ID: 1104653088

View in Genome Browser
Species Human (GRCh38)
Location 12:130551676-130551698
Sequence GAAAATGCACAGATAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 562}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104653085_1104653088 17 Left 1104653085 12:130551636-130551658 CCCTGTGTCCAATTTATAGAATT 0: 1
1: 0
2: 1
3: 20
4: 261
Right 1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG 0: 1
1: 0
2: 1
3: 55
4: 562
1104653086_1104653088 16 Left 1104653086 12:130551637-130551659 CCTGTGTCCAATTTATAGAATTG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG 0: 1
1: 0
2: 1
3: 55
4: 562
1104653087_1104653088 9 Left 1104653087 12:130551644-130551666 CCAATTTATAGAATTGTGCATTC 0: 1
1: 0
2: 3
3: 16
4: 241
Right 1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG 0: 1
1: 0
2: 1
3: 55
4: 562
1104653084_1104653088 30 Left 1104653084 12:130551623-130551645 CCTATAATTAGTTCCCTGTGTCC 0: 1
1: 0
2: 2
3: 11
4: 133
Right 1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG 0: 1
1: 0
2: 1
3: 55
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104653088 Original CRISPR GAAAATGCACAGATAGAGCA AGG Intronic
900865633 1:5266865-5266887 GAGAATGAACAGAAAGCGCAGGG + Intergenic
901471932 1:9463130-9463152 AAAAATGGACAGATTGGGCATGG - Intergenic
901646520 1:10719777-10719799 AAAACTGCACACAAAGAGCATGG + Intronic
902541217 1:17156496-17156518 CAAAATGCACAAACAAAGCAAGG - Intergenic
903920867 1:26799733-26799755 GAAAATGTACACACAGATCAGGG + Intergenic
904132210 1:28283282-28283304 GAAAATGAACAGATACCTCAAGG - Intergenic
904377008 1:30088018-30088040 GATAAAGCACAGATATAGAAAGG - Intergenic
904944161 1:34187139-34187161 GAAAATGAAAATATAGAGCCTGG - Intronic
905011988 1:34753932-34753954 GAAAAGACACAGAGAGAGAAGGG - Intronic
905178707 1:36153941-36153963 AAAAATGAACAGATAGGCCAGGG - Intronic
905529387 1:38664601-38664623 GAGAATGCAGAGTTAGACCATGG - Intergenic
906442391 1:45859887-45859909 TAAAAAGAACAGAAAGAGCAGGG - Intronic
906882985 1:49613012-49613034 GAAAATGTACATATACATCATGG + Intronic
908358574 1:63345875-63345897 GAAAATGCACAAATAGATACTGG - Intergenic
908609919 1:65846238-65846260 GAGAAAGCACAGAGAGAGGAGGG + Intronic
908912192 1:69084930-69084952 GAAAATAAACTAATAGAGCAAGG - Intergenic
908934385 1:69357214-69357236 CAAAATGCACAAACAAAGCAAGG + Intergenic
909053833 1:70799671-70799693 GAAAATGAACATATACACCATGG + Intergenic
909520124 1:76558372-76558394 GAAAATGTACATATACACCATGG + Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
909951157 1:81721995-81722017 GAAAATGCAGAGATAGGACCAGG + Intronic
910148230 1:84108106-84108128 GAAAATGTACATATACACCATGG + Intronic
910434543 1:87191833-87191855 AAAAATGCACAGATTGTGGAGGG - Intergenic
910809801 1:91224536-91224558 CAAAATGCACAAACAAAGCAAGG - Intergenic
911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG + Exonic
911734717 1:101324468-101324490 CAAAATGCACAAACAAAGCAAGG - Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912869133 1:113287962-113287984 GAAGAGGCACAGAAAGAGAAAGG + Intergenic
913388813 1:118288223-118288245 GCAAATGTTCTGATAGAGCAGGG + Intergenic
913963233 1:143354730-143354752 AAAGATGCACAGAGAGACCAAGG - Intergenic
914057589 1:144180316-144180338 AAAGATGCACAGAGAGACCAAGG - Intergenic
914121557 1:144786050-144786072 AAAGATGCACAGAGAGACCAAGG + Intergenic
914697942 1:150102653-150102675 GAAAATGTACATATACACCATGG + Intronic
914956351 1:152166203-152166225 CAAAATGCACAAACAAAGCAAGG + Intergenic
915697917 1:157762984-157763006 GAAAATGCATAGGTAAAGCCAGG + Intronic
916483436 1:165235860-165235882 GAAAATGCAGATAAAGAGCCCGG - Intronic
916897402 1:169179588-169179610 GAAAATGTACATATACACCATGG + Intronic
917898989 1:179522926-179522948 GAAAATGCACAAATAAATTATGG - Intronic
918568404 1:185957581-185957603 GAATATGCTCAGATTGAACAAGG - Intronic
919194159 1:194262697-194262719 GAAAATGTACATATACAACATGG + Intergenic
919459345 1:197857896-197857918 CAAAATGCAGTGGTAGAGCAGGG + Intergenic
921766472 1:218978476-218978498 GAAAAGGCATAGATATACCATGG - Intergenic
922349436 1:224723328-224723350 GAAAAGGCACAGAGAGAGAAGGG - Intronic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
923139509 1:231149120-231149142 GAAAAGGCACAGTTAAAACATGG - Intergenic
923485512 1:234426194-234426216 GAATGTGCACCGATAGTGCATGG - Intronic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1063450977 10:6149941-6149963 GAAAATGTACATATACAACATGG - Intronic
1063552767 10:7048849-7048871 GAAAATGTACAGTAAGAACATGG + Intergenic
1063856136 10:10256226-10256248 TAAAATGCACACATAAAGCATGG - Intergenic
1064207345 10:13335373-13335395 AAAAATGCACAGGTCGGGCACGG + Intronic
1064408382 10:15084469-15084491 CAAAATGCACAAACAAAGCAAGG + Intronic
1064798291 10:19039119-19039141 GAAAATGTACATATACACCATGG + Intergenic
1065850236 10:29781706-29781728 CAAAATGCACAAACAAAGCAAGG + Intergenic
1066119092 10:32266440-32266462 GAAATCCAACAGATAGAGCAAGG - Intergenic
1066173647 10:32879912-32879934 GAAAATGTACATATACACCATGG - Intronic
1066266748 10:33783260-33783282 CCAAGTGCTCAGATAGAGCACGG - Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1066540155 10:36437815-36437837 GAAAAAGCAAAGATAAAGAATGG - Intergenic
1066808604 10:39293215-39293237 GAATCTGCACAGATATAGCTGGG - Intergenic
1067184243 10:44013654-44013676 GAAGATGCAGAGATACAGAAAGG - Intergenic
