ID: 1104655573

View in Genome Browser
Species Human (GRCh38)
Location 12:130571828-130571850
Sequence GGCCACAGGGAGGCCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 437}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104655573_1104655585 7 Left 1104655573 12:130571828-130571850 CCCACACTGGCCTCCCTGTGGCC 0: 1
1: 0
2: 4
3: 47
4: 437
Right 1104655585 12:130571858-130571880 ACACCCAGGGAGCCCACCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1104655573_1104655579 -6 Left 1104655573 12:130571828-130571850 CCCACACTGGCCTCCCTGTGGCC 0: 1
1: 0
2: 4
3: 47
4: 437
Right 1104655579 12:130571845-130571867 GTGGCCCCCTCACACACCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 181
1104655573_1104655584 6 Left 1104655573 12:130571828-130571850 CCCACACTGGCCTCCCTGTGGCC 0: 1
1: 0
2: 4
3: 47
4: 437
Right 1104655584 12:130571857-130571879 CACACCCAGGGAGCCCACCTCGG 0: 1
1: 0
2: 1
3: 36
4: 292
1104655573_1104655578 -7 Left 1104655573 12:130571828-130571850 CCCACACTGGCCTCCCTGTGGCC 0: 1
1: 0
2: 4
3: 47
4: 437
Right 1104655578 12:130571844-130571866 TGTGGCCCCCTCACACACCCAGG 0: 1
1: 0
2: 0
3: 35
4: 231
1104655573_1104655586 8 Left 1104655573 12:130571828-130571850 CCCACACTGGCCTCCCTGTGGCC 0: 1
1: 0
2: 4
3: 47
4: 437
Right 1104655586 12:130571859-130571881 CACCCAGGGAGCCCACCTCGGGG 0: 1
1: 0
2: 3
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104655573 Original CRISPR GGCCACAGGGAGGCCAGTGT GGG (reversed) Intronic
900291635 1:1926193-1926215 GGCCGCAGTGTGGCCAGGGTGGG + Intronic
900416202 1:2535863-2535885 GGCCACAGGGAGGCCACCACCGG - Intergenic
900492745 1:2960750-2960772 GACCACAGAGAGGCCAAGGTTGG + Intergenic
900595221 1:3477332-3477354 GGCCAGAGGGTGGGCAGTGTGGG - Intronic
900791481 1:4683814-4683836 GTCCCCAGAGAGGCCAGGGTGGG + Intronic
900803100 1:4749574-4749596 GGCCAGGGGGAGGCAAGAGTGGG + Intronic
901140820 1:7028618-7028640 TGCTCCAGGGAGGCCAGAGTGGG - Intronic
901323227 1:8351839-8351861 GGCCACAGGGGGGCAGGCGTTGG - Intergenic
901645545 1:10715114-10715136 GGCCAACCGGAGGCCAGGGTGGG - Intronic
902308354 1:15561076-15561098 GGACAGAGAGAGGCCAGAGTGGG - Intronic
902410778 1:16210319-16210341 GCCCACAGCGAGGCCAGGCTAGG - Intronic
902517090 1:16995380-16995402 GACCACAAGGATGCCTGTGTTGG + Intronic
902612451 1:17605150-17605172 AGCCCCAGGCAGGCCAGTGCTGG - Intronic
902629874 1:17698380-17698402 GGTCAGAGGGAGGACAGGGTGGG + Intergenic
902641187 1:17767337-17767359 GGAGGCAGGGGGGCCAGTGTGGG + Intronic
902796953 1:18806274-18806296 GGCCACAGGAAGGCCAGCCCTGG - Intergenic
902824073 1:18960607-18960629 TGCCACAGGGTGGGCAGTGCTGG - Intergenic
