ID: 1104654066

View in Genome Browser
Species Human (GRCh38)
Location 12:130560126-130560148
Sequence AACACATTTTTGCCTCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104654066_1104654068 1 Left 1104654066 12:130560126-130560148 CCAGACGGAGGCAAAAATGTGTT 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1104654068 12:130560150-130560172 TAAAGGCAAAGTATTATTGCAGG 0: 1
1: 0
2: 3
3: 10
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104654066 Original CRISPR AACACATTTTTGCCTCCGTC TGG (reversed) Intronic
904306683 1:29594499-29594521 AACACGCCTTAGCCTCCGTCAGG - Intergenic
906705432 1:47891476-47891498 AACATATTCTTGCCTCTGCCTGG - Intronic
907759969 1:57348127-57348149 AATACAATTTTGTCTCCTTCAGG - Intronic
912705428 1:111908402-111908424 AACATTTATTTGCCTCAGTCTGG - Intronic
915977293 1:160399912-160399934 AACACATTTTTCCTCCCCTCTGG - Intergenic
916244769 1:162676434-162676456 AACATATTTTCTCCTCCTTCAGG - Intronic
1064350676 10:14573434-14573456 AACACATTTTTGGCTGGGTGTGG + Intronic
1070832976 10:79431622-79431644 AGCACATTTTGGCCTCCCACTGG + Intronic
1072082426 10:92045516-92045538 AACACATTTTTCTCTCCATTTGG + Intergenic
1072173926 10:92897032-92897054 AATACCTCTTTGCCACCGTCAGG + Intronic
1075578097 10:123595587-123595609 AACCAATTTTTGCCACCTTCTGG + Intergenic
1077557085 11:3230989-3231011 AACTCATCTCTGCCTCCCTCTGG - Intronic
1086493127 11:87375779-87375801 CACACATTTTTCCCTCCACCTGG - Intergenic
1091840409 12:3616559-3616581 AACCCATTCTTGCCTCCAGCTGG + Intronic
1092558797 12:9587390-9587412 AACAGATTTTTGCCTCCGTGGGG - Intergenic
1098028610 12:66231669-66231691 AACAAATTATTGCCTCCACCAGG - Intronic
1104654066 12:130560126-130560148 AACACATTTTTGCCTCCGTCTGG - Intronic
1109946866 13:69445805-69445827 AAAACATTTCTGCCTCTATCTGG + Intergenic
1117620767 14:57584074-57584096 AAGACATATTTGCCTATGTCAGG - Intronic
1126149840 15:45513958-45513980 AACACATCATTGCCTACCTCAGG - Intronic
1126795429 15:52257202-52257224 AGCACAATTTTGCCTCCCTAAGG + Intronic
1127425082 15:58848185-58848207 ACCATATTTTTGCCTCAGTCAGG - Intronic
1127536682 15:59896365-59896387 TAACCATTTTTGCCTCTGTCTGG + Intergenic
1128407719 15:67360075-67360097 AACCCTTTTTTGCCTCCTTTTGG + Intronic
1129852576 15:78802356-78802378 AGCACATTTTTAAATCCGTCAGG - Intronic
1130019094 15:80212099-80212121 AACAGAGTTTTTCCTCCCTCAGG - Intergenic
1143211806 17:5193575-5193597 AACTCATTTTTGCCTCCCAGAGG - Intergenic
1144665134 17:17097214-17097236 AACCGATTTTTACCTCCGTGTGG - Intronic
1153144533 18:2015568-2015590 AACACATTTTTGCCACCTTGGGG + Intergenic
1155732575 18:29179603-29179625 AACACAGGTTTGCATCTGTCTGG + Intergenic
1160048691 18:75411389-75411411 AACACATTCTTGAGGCCGTCAGG - Intronic
1167097430 19:47381847-47381869 AACCCAGTTTTGCCTCCTCCAGG - Intronic
1167226113 19:48241639-48241661 ATCACACTTTTGCCTCTGTCAGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
927536557 2:23865611-23865633 AACCAATTTTTGCCTCTGTGAGG - Intronic
929086374 2:38171435-38171457 AACACATTTTTTCATCCAACAGG - Intergenic
933006400 2:77001043-77001065 AACACATTTTTGTATCCTTTGGG - Intronic
933161919 2:79034815-79034837 AACATATTCTCGCCTCAGTCAGG + Intergenic
933204669 2:79491969-79491991 AACGCATTTTTGCCTCTTTCTGG - Intronic
939214733 2:139221453-139221475 TACACATTTTTGCTTCTGTGGGG + Intergenic
939389684 2:141550421-141550443 AACAGATTTTTAGCTCCTTCAGG + Intronic
943151573 2:184120561-184120583 GACACATTTTTGCCTATGTAGGG - Intergenic
945169580 2:206981727-206981749 AACACATTTTCACTTCCTTCAGG + Intergenic
945208512 2:207357857-207357879 ATCATCTTTTTGCCTCTGTCTGG + Intergenic
946681348 2:222220189-222220211 GACAGCTTTGTGCCTCCGTCGGG - Exonic