1067184777 10:44017287-44017309 GAGAATTCAGAAATAGAGCAGGG + Intergenic
1067929813 10:50549324-50549346 GAAAATGTACATATACACCATGG + Intronic
1068106502 10:52623536-52623558 GAACATGCAGAGAAATAGCAAGG + Intergenic
1068189597 10:53634099-53634121 GAAAAGGCAAAAACAGAGCATGG + Intergenic
1068217888 10:54007137-54007159 GAAAATACACAGAAAGAAAAGGG - Intronic
1068587681 10:58817508-58817530 GTAAATGCCCAGAGAGAACATGG - Intronic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1068938919 10:62661937-62661959 CAAAATGCACAAACAAAGCAAGG + Intronic
1070579296 10:77707618-77707640 GAAAATGTACAGATACACAATGG + Intergenic
1070623978 10:78035859-78035881 TAAAATGCACAGGTGGAGTACGG + Intronic
1070767609 10:79065823-79065845 GAAGATGAACAAAGAGAGCAAGG + Intergenic
1072639451 10:97200489-97200511 GATAAGGCACAGAAGGAGCACGG - Intronic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1073828093 10:107349051-107349073 GAAAAGGCACATATATACCATGG - Intergenic
1074124419 10:110516768-110516790 AAAAATGCACAGATACTTCAAGG - Intergenic
1074163655 10:110856076-110856098 AAAAAAGCAGAGAGAGAGCAAGG - Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1075188079 10:120281375-120281397 GGAAATGCACATATACACCATGG + Intergenic
1075500503 10:122969439-122969461 GAAAATGTACATATACACCATGG + Intronic
1075603090 10:123785161-123785183 CAAAATGCACAAACAAAGCAAGG - Intronic
1076327192 10:129634356-129634378 GCAAATGCACAGATACAAGATGG - Intronic
1076593678 10:131609995-131610017 GAAAAAACCCAAATAGAGCAAGG + Intergenic
1077827263 11:5824717-5824739 CAAAATGCACAAACAAAGCAAGG - Intronic
1078113271 11:8418448-8418470 GAAAATGTACATATACACCATGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078502498 11:11895300-11895322 GAAAATGTACAGGTAGGGAAAGG - Intronic
1078556833 11:12334813-12334835 GAAAATGTACATATACACCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1078645625 11:13139280-13139302 GAAAATGTACATATACATCATGG - Intergenic
1079717291 11:23764356-23764378 AAGAATGCAGACATAGAGCATGG + Intergenic
1079742132 11:24076076-24076098 GAAAATGCAAAAACAAAGCAAGG + Intergenic
1080487923 11:32730618-32730640 GAAAATACCCAGATACATCATGG - Intronic
1080643560 11:34172745-34172767 GATAATGCACATAAAGAGGAAGG + Intronic
1080870573 11:36233311-36233333 TAAAATACTCAGCTAGAGCAGGG + Intergenic
1080925158 11:36748546-36748568 CAAAATGCAAAGAGAGAACAAGG - Intergenic
1081517337 11:43845968-43845990 GAAAAGTCACAGCTAAAGCATGG + Intronic
1081636315 11:44724862-44724884 GCTAATGCACAGATAGGGCCAGG + Intergenic
1082702619 11:56451724-56451746 GAAAATGTACAGATACGCCATGG - Intergenic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1082778023 11:57262951-57262973 CAAAATGCACAAACAAAGCAAGG - Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1085997824 11:81942960-81942982 GATAATGCTAAGATAGAGAAAGG - Intergenic
1086534557 11:87829318-87829340 GAAAATGAACTGATACAACAGGG - Intergenic
1087720723 11:101662495-101662517 GAAAATGTACATATATACCATGG - Intronic
1088497999 11:110451716-110451738 GAAAATGTACATATACACCATGG + Intronic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1092486581 12:8907502-8907524 CAAAATGCACAAACAAAGCAAGG + Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1093071767 12:14713236-14713258 CAAAATGCACAAACAAAGCAAGG - Intergenic
1093097765 12:14991542-14991564 GAAAATGTACATATACACCATGG + Intergenic
1094668609 12:32546635-32546657 GAAACTGCAGCCATAGAGCATGG + Intronic
1095180057 12:39137260-39137282 CAAAATGCACAAACAAAGCAAGG + Intergenic
1095215069 12:39538505-39538527 CAAAATGCACAAACAAAGCAAGG - Intergenic
1095258978 12:40076515-40076537 GAAAATGTACATATACACCATGG - Intronic
1095391048 12:41707061-41707083 GAAAATGTACATATACACCATGG - Intergenic
1096713930 12:53479489-53479511 GAAACTACACAGATGGATCATGG - Exonic
1096912843 12:55001376-55001398 GAAAAGGCACAAATAGACCAGGG + Intergenic
1096970926 12:55665718-55665740 CAAAATGCACAAACAAAGCAAGG + Intergenic
1097367847 12:58739845-58739867 GAAAATGTACATATACACCATGG - Intronic
1097375335 12:58836407-58836429 GAAAATGTACATATACACCATGG - Intergenic
1097673433 12:62569374-62569396 GAAAATTCAAAGATAGAGGAAGG + Intronic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1098206468 12:68115617-68115639 GAAAAGCCACAGTTAGAACAGGG + Intergenic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1098695704 12:73551646-73551668 CAAAATGCACAAACAAAGCAAGG + Intergenic
1098938915 12:76512332-76512354 GAAAATGTACATATACACCATGG - Intronic
1099241332 12:80142849-80142871 GAAGATGTAGAGATACAGCAGGG + Intergenic
1099745787 12:86702869-86702891 GAGAATCCACTGATAGATCAAGG + Intronic
1100137724 12:91574341-91574363 GACATGGCACAGATAGAGAAAGG + Intergenic
1100277298 12:93082739-93082761 GATCATGCACAGGTAGAGCCAGG + Intergenic
1101045672 12:100803297-100803319 GAACATGCAAAAATTGAGCAAGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1102341797 12:112127177-112127199 GAAAAGACAAAGATAGAGGATGG - Intronic
1103866877 12:124059661-124059683 GAAAATGTACATATACACCATGG - Intronic
1104147793 12:126052637-126052659 GAAAATGCACAGTAAAACCACGG + Intergenic
1104262353 12:127196101-127196123 GAAAATGTACATATACATCATGG + Intergenic
1104489509 12:129181829-129181851 GAAAATGGACAAATAAAGGATGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104877433 12:132045404-132045426 GAAAATTCGCAGAGAGGGCAAGG + Exonic