903005089 1:20293160-20293182 GGCCACAGGGATGGCTGAGTGGG - Intronic
903238718 1:21968274-21968296 GCCATCAGGGAGGCTAGTGTGGG - Intergenic
903242643 1:21993938-21993960 GCCATCAGGGAGGCTAGTGTGGG - Intronic
903279306 1:22241460-22241482 GGAGGCAGGCAGGCCAGTGTGGG + Intergenic
903302051 1:22386155-22386177 GGCCACAGGGAGGCGATGGCAGG - Intergenic
903442886 1:23401634-23401656 GGACACAGGGAAACCAGTTTTGG - Intronic
904036560 1:27562131-27562153 GGCCGAGGGGAGGCCTGTGTGGG + Intronic
904380617 1:30108260-30108282 GGCCACAGGGAGCCCAGAAGAGG + Intergenic
904410808 1:30323777-30323799 AGCCACAGTGAGCCCAATGTAGG + Intergenic
904603700 1:31687480-31687502 GGCCACGGGCAGGCCAGAGGAGG + Intronic
905209281 1:36362326-36362348 GGTCACAGGATGCCCAGTGTGGG + Intronic
905629542 1:39511043-39511065 GGACCCAGGGAGGCCTGGGTGGG - Intronic
905668218 1:39775147-39775169 GGACCCAGGGAGGCCTGGGTGGG + Intronic
905790046 1:40784768-40784790 GGACACAGGGAGGCAGGGGTGGG - Intronic
905798234 1:40827421-40827443 GGCAAGAGGGAGCACAGTGTGGG + Intronic
906265830 1:44428647-44428669 GGAAAGAGGGAGGCCAGTTTGGG - Intronic
908268123 1:62397970-62397992 AGTCAGAGGGAGGCCAGCGTTGG + Intergenic
908389847 1:63674627-63674649 GGTCTCAGGGAAGTCAGTGTGGG - Intergenic
910290637 1:85597089-85597111 GGTCACAGGGAGGTCTGTCTAGG + Intergenic
910906920 1:92191177-92191199 AGCTACAGGGAGGCTAGGGTGGG - Intergenic
911053570 1:93692673-93692695 GGAGTCAGGGAGGCCAGTTTAGG - Intronic
915081120 1:153353445-153353467 GGCCACAAGGATGCCAGGGGTGG + Intergenic
915177291 1:154026592-154026614 GGCCTCTGGGAGGCCAATGCAGG - Intronic
915267928 1:154732041-154732063 GGCCACACACAGGTCAGTGTTGG - Intronic
915290208 1:154878462-154878484 TCCCACAGGGAGGGCAGTGAGGG + Intergenic
915359869 1:155279389-155279411 GGACACAGGGAGGCCAGAGGAGG + Intronic
915597775 1:156905242-156905264 GGCCAGGGGGAGGCCAGGGAAGG - Intronic
916032799 1:160892937-160892959 GGCCACAGTGAGGCTAGGGGAGG + Intergenic
916141722 1:161705679-161705701 GGCCCCAGGGAGTCCAGGGGTGG - Intergenic
917537634 1:175885949-175885971 GCCCACAGCGAGGGCAATGTTGG + Intergenic
917653391 1:177101564-177101586 GGGCACAGGGAGGACAGGGGTGG + Intronic
919788802 1:201276955-201276977 GGCCCCCGGCAGGCCAGTGTTGG + Intergenic
920091284 1:203455084-203455106 GGCCACAGGAATGCCAGGGGAGG - Intergenic
920202201 1:204266458-204266480 GGCCACAGTGGAGCCAGAGTGGG - Intronic
920380241 1:205530795-205530817 GTCCAAAGGGAAGCCAGTGGTGG - Intronic
920541883 1:206784974-206784996 GAGCACAGTGAGGCCAGTCTGGG + Intergenic
920670993 1:208003472-208003494 GGACAGAGGGAAGCCAGGGTGGG - Intergenic
921232136 1:213083701-213083723 GGCCAAAGAGAGGTCTGTGTTGG + Intronic