1175924156 20:62463785-62463807 AGCACATCCTCGCCTCCGTCCGG - Exonic
1175964502 20:62653720-62653742 GACACCTGTTTGCCTCCGTGGGG + Intronic
1182268487 22:29137677-29137699 AAGACATCTTTGCCTCCTTGGGG + Intronic
951865450 3:27301909-27301931 AAGAAATCTTTGCCTCCCTCAGG + Intronic
952221782 3:31330983-31331005 AAGACATTTCTGCCTAAGTCAGG + Intergenic
953031723 3:39184199-39184221 AACACTCTTTTGCCACCCTCTGG + Exonic
962255766 3:133869128-133869150 CACACATTGTTCCCTCTGTCTGG - Intronic
962829024 3:139123482-139123504 CACACATTCTTGCCTCTGTTGGG + Intronic
963564769 3:146915462-146915484 AAGAAATTTTTGCCTCATTCGGG + Intergenic
966589777 3:181669436-181669458 AACATATTTTTATCTCGGTCTGG + Intergenic
967819946 3:193831285-193831307 TACACCTTTCTGCCTCCCTCTGG + Intergenic
970998080 4:22290957-22290979 AACATATTATTTCCTCTGTCTGG - Intergenic
972454029 4:39234565-39234587 AATCAATTTTTGCCTCCTTCAGG + Intronic
974370415 4:61009747-61009769 AACACATTTTTGGCTGGGTGCGG + Intergenic
975723634 4:77271601-77271623 ATAACATTTTTGCCCCCCTCTGG + Intronic
976473016 4:85451617-85451639 AACACAGTTTAGCCTCCAGCTGG - Intergenic
977533478 4:98228056-98228078 AACACATTTTGTCCTCCTGCGGG + Intergenic
982978945 4:162105887-162105909 AGCAAATTTTTTCCTCAGTCAGG + Intronic
984395228 4:179189206-179189228 AATAGATTTTTGCCTGTGTCAGG - Intergenic
987138004 5:14917709-14917731 AACGCATTGTGGCCTCCATCCGG + Intergenic
989709584 5:44380989-44381011 CTCACATTTTTGCCTTTGTCTGG - Intronic
990647150 5:57857745-57857767 AAGACAATTTTGTCTCCCTCAGG - Intergenic
996402014 5:123072975-123072997 AAGACATTTTAGCCTCGGTGGGG - Intergenic
998503400 5:142652893-142652915 AACCCATTTTTGACTCTGTCTGG - Intronic
1006209123 6:32377730-32377752 AACACATTTTTCTTTCCCTCAGG + Intergenic
1007263887 6:40583095-40583117 CACACATTTTTGCCCCCTTGGGG - Intronic
1009559240 6:65218404-65218426 AACACATTCTTACCTCAGTGAGG - Intronic
1012546886 6:100430254-100430276 AACATATTTGTGACTCCTTCAGG + Intronic
1012947468 6:105482983-105483005 AACACATTTATGCCTCTCTGAGG + Intergenic
1015761964 6:136672516-136672538 AACACATTTGGGACTCCTTCGGG - Intronic
1016135542 6:140537240-140537262 ATCACATTGTTGTCTCTGTCTGG + Intergenic
1018196859 6:161362730-161362752 AAGATATTTTTGCTTCCGCCTGG - Intronic
1020656602 7:10935735-10935757 AACAAATTTATTCCTCAGTCCGG - Intronic
1023411478 7:39892959-39892981 GACACTTTTTTTCCTCCCTCAGG + Intergenic
1036966835 8:13308191-13308213 AATACATTTTAGCCTCCTTATGG + Intronic
1038196157 8:25370116-25370138 AACACATCTGTACCTCTGTCTGG + Intronic
1038914439 8:32004834-32004856 AGTACATTTTTGCCTCTGTGAGG - Intronic
1039401046 8:37269478-37269500 AACATATTTATGCCTCTGTAAGG - Intergenic
1041436587 8:57848516-57848538 AACGCATTTTAGCATCCGCCAGG + Intergenic
1046634555 8:116659514-116659536 AGTACATTTTTGCCTTCATCTGG + Intronic
1047107813 8:121753638-121753660 AACACATTTTTCCCCCAGTCAGG - Intergenic
1047426727 8:124753313-124753335 CACACATCTTTGCCTCCCCCAGG + Intergenic
1047819317 8:128501195-128501217 GTCACATTTTTGCCTCCTGCAGG - Intergenic
1050898657 9:10915883-10915905 AAAACATTTTTTCCTCCTTTGGG + Intergenic
1052131365 9:24852155-24852177 AACACAGTTTTGCCTCACACAGG - Intergenic
1052519738 9:29531170-29531192 AACATATTTTTTCATCCTTCTGG + Intergenic
1055622496 9:78141089-78141111 AAAATATTTTTGCCTATGTCTGG - Intergenic
1056265881 9:84896419-84896441 AGCACATTTTTTCCTCCCTAAGG + Intronic
1056817245 9:89811077-89811099 AACACACTTTTGCTCCCTTCTGG + Intergenic
1185764839 X:2716873-2716895 AACACACTTTTGGCCCCGTCAGG - Intronic
1193591380 X:83392294-83392316 AAAACATTTTTCCCTTTGTCAGG - Intergenic
1199324382 X:146479399-146479421 AACACATTTTTGGCTGGGTGCGG - Intergenic
1199824236 X:151482043-151482065 AAGACATTTTTGCCTAACTCAGG - Intergenic