1105938297 13:25122002-25122024 GAAAATACACAGTCAGAGGAGGG + Intergenic
1106048465 13:26167828-26167850 GAAAATGTACATATACACCATGG + Intronic
1106367882 13:29100934-29100956 GACAGTGCACAGCCAGAGCAGGG + Exonic
1106547802 13:30745383-30745405 GAAAATGCCCACAGAGGGCAAGG - Intronic
1106601602 13:31192289-31192311 CAAAACGCACAAATAAAGCAAGG - Intergenic
1106607823 13:31247566-31247588 GAAAAAGCATATATAGGGCAGGG - Intronic
1107111309 13:36701061-36701083 CAAAATGCACAAACAAAGCAAGG + Intergenic
1107483258 13:40802865-40802887 GCAAAAGCACAGATGGGGCAGGG - Intronic
1107530504 13:41278287-41278309 CAAAATGCACAAACAAAGCAAGG + Intergenic
1107738338 13:43421673-43421695 GAAAGTGCTGGGATAGAGCAAGG - Intronic
1108650018 13:52468738-52468760 GAAAATGTACATATACACCATGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108714980 13:53069983-53070005 GAGATTGCACAGGTAGAGCCTGG - Intergenic
1108997301 13:56749844-56749866 GAAAATGAACACATTAAGCAAGG - Intergenic
1108999770 13:56783896-56783918 AAAAATGAACAAATTGAGCATGG + Intergenic
1109167582 13:59055297-59055319 GAAAATGTACATATACACCATGG + Intergenic
1109488357 13:63058385-63058407 CAAAATGCACAAACAAAGCAAGG - Intergenic
1109783091 13:67138721-67138743 CAAAATGCACAAACAAAGCAAGG - Intronic
1110418067 13:75273804-75273826 CAAAATGCACAAACAAAGCAAGG + Intergenic
1110442698 13:75542964-75542986 GAAAATGTACATATACACCATGG + Intronic
1110555617 13:76856118-76856140 CAACATGCACAGACAAAGCAAGG + Intergenic
1111594764 13:90397025-90397047 CAAAATGCACAAACAAAGCAAGG - Intergenic
1111706669 13:91758639-91758661 GAAAAAGCACAGAGTTAGCAAGG + Intronic
1112002126 13:95220668-95220690 AAAAATGCACAGAGAGAGGAGGG + Intronic
1112130032 13:96513249-96513271 AAAAATACACAGAAAGATCAAGG - Intronic
1112404274 13:99104389-99104411 CAAAATGCACAAACAAAGCAAGG + Intergenic
1112824465 13:103375968-103375990 GAAAATGTACATATACGGCATGG + Intergenic
1113285760 13:108847277-108847299 AATAATGCATAAATAGAGCATGG - Intronic
1113710753 13:112463501-112463523 GAAAAGGCACAGATCAAGAAAGG + Intergenic
1114338961 14:21723333-21723355 GAAAATGCACAGAAAAAGAAAGG - Intergenic
1114908066 14:27155051-27155073 GTAAATGAATAGATAGATCATGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115620162 14:35133212-35133234 GAAAATACACAGTTAGGGCTGGG - Intronic
1116520315 14:45838907-45838929 AAAAATGCTCACACAGAGCAGGG + Intergenic
1116544269 14:46143549-46143571 GAAATTGCTGAGATAGAGCAGGG + Intergenic
1116726510 14:48566972-48566994 CAAAATGCACACATAAAGCAAGG + Intergenic
1116799868 14:49431425-49431447 TAAAATGCACAGAGAGGGCCAGG + Intergenic
1116845163 14:49858592-49858614 GACTATTCACAGATAGAGAAGGG - Intergenic
1116866023 14:50032328-50032350 ACAGATGCACAGAGAGAGCAGGG + Intergenic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1119159082 14:72438287-72438309 GAAAATGCAGAGAGAGAAGAGGG - Intronic
1119729019 14:76939425-76939447 GAAAATGAACAGAATGAACAGGG - Intergenic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120064669 14:80027146-80027168 AAATATGCACAAATAGACCAAGG + Intergenic
1120625115 14:86815862-86815884 GAAAATGTACATATATACCATGG + Intergenic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1122757465 14:103993561-103993583 GAAGAGGCTCAGAAAGAGCATGG - Intronic
1126183937 15:45812121-45812143 CAAAATGCACAAACAAAGCAAGG + Intergenic
1127154876 15:56113282-56113304 GAAAATGTACATATACACCATGG + Intronic
1127707660 15:61562976-61562998 GAAGGTGCAGAGAAAGAGCATGG - Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1129040717 15:72684124-72684146 CAAAATGCACAAACAAAGCAAGG + Intronic
1129063096 15:72876778-72876800 CAAAATGCACAAACAAAGCAAGG - Intergenic
1129260481 15:74364616-74364638 CAAAATGCACAGACAAAGTAAGG - Intronic
1129506566 15:76086481-76086503 CAAAATGCACAAACAAAGCAAGG + Intronic
1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG + Intergenic
1129972249 15:79789049-79789071 GAAAGTGCATAGATTGAGGAGGG + Intergenic
1130312067 15:82764783-82764805 CAAAATGCACAAACAAAGCAAGG - Intronic
1130459833 15:84152692-84152714 GATAAAGCACAGACAGAGCCAGG - Intergenic
1130505860 15:84541249-84541271 TAAAATGCTTAGACAGAGCAGGG - Intergenic
1130768490 15:86899168-86899190 GAAAATGTACATATACACCATGG + Intronic
1130931786 15:88433890-88433912 GGAGATGAACAGACAGAGCAGGG - Intergenic
1132477300 16:147014-147036 GAAAATGAACACATATAACATGG + Intergenic
1132783100 16:1639256-1639278 CAAAATGCACAAACAAAGCAAGG + Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135788670 16:25373561-25373583 CAAAATGCACAAACAAAGCAAGG + Intergenic
1135837947 16:25844831-25844853 GAAAATGTACATATACACCAGGG + Intronic
1137241890 16:46662521-46662543 GAAAATGCTCAACTAGAGGATGG - Intronic
1138325955 16:56168281-56168303 GAAAAAGCACACCTAGAGGAAGG - Intergenic
1138378834 16:56586339-56586361 GAAAAAGGGAAGATAGAGCAAGG + Intergenic
1139743450 16:69055283-69055305 GGAAAAGCAGAGATAGAGCTGGG + Intronic
1140115044 16:72034608-72034630 CAAAATGCACAAACAGAGCAAGG - Intergenic
1140208024 16:72949344-72949366 GAAAATGAAAAGAGAGAGCGAGG + Intronic
1140655796 16:77138001-77138023 GAAAATGTACATATACACCATGG - Intergenic
1140803054 16:78506522-78506544 GAAAAGGGACAGATATAGAAAGG - Intronic
1141049544 16:80747954-80747976 GAAAATGAACAAATATAGAATGG - Intronic
1141417024 16:83883610-83883632 CAAAATGCATAAATAAAGCATGG - Intergenic
1143330337 17:6130281-6130303 GAGAATGCAGAGACACAGCAAGG + Intergenic