922562294 1:226578043-226578065 GCCCACGGGGAGGGCAGTCTGGG - Intronic
922579367 1:226685601-226685623 GGCTGCAGGGAGGCCTGTGAGGG - Intronic
922704552 1:227782305-227782327 CACCCCAAGGAGGCCAGTGTTGG + Intergenic
922717632 1:227885590-227885612 GGTCACAGGGAGGCCATCCTGGG - Intergenic
1062895085 10:1097264-1097286 GTTGACAGGGAGGCGAGTGTGGG + Intronic
1063671898 10:8105647-8105669 GGCTATAGCAAGGCCAGTGTTGG + Intergenic
1066050504 10:31631290-31631312 GGACACAGAGAGGTCAGCGTTGG + Intergenic
1066501910 10:36003085-36003107 GACCAAAGGGAGGTCAGTGCTGG - Intergenic
1066732602 10:38449098-38449120 GGCCCCTGGGAGGCAAGAGTGGG - Intergenic
1067142540 10:43669109-43669131 GGGCAGGGGCAGGCCAGTGTGGG + Intergenic
1067494519 10:46749937-46749959 TCCCAAAGAGAGGCCAGTGTTGG - Intergenic
1067600139 10:47590460-47590482 TCCCAAAGAGAGGCCAGTGTTGG + Intergenic
1067743135 10:48912125-48912147 GTACACAGGGAGGCCAGAGAAGG + Intronic
1068279886 10:54854770-54854792 GGCCACGGGCAGGCCAGAGAAGG + Intronic
1069264657 10:66443089-66443111 GGCCACAGGGAGGCTGGGGGAGG + Intronic
1069853680 10:71426556-71426578 GGGCCCAGGGAGGCAAGTGGGGG + Intronic
1069907783 10:71741937-71741959 GGCCACAGGGAGGAGCGGGTGGG + Intronic
1070921769 10:80191719-80191741 GGCCACACGGAAGCCACTGAGGG - Intronic
1071102945 10:82060754-82060776 GGCCACAGGTAGGTCAGTACAGG - Intronic
1071269359 10:83992424-83992446 GGCCAGAGGAGGGCCTGTGTAGG + Intergenic
1071289343 10:84177204-84177226 GGACACTGGGAGGCCTGTGGCGG + Intronic
1072017189 10:91359930-91359952 GTCAAGAGGGAGGCCAGTATGGG + Intergenic
1072628198 10:97127999-97128021 GGCTTCTTGGAGGCCAGTGTGGG - Intronic
1073542414 10:104324596-104324618 GGCCACAGGGTGGCAGGTCTGGG - Intronic
1075031233 10:119026022-119026044 GACCATAGAAAGGCCAGTGTGGG - Intergenic
1075264355 10:120988179-120988201 GGCCACAGGGAATGGAGTGTGGG - Intergenic
1075625883 10:123964327-123964349 GCCCCCAGGGAGGCGACTGTGGG - Intergenic
1076691266 10:132224875-132224897 GGCCACGGCGAGGCCAGTCCTGG - Intronic
1076752499 10:132550637-132550659 GGCCACAGGACGTCCACTGTAGG + Intronic
1076844079 10:133060550-133060572 GCCCTCGGGGAGGCCAGTGGTGG - Intergenic
1077158965 11:1104015-1104037 GGCCACAGGCAGGCCTGGGCGGG - Intergenic
1077316578 11:1922029-1922051 GGCCACAGGGAGGGAAATGGGGG + Intronic
1078507798 11:11965439-11965461 GGCCACGGGGAGGCCAGGAGTGG - Intronic
1078706466 11:13748489-13748511 GGCAGCAGGGAGGCCATTGAAGG - Intergenic
1078749811 11:14150797-14150819 GGACACAGGGAGCACAGTGTAGG + Intronic
1079087111 11:17454424-17454446 AGCCACAGGGAGACCACTGAGGG + Intronic
1079745868 11:24129240-24129262 GGATACAGGGAGGGCAGTGAGGG - Intergenic