1143601688 17:7950740-7950762 GAAAATGTACATATACACCATGG + Intergenic
1143988768 17:10938828-10938850 GAAAATGCACAGGTACTGGAGGG + Intergenic
1145212273 17:21022959-21022981 GAAAATGTACATATATACCATGG + Intronic
1146535574 17:33647775-33647797 GAAAATGCCCAATTAGAGCAGGG + Intronic
1146619582 17:34387074-34387096 GTAAATGCTCAGAGAGAGCTTGG + Intergenic
1147619645 17:41857033-41857055 TAAAAAGCACATATAGAGCTGGG + Intronic
1148947981 17:51282458-51282480 GAAAATGAAGAGAAAGAGGAAGG + Intronic
1149271249 17:54980422-54980444 CAAAATGCACAAACAAAGCAAGG + Intronic
1150743138 17:67795724-67795746 GAACAAGCAAAGAGAGAGCATGG - Intergenic
1151436197 17:74099325-74099347 GAAAATGCCCAGGGAAAGCAAGG + Intergenic
1153168779 18:2292162-2292184 CAAAATGCACAAACAAAGCAAGG - Intergenic
1153261739 18:3230836-3230858 CAAAATGCACAAACAAAGCAAGG - Intergenic
1153740085 18:8115789-8115811 GAAAATGCACATGTACATCATGG - Intronic
1154113076 18:11586973-11586995 CAAAATGCACAAACAAAGCAAGG - Intergenic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1155583148 18:27335028-27335050 CAAAATGCACAGAAATTGCAAGG - Intergenic
1155662375 18:28264773-28264795 GAAAATGTACATATACACCATGG - Intergenic
1155803268 18:30135869-30135891 CAAAATGCACAAACAAAGCAAGG + Intergenic
1156039759 18:32807344-32807366 GAAAATCCACACAAAGAACATGG + Intergenic
1156238369 18:35227123-35227145 CAAAATGCACAAACAAAGCAAGG + Intergenic
1157013739 18:43683325-43683347 CAAAATGCACAAACAAAGCAAGG + Intergenic
1157352869 18:46905978-46906000 AAAAAGGAACAGATAGATCAGGG + Intronic
1158625989 18:59072063-59072085 CAAAATGCACAAACAAAGCAAGG - Intergenic
1158671145 18:59475017-59475039 GAAAATGCACAAAATGGGCAGGG - Intronic
1158678651 18:59546615-59546637 GAAAATACAAAAATAGATCAAGG - Intronic
1158842564 18:61403864-61403886 GAAAATGTACATATACACCATGG + Intronic
1159429437 18:68332369-68332391 GAAAAGGCACAGATATACCCAGG + Intergenic
1159733212 18:72058761-72058783 AAAAATACACAGATATAACAAGG + Intergenic
1159863239 18:73673972-73673994 GAAAATGTACAGAATGAGCCTGG - Intergenic
1160035427 18:75297150-75297172 AAAAAATCACAGAAAGAGCATGG + Intergenic
1164280625 19:23765419-23765441 GAAAATGTACATATAAAACATGG + Intronic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1164938577 19:32233524-32233546 AAAAATGCAAAAATAGGGCATGG - Intergenic
1164975036 19:32566535-32566557 GAAAATGAACAGTAAGGGCATGG + Intergenic
1167394311 19:49217806-49217828 GAAGACGCACAGGTAGAGGAGGG - Intergenic
1167900587 19:52618879-52618901 GAAAATGCAAAGATACACAAGGG + Intronic
1202697072 1_KI270712v1_random:132989-133011 AAAGATGCACAGAGAGACCAAGG - Intergenic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925543978 2:4999037-4999059 GAAAAGGCAGAACTAGAGCATGG + Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925956903 2:8975457-8975479 TGAAAGGCACAGATAGAGCCAGG - Intronic
926698565 2:15787482-15787504 GAAAGTCCACAGAGAAAGCAGGG + Intergenic
927155122 2:20216896-20216918 GAAGATCCACAGAGAGAGCCAGG + Intronic
927283394 2:21331515-21331537 GAAAATACACAGATAAAGTCTGG - Intergenic
927398079 2:22678503-22678525 GAATATGCACTGATACAGCCAGG + Intergenic
927567929 2:24130171-24130193 GAAAATGTACATATACACCATGG - Intronic
928105357 2:28467366-28467388 GAAAATACATAGATACAGAAAGG + Intronic
928738141 2:34316719-34316741 GAGAATGTAAAGATAGAGTAAGG + Intergenic
929153021 2:38764901-38764923 GAAAATCCACATAAAGAGTATGG + Intronic
929212089 2:39368262-39368284 GAAAAAGGAAAAATAGAGCACGG + Intronic
930692841 2:54381906-54381928 GAAAAGGAACAGAGAGATCACGG + Intronic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932358302 2:71084989-71085011 CAAAATGCACAAACAAAGCAAGG - Intergenic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
933117108 2:78487841-78487863 GAAAACCCACCGATAGACCAAGG - Intergenic
933660690 2:84925209-84925231 CAAAATGCACAAACAAAGCAAGG - Intergenic
934278233 2:91590003-91590025 AAAGATGCACAGAGAGACCAAGG - Intergenic
934791590 2:97066984-97067006 GGACAGGCACAGATAGAGCAAGG + Intergenic
934814846 2:97315559-97315581 GGACAGGCGCAGATAGAGCAAGG - Intergenic
934818548 2:97351825-97351847 CAAAATGCACAAACAAAGCAAGG - Intergenic
934822849 2:97392924-97392946 GGACAGGCGCAGATAGAGCAAGG + Intergenic
935309236 2:101766836-101766858 CAAAATGCACAAACAAAGCAAGG + Intronic
936754801 2:115694962-115694984 GAAATTGCAGATATAGAGGAAGG + Intronic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
938030364 2:127987061-127987083 GAAATTGGACAGTTAGAACATGG - Intronic
938236180 2:129708849-129708871 CAAAATGCACAAACAAAGCAAGG + Intergenic
939257830 2:139767433-139767455 GAATATGCACATATAGGGCCAGG + Intergenic
939423818 2:142008389-142008411 GAAAATGCACTGTGTGAGCACGG + Intronic
939685096 2:145189279-145189301 GAAAATGCCTAGATAGGGCTGGG + Intergenic
939881024 2:147631587-147631609 GAAACTTCACAGCTAGAGCCTGG + Intergenic
940166592 2:150780427-150780449 GAAAAGGCACAGACAGAGGAAGG - Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940549633 2:155137428-155137450 GAAAATGCCTAGATAGAGATAGG - Intergenic
940559660 2:155279878-155279900 GAAAATACACAGACAGAAGAGGG - Intergenic
940569443 2:155411349-155411371 CAAAATGCACAAACAAAGCAAGG - Intergenic
940675152 2:156718255-156718277 GAAAATGTACATATACACCATGG + Intergenic
941256602 2:163240102-163240124 GAAAATGAACAATTAGATCAAGG - Intergenic
941370694 2:164659813-164659835 GACAATCTATAGATAGAGCAAGG - Intronic
942235550 2:173900953-173900975 TAAAGTTCACAGAAAGAGCAAGG + Intergenic
943200874 2:184822192-184822214 GAAAATGTACATATACACCATGG + Intronic
943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG + Intergenic
944240370 2:197480147-197480169 GCAAATGCACTAATAGAGAAGGG - Intergenic
944500561 2:200355080-200355102 GAAAAGGGAGAGATAGAGGAAGG - Intronic
945038302 2:205723108-205723130 GATAAGGCACAGATAGGGTAAGG - Intronic
945168617 2:206972460-206972482 GAAAAAGCACTGATAGAGTTTGG - Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945621052 2:212137535-212137557 GAAAATGTACATATACACCATGG - Intronic
948154858 2:235773053-235773075 CAAAATGCACAAACAAAGCAAGG + Intronic
948272307 2:236683898-236683920 CAAAATGCACAAACAAAGCAAGG + Intergenic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
1169107875 20:3012594-3012616 GAGAAGGCAAAGATAAAGCATGG + Intronic
1169769535 20:9185920-9185942 GAAAAAGCAAAAATAGAGAACGG - Intronic
1169789239 20:9392213-9392235 CAAAATGCACAAACAAAGCAAGG + Intronic
1169981134 20:11385177-11385199 GAAACTGCTCAGATGGGGCAAGG - Intergenic
1170363679 20:15576397-15576419 GGAGATGCAGAGATAGAGGAAGG - Intronic
1170839994 20:19916903-19916925 TCAAATGCACAGATGGAGCCAGG - Intronic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1172129927 20:32648798-32648820 AAAATTGCACAGATAGTACAGGG + Intergenic
1172343877 20:34181483-34181505 CAAAATGCACAAACAAAGCAAGG + Intergenic
1172402486 20:34661577-34661599 GAAAATGTACATATACACCATGG - Intronic
1172671007 20:36634442-36634464 GAATATGCACTAATAGAGCCAGG - Intronic
1173262781 20:41451478-41451500 GAAAAGGCACAGACAGAGGTGGG + Intronic
1173555560 20:43963138-43963160 GAAAGAGCACAGTTAGAGCGAGG + Intronic
1173739172 20:45384593-45384615 GCAAATGCACAGAAAAAGGAAGG - Intronic
1175089976 20:56494444-56494466 GTAAATGCTCAGAAAAAGCAGGG - Intronic
1175587651 20:60157617-60157639 GAAAATGTACATATACACCATGG + Intergenic
1177760226 21:25394924-25394946 GAAAGTGCACAGATAGGCCTCGG - Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1179045895 21:37844767-37844789 GAAAATGGTCAGAAAGAGCAGGG - Intronic
1179086995 21:38226848-38226870 GAAAATGCACTGAAGGAGGATGG - Intronic
1180657368 22:17434180-17434202 GAGAATGAACAGTTAAAGCATGG + Intronic
1180665819 22:17511245-17511267 GAAATTTCAAAGAAAGAGCATGG - Intronic
1181395367 22:22617657-22617679 GAAAATACACAGGTAGAAGATGG + Intergenic
1182593913 22:31403370-31403392 GAAAATGCAGAGAAAGGGCCGGG + Intronic
1182649719 22:31841419-31841441 CAAAATGCACAAACAAAGCAAGG + Intronic
1182758784 22:32704425-32704447 GAAAATGTACATATACACCATGG - Intronic
1184081267 22:42222059-42222081 GACCATGCAGAGACAGAGCAAGG + Intronic
1184168869 22:42746969-42746991 CAAAATGCACAAACAAAGCAAGG - Intergenic
1184320869 22:43741319-43741341 GAAAAGGGGCAGATAAAGCAGGG - Intronic
1184508303 22:44917329-44917351 GAAAATGCACAGGAAGTGCTGGG + Intronic
1184752425 22:46495341-46495363 GAAAAGGCACAGTGAGAACATGG + Intronic
949386861 3:3512524-3512546 GAAAATGTACATATACACCATGG + Intergenic
949575031 3:5330885-5330907 GAAAATGGACTGATACAGGAGGG - Intergenic
952025808 3:29080506-29080528 GAAGATGCACAGCTAGAGGCTGG + Intergenic
952262558 3:31754479-31754501 GAAAAGACACAGAAAGAGAAGGG + Intronic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955411095 3:58655989-58656011 AAAAGTGAACAGATAGAGGATGG - Intronic
956350746 3:68333276-68333298 GAAAATGCAAATATACACCATGG + Intronic
957157318 3:76561583-76561605 CAAAAGGCAAAGATAGAACAAGG + Intronic
957719221 3:83972088-83972110 CAAAATGCACAAACAAAGCAAGG - Intergenic
957916047 3:86689044-86689066 GAAAATGCAGGGATTGAGAAAGG + Intergenic
959222280 3:103535687-103535709 CAAAATGCACAAACAAAGCAAGG - Intergenic
960198420 3:114799820-114799842 GATGATGCACGGACAGAGCAAGG - Intronic
960221531 3:115116261-115116283 TAATATGCCCAGATAGAGCTGGG - Intronic
960561242 3:119085867-119085889 CAAAATGCACAAACAAAGCAAGG + Intronic
960833345 3:121875593-121875615 CAAAATTAACAGTTAGAGCAGGG + Intronic
962246288 3:133796648-133796670 CAAAATGCACAAACAAAGCAAGG - Intronic
962331026 3:134478535-134478557 CAAAGTACACAGATAAAGCATGG - Exonic
962531588 3:136286102-136286124 GTAAATGGACAGAAAGACCAAGG + Intronic
963471466 3:145747419-145747441 GAAAATGAACTAATACAGCATGG - Intergenic
963993741 3:151683073-151683095 AAAAATGAACACATAGACCATGG + Intergenic
964208981 3:154207876-154207898 GAAAATGTACATATACACCATGG + Intronic
964510657 3:157447326-157447348 GACAATGCACATATGGATCAAGG - Intronic
965797406 3:172455145-172455167 GAAAATACACATTTATAGCAGGG + Intergenic
965849750 3:173009774-173009796 GAAAATGCACACACAAAGCAAGG + Intronic
965902180 3:173655882-173655904 CAAAATGCACAGACAAAGCAAGG + Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
966225620 3:177594341-177594363 GGAAATGCACAGATAGGCCTAGG + Intergenic
966517763 3:180837974-180837996 GAAAATGTACATATACACCATGG + Intronic
967866002 3:194190362-194190384 GAAAATGTACATATACACCATGG - Intergenic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
968333265 3:197890097-197890119 AAAAATGCACAGATAATGCCAGG + Intronic
969032517 4:4226329-4226351 AAAGATGCACAGAGAGACCAAGG + Intronic
970044362 4:11833743-11833765 GAAAATGTACATATATACCATGG - Intergenic
970811066 4:20094578-20094600 CAAAATGCACAAACAAAGCAAGG - Intergenic
971432438 4:26582379-26582401 GAAAAGGCATAGATAGTGCCTGG - Intronic