1080411399 11:32028653-32028675 GGCCATGGAGAGGGCAGTGTGGG - Intronic
1081600293 11:44488185-44488207 TGGCACTGGGAGGCCAGTCTGGG - Intergenic
1081813805 11:45927741-45927763 GTCAACAGGGAGGCCAGGGCCGG + Intronic
1081993048 11:47347816-47347838 GGCCTGGGGGAGGCCAGTGCTGG - Intronic
1082001798 11:47397217-47397239 GGCCAGAGGGAGGCCAGGGAGGG - Intergenic
1082259948 11:50071167-50071189 GGCCACAGTGAGGCAAGAGCTGG + Intergenic
1082296428 11:50445816-50445838 GGCCTCAGGGAGGGGAGTGGGGG - Intergenic
1083325066 11:61869061-61869083 GGCCACAGGGTGTCCTGAGTAGG + Intergenic
1084410051 11:69001666-69001688 GGCAACAGGAGGGCCACTGTGGG + Intergenic
1085049538 11:73373126-73373148 GTGCTCAGGGAGGCAAGTGTAGG - Intergenic
1085121348 11:73969473-73969495 GCCCACAGCTTGGCCAGTGTGGG - Intronic
1085503381 11:77041571-77041593 GGGAACATGGAGGCCAGTGTTGG + Exonic
1085512611 11:77095919-77095941 GGTCCCAGGGAGGCCAGGGCGGG + Intronic
1085524757 11:77157681-77157703 GGCCACATGGACGTAAGTGTGGG + Intronic
1085772777 11:79339846-79339868 GGGCACAGAGGGGACAGTGTGGG + Intronic
1088400292 11:109416182-109416204 GGCCACAAGCAAACCAGTGTGGG - Intergenic
1089190363 11:116649080-116649102 GGCCACAGGGTGGGCAGGCTGGG - Intergenic
1089399536 11:118156516-118156538 GGCAACAGGGGAGCCAGAGTGGG - Intergenic
1089490489 11:118880419-118880441 GGGGACAGGGTGGACAGTGTGGG - Intergenic
1089771514 11:120806518-120806540 GGCCACAGGGTGACAGGTGTAGG - Intronic
1089841629 11:121423808-121423830 AGCAGCAGGGAGGCCTGTGTGGG - Intergenic
1092111894 12:5970126-5970148 GGCCACAGGGAGTCAGGAGTGGG - Intronic
1092260830 12:6952456-6952478 GGAGACAGGGAGGCCACTGCTGG + Intronic
1092276778 12:7067495-7067517 GGCCACAGAGAGGCTGGTGTGGG + Intronic
1092622351 12:10286083-10286105 GGCCACACCAAGACCAGTGTAGG + Intergenic
1096156731 12:49345375-49345397 GCCGCCGGGGAGGCCAGTGTCGG + Intergenic
1097266955 12:57751619-57751641 GGCCACAAAGTGGCCACTGTGGG + Exonic
1102111822 12:110370969-110370991 TGCCACAGGTAAGCCAGTGTAGG + Intergenic
1102457034 12:113077337-113077359 GGCCACAGCCAGGCAAGGGTGGG - Intronic
1102465867 12:113130612-113130634 GCCCCCAGGGAGGCCACTGTAGG + Intronic
1103134761 12:118497986-118498008 GGCCAGAGGGGAGCCAGAGTGGG - Intergenic
1103581533 12:121918820-121918842 GGCCCCAGGGAGACCTGAGTTGG + Intronic
1103763722 12:123268087-123268109 GGCCACTGGGACGCCATTGCGGG - Intronic
1104169034 12:126261893-126261915 CTCCACAGGGAGACCACTGTGGG + Intergenic
1104348837 12:128027286-128027308 AGGCACAGGGAGTCCAGTGATGG + Intergenic
1104655573 12:130571828-130571850 GGCCACAGGGAGGCCAGTGTGGG - Intronic
1104881994 12:132078355-132078377 GGCCTGGGGGAGGCCACTGTTGG