971479813 4:27104378-27104400 GAAACAGCTCAGATAGATCATGG - Intergenic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
971729350 4:30357198-30357220 GAAAATGTACATATACACCATGG - Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
972186911 4:36540590-36540612 GAAAATGATCAGAAAGAGAATGG - Intergenic
972391769 4:38620308-38620330 GAAAATGCAAAAATAGAAAAAGG + Intergenic
972892223 4:43572500-43572522 AAAAATGTACAGACAGATCAGGG + Intergenic
973064575 4:45772844-45772866 GAAAATGCACATATACCCCATGG - Intergenic
973263720 4:48189507-48189529 GAAAATGCAGAAATAGACAATGG + Intronic
973794949 4:54415825-54415847 CAAAATGCACAAACAAAGCAAGG + Intergenic
973875756 4:55216942-55216964 GTAAATGCATTCATAGAGCATGG + Intergenic
974713267 4:65631192-65631214 GAAAATGCACAGTGAAGGCAGGG - Intronic
975140660 4:70915311-70915333 CAAAATGCACAGACAAAACAAGG + Intronic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976558121 4:86472999-86473021 CAAAATGCACAAACAAAGCAAGG - Intronic
977310831 4:95384958-95384980 GAGAATGTACAGATAGGACAGGG + Intronic
978416753 4:108485027-108485049 GAAAATAGACAGATAGATGAAGG + Intergenic
978793533 4:112686851-112686873 GCAAATGCAAAGACAGAGAAGGG + Intergenic
978950539 4:114553940-114553962 CAAAATGCACAAACAAAGCAAGG + Intergenic
980267838 4:130543004-130543026 GAAAATGCACAAACAAAGCAAGG + Intergenic
980519493 4:133911925-133911947 GAAAATGTACATATAAACCATGG + Intergenic
980751868 4:137100891-137100913 GAAAATGTACATATACATCAAGG + Intergenic
980889536 4:138799718-138799740 GAAAATGATCAGATAGATAAAGG + Intergenic
981538836 4:145827291-145827313 GAAAAGGAAGAGATAGAGAAGGG + Intronic
981924394 4:150122386-150122408 GCAAATGCACATATACACCATGG + Intronic
982195204 4:152904755-152904777 GAAAATGTACATATACACCATGG - Intronic
982540502 4:156664112-156664134 TAAAAAGTACAGACAGAGCAAGG + Intergenic
982632735 4:157852773-157852795 GAAAATGTACATATACACCATGG - Intergenic
982974183 4:162032458-162032480 GAAAATGCACAGAAATAGTTTGG + Intronic
984017788 4:174446189-174446211 CAAAATGCACAAACAAAGCAAGG - Intergenic
984473897 4:180213433-180213455 GAAAACCCACAGAGAGATCAAGG + Intergenic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
985236029 4:187875358-187875380 GAAAATGTACATATATACCATGG - Intergenic
985501659 5:251535-251557 GAAAATGCAGAGAAAATGCAGGG - Intronic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986134553 5:4963097-4963119 GAAAATAGACACATAGATCAAGG + Intergenic
986296280 5:6441338-6441360 GAAAATGTACATATACACCAAGG - Intergenic
986945393 5:13012287-13012309 GAAACTGTACAGATACACCATGG - Intergenic
987244921 5:16039134-16039156 GAAAATGCACAATTAGAGTGGGG - Intergenic
987350900 5:17020891-17020913 CAAAATGCACAAACAAAGCAAGG + Intergenic
987490515 5:18575280-18575302 GAAAATGTACATATACACCATGG + Intergenic
987618948 5:20313695-20313717 GATAGTGCACAGTTAGAACATGG + Intronic
987841705 5:23231056-23231078 CAAAATGCACAAACAAAGCAAGG + Intergenic
989244637 5:39240950-39240972 GAAAATGTACATATACACCATGG + Intronic
989340955 5:40375159-40375181 AAAAATGCACATAAATAGCACGG + Intergenic
989436067 5:41415244-41415266 TAAAAAGTACAGAAAGAGCAGGG - Intronic
989735206 5:44695330-44695352 CAAAATGCACAAACAAAGCAAGG + Intergenic
990090350 5:52038636-52038658 GAAAGTGCAGAAATAGTGCAGGG - Intronic
990791157 5:59481551-59481573 CCAAATGCACCCATAGAGCAGGG - Intronic
992030508 5:72716688-72716710 GAGAAAGCACTGATAGAGAATGG + Intergenic
992833066 5:80614418-80614440 GAATATGGAGAGATGGAGCAAGG - Intergenic
993221390 5:85101931-85101953 GAAAATGTACATATACACCATGG + Intergenic
993745491 5:91592242-91592264 TAAAATGCACAGTAAAAGCATGG - Intergenic
993794981 5:92255808-92255830 AAAAATGCACATATACACCATGG - Intergenic
994351184 5:98748407-98748429 GAAAATGTACATATACACCATGG + Intergenic
994631912 5:102296963-102296985 GAAAACGCACAAACAAAGCAAGG + Intergenic
995431082 5:112078310-112078332 GAAAATGTACACATACATCATGG - Intergenic
995562532 5:113398461-113398483 GAAAATGCACATATATACCATGG + Intronic
995950755 5:117710314-117710336 GAAGATACACAGATAGTGAATGG - Intergenic
996120394 5:119665404-119665426 CAAAATGCACAAACAAAGCAAGG + Intergenic
996273367 5:121635970-121635992 CAAAATGCACAAACAAAGCAAGG - Intergenic
996642580 5:125774801-125774823 GGAAATGCAGAGATAAGGCAAGG - Intergenic
997099455 5:130952880-130952902 GATAATCCATAGATAGAGTAGGG + Intergenic
997342859 5:133159406-133159428 TAAAAGGCACAGATAGAGGGAGG + Intergenic
997785993 5:136714512-136714534 GAAAATGTACATATACACCATGG - Intergenic
998992548 5:147833873-147833895 GGAAATGACCAGATTGAGCAAGG - Intergenic
999362527 5:150998016-150998038 CAAAATGCACAAACAAAGCAAGG + Intergenic
999526743 5:152414586-152414608 CAAAATGCACAAACAAAGCAAGG - Intronic
1000003193 5:157159671-157159693 GGAAATGCAGAGAAAGTGCATGG + Intronic
1000698499 5:164419093-164419115 CAAAATGCACAAACAAAGCAAGG + Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001645380 5:173277793-173277815 GAAGTTGCACAGGTTGAGCATGG - Intergenic
1003105601 6:3212820-3212842 GAAACTTCACAGAGAGAGCTTGG + Intergenic
1003113481 6:3267490-3267512 GGAAATGCTCAGAAAGAGGATGG - Intronic
1003479560 6:6518665-6518687 GAAAAAGCACAATCAGAGCAAGG - Intergenic
1004624331 6:17360630-17360652 GAAAATGTACATATACATCACGG + Intergenic
1004763883 6:18702170-18702192 AAAAATGAAAAGAAAGAGCAGGG - Intergenic
1004862120 6:19815158-19815180 GAAAATACACAAATAGAGATTGG + Intergenic
1004907688 6:20251962-20251984 GAAACTGCACAGATAGTCTAGGG - Intergenic
1004965638 6:20847819-20847841 CAAAATGCACAAACAAAGCAAGG + Intronic
1005435157 6:25801954-25801976 GAACATCCACAGGTAGAGCTTGG + Intronic
1005516950 6:26564147-26564169 CAAAACGCACAAACAGAGCAAGG - Intergenic
1005773772 6:29106122-29106144 GAAAATTCACATATACAACATGG - Intergenic
1006289690 6:33125189-33125211 GAAGATGCACACATTGAGTAAGG + Intergenic
1007723015 6:43896947-43896969 GACAATGCACACATAAAGAAAGG - Intergenic
1008083571 6:47220304-47220326 GAAAATGCATATATAGACAATGG + Intergenic
1008596980 6:53052260-53052282 GAAAATGTACATATACACCATGG - Intronic
1008959169 6:57248443-57248465 CAAAATGCACAAACAAAGCAAGG + Intergenic
1009479452 6:64138746-64138768 GAAAATTCACATATAGGACATGG + Intronic
1009528085 6:64773339-64773361 GAAAATGTACATATATACCATGG - Intronic
1009613983 6:65981787-65981809 CAAAAAGCAAAGATAGAGTAAGG - Intergenic
1009616136 6:66009772-66009794 GGCACTGCACAGATAGAGGAGGG + Intergenic
1010477331 6:76304095-76304117 GAAAATGTACATATACACCATGG - Intergenic
1011486439 6:87846722-87846744 AAAAATGCATTGAGAGAGCAGGG + Intergenic
1012281376 6:97331494-97331516 CAATATGCACAGATAGTTCATGG - Intergenic
1012301854 6:97599607-97599629 GAAAATGAAAAGAAAGGGCATGG + Intergenic
1012761402 6:103307592-103307614 GAAAATGCAGAGACAAATCATGG + Intergenic
1013455671 6:110327168-110327190 GAAAATACAAAGGCAGAGCATGG + Intronic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1013807124 6:114008446-114008468 CAAAATGCACAAACAAAGCAAGG + Intronic
1014821586 6:125994735-125994757 GAAAATGTACATATACACCATGG + Intronic
1015702345 6:136050338-136050360 GAAAATTCACAGAGAGGGCTTGG - Intronic
1016225323 6:141728299-141728321 CAAAATGCACAAACAAAGCAAGG + Intergenic
1016601978 6:145872816-145872838 GAAAATGTACATATACAACATGG + Intronic
1016662122 6:146594099-146594121 GAAGTTGCACAGACAGAGTATGG - Intergenic
1016749629 6:147618543-147618565 GAAACAGAACAGATAGAGCAAGG + Intronic
1016770873 6:147849141-147849163 AAAAATTCACATATAGAACAGGG - Intergenic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1017090347 6:150753635-150753657 GCAAATGCACAGAGAGAAAAGGG + Intronic
1017378284 6:153797086-153797108 CAAAATGCACAAACAAAGCAAGG + Intergenic
1018178553 6:161200100-161200122 GAATGTGCACAGAAAGAGGAAGG + Intronic
1018343788 6:162880958-162880980 GTAAATGTACAGACAGAGCGTGG - Intronic
1018514872 6:164568598-164568620 CAAAATGCACAAACAAAGCAAGG + Intergenic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1019901726 7:4026221-4026243 GAGAATGCAGAGACAGGGCATGG + Intronic
1020716907 7:11685997-11686019 GAAAATGTACATATACACCATGG + Intronic
1020808738 7:12825079-12825101 GAAAATGTACATATACACCATGG + Intergenic
1021454415 7:20814017-20814039 GAAAATGTACACAGAGAGCCGGG + Intergenic
1021651382 7:22836905-22836927 CAAAATGCACAAACAAAGCAAGG - Intergenic
1022513736 7:30962150-30962172 GAACATGTACAGTTAGAGCAGGG + Intronic
1023087464 7:36585763-36585785 GAAAATACACAGAAAGGGCCTGG + Intronic
1023480341 7:40627187-40627209 CAAAATGCACAAACAAAGCAAGG + Intronic
1023518819 7:41030454-41030476 GAAAATACACATAAAGAGGATGG + Intergenic
1023817280 7:43960865-43960887 CAAAATGCACAAAGAAAGCAAGG + Intergenic
1024191873 7:47020394-47020416 AAAAATGCACAAACAAAGCAAGG + Intergenic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1024329227 7:48139824-48139846 CAAAATGCACAAACAAAGCAAGG + Intergenic
1024630377 7:51242409-51242431 CAAAATGCACAAACAAAGCAAGG - Intronic
1025020268 7:55474993-55475015 GAAACTGTAGAGAAAGAGCACGG - Intronic
1025784256 7:64630084-64630106 GAAAATGTACATATACACCATGG + Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026807926 7:73439312-73439334 GAAAATGTCCAGAAGGAGCATGG + Intergenic
1027696062 7:81411932-81411954 CAAAATGCACAAACAAAGCAAGG + Intergenic
1029501679 7:100934573-100934595 GAAAATGCAGAGAGAGAGAGGGG - Intergenic
1030183186 7:106732072-106732094 GAAAATGCCTTGAAAGAGCAGGG - Intergenic
1030366459 7:108652796-108652818 CAAAATGCACAAACAAAGCAAGG + Intergenic
1030973440 7:116090450-116090472 CAAAATGCACAAACAAAGCAAGG - Intronic
1031894610 7:127334817-127334839 GAAGATGCAGAGAAAGAGGAAGG + Intergenic
1031910030 7:127506214-127506236 CTAAATACACAGCTAGAGCAAGG - Intergenic
1032010110 7:128340420-128340442 CAAAATGCCCAGACAGTGCAGGG - Intronic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1035063549 7:156088850-156088872 GAAAATGAAGAGACAGAGGAGGG + Intergenic
1036017211 8:4798369-4798391 AAAAATGCACATATACACCATGG - Intronic
1036075928 8:5499588-5499610 GAAAATACACATATATACCATGG - Intergenic
1036103607 8:5815290-5815312 GAAAATGTACATATATACCATGG + Intergenic
1037849284 8:22313178-22313200 AAAGATGAACAGACAGAGCAAGG - Intronic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG + Intergenic
1040449891 8:47534411-47534433 GAAAATGTACATATACACCATGG + Intronic
1040805062 8:51385986-51386008 GAAAATGGACTAATAGACCATGG + Intronic
1041269774 8:56100112-56100134 GAAAAGAGACAGACAGAGCAAGG - Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041487735 8:58397255-58397277 AAAAATGACCAGATAGAGCAGGG - Intergenic
1042600498 8:70494714-70494736 GAAAAATCACTGATGGAGCATGG - Intergenic
1042643873 8:70964314-70964336 AAAAATGGACACATAGACCAAGG - Intergenic
1042987756 8:74603219-74603241 GAAACTACACAGATGGATCATGG + Intronic
1043038927 8:75234796-75234818 GAAAATGCATAATTATAGCAAGG - Intergenic
1043991766 8:86764368-86764390 GAAAATTCACATATAGAGTTAGG - Intergenic
1044310615 8:90687863-90687885 CAAAATGCACAAACAGAGCAAGG - Intronic
1044836849 8:96303993-96304015 GAAAATCCAGAGATAAGGCAGGG - Intronic
1045549667 8:103160160-103160182 CAAAATGCACAAACAAAGCAAGG + Intronic
1046838709 8:118832257-118832279 GAAAATGTACATATACACCATGG + Intergenic
1046886157 8:119369510-119369532 GAAAATGTACATATACACCATGG + Intergenic
1047073938 8:121378667-121378689 CAAAATGCACAAACAAAGCAAGG - Intergenic
1047720903 8:127638218-127638240 GAAAAGGCACAAGTAGAGGAGGG + Intergenic
1047889151 8:129288136-129288158 CAAAATGCATAAATAAAGCAAGG - Intergenic
1048171540 8:132111368-132111390 GACAATGCACTGATTCAGCATGG + Intergenic
1048417721 8:134245011-134245033 GAAAATGTACATATACACCATGG - Intergenic
1048525055 8:135194889-135194911 GAAATTGCACAAATAGGGGAAGG - Intergenic
1048761410 8:137799475-137799497 GAAAATGTACATATACACCACGG - Intergenic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1050045708 9:1542675-1542697 GAAAATGTACATATACATCATGG - Intergenic
1050897088 9:10897530-10897552 GAAAATGCAAAAATTGAGAAAGG + Intergenic
1051852461 9:21525544-21525566 GAAAATGTACATATACACCATGG - Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052636815 9:31117059-31117081 GAAAATGTACATATACACCATGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053326035 9:37152278-37152300 AAAATTGCAAAGATAGTGCAGGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053558417 9:39162598-39162620 GAAAATGTACATATATACCATGG + Intronic
1053822532 9:41982823-41982845 GAAAATGTACATATATACCATGG + Intronic
1054138697 9:61456344-61456366 GAAAATGTACATATATACCATGG - Intergenic
1054608044 9:67204543-67204565 GAAAATGTACATATATACCATGG - Intergenic
1055116638 9:72612189-72612211 GCAATTGAACAGATATAGCAGGG - Intronic
1055322049 9:75091710-75091732 GAAAAAGTAAAGATAAAGCATGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057859750 9:98630984-98631006 GAGACAGCACAGATAGAGAACGG + Intronic
1058516883 9:105785050-105785072 GAAAATGTACATATACACCATGG - Intergenic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1058805717 9:108589490-108589512 GAAAATGTAAAGATGGAGAAGGG + Intergenic
1059573945 9:115470023-115470045 GAAAATGCAGAGAAAGACAAAGG - Intergenic
1059701542 9:116779684-116779706 GAAAATGAACAGAAAAAGAAGGG - Intronic
1059784949 9:117571525-117571547 CAAAATGCACAAACAAAGCAAGG - Intergenic
1060570239 9:124632029-124632051 GAAAATGTACATATACATCATGG - Intronic
1061324350 9:129853986-129854008 TAAAATACTCAGAAAGAGCAAGG + Intronic
1061388062 9:130302033-130302055 AAAAAAGCACAGCTAGAGGATGG - Intronic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1186182174 X:6984002-6984024 CAAAATGCACACACAAAGCAAGG - Intergenic
1186219422 X:7333815-7333837 GATAATGCACGGACAGAGCTGGG + Intronic
1186226675 X:7406576-7406598 GAGAATGAACTGATAGAGCAGGG - Intergenic
1186729440 X:12392720-12392742 GAAAATTCACAGACATAGGAAGG - Intronic
1188169720 X:26910065-26910087 GAAAAAGCACAGATATAGAGAGG + Intergenic
1188295897 X:28447903-28447925 GAAAATGTACATATACACCATGG + Intergenic
1188680824 X:33002278-33002300 CAAAATGCACAAACAAAGCAAGG + Intronic
1188901699 X:35740569-35740591 GGAAATGCACAGAGATAACATGG - Intergenic
1188982504 X:36739580-36739602 AAAAATGAACAGGTAGTGCATGG - Intergenic
1189132040 X:38509695-38509717 GAAAATGTACATATACACCATGG + Intronic
1189192652 X:39123744-39123766 GAAAAGGTAGAGATTGAGCATGG - Intergenic
1189237603 X:39499762-39499784 GAAAATGTACATATACACCATGG - Intergenic
1189761759 X:44329002-44329024 CAAAATGCACAAACAAAGCAAGG - Intronic
1189867293 X:45344242-45344264 CAAAATGCACAAACAAAGCAAGG - Intergenic
1190408912 X:50115182-50115204 CAAAATGCACAAACAAAGCAAGG - Intergenic
1190790153 X:53691658-53691680 GAAAATGCACAGCTCTGGCAAGG - Intergenic
1191878688 X:65822726-65822748 GAAAATGTACATATAAACCATGG + Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1193165574 X:78276810-78276832 GAAAGTGGACAGATGGAGGATGG + Intronic
1193193393 X:78600732-78600754 AAAAATGGACACATAGACCAAGG + Intergenic
1193507774 X:82364156-82364178 CAAAATGCACAAACAAAGCAAGG + Intergenic
1193629601 X:83866519-83866541 GCAAATGGACAGAGAGAGGAAGG - Intronic
1193826491 X:86232971-86232993 GAAAATGTACATATACACCATGG + Intronic
1193920236 X:87415931-87415953 GAAAATGTACATATACATCATGG - Intergenic
1193961417 X:87929532-87929554 TAAAATGGACACATAGAACAAGG + Intergenic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195907386 X:109858269-109858291 AAATATGCAGAGATAGAACAAGG - Intergenic
1196401251 X:115318756-115318778 CAAAATGCACAAACAAAGCAAGG + Intergenic
1197243627 X:124146147-124146169 TAAAATGCACAAACAGAGCAAGG + Intronic
1198551634 X:137751534-137751556 GGAAAGGCAAAGATGGAGCAGGG - Intergenic
1199482972 X:148318195-148318217 GCAAATGCATAGAGAGAGAAAGG + Intergenic
1199543302 X:148981449-148981471 GAACAAGCCCAGATAGAGGAAGG - Intronic
1199835382 X:151585107-151585129 AAAAATGCACATAAAGGGCAAGG + Intronic
1199921417 X:152408573-152408595 GAAAATGGAAAGATAGTTCACGG + Intronic
1200170102 X:154066409-154066431 GAAAATGAAAAGACAGAGCTGGG - Intronic
1200734087 Y:6775199-6775221 CAAAATGCACAAACAAAGCAAGG + Intergenic
1200794672 Y:7329874-7329896 GAAAATGCCAGGATAGAGAAGGG - Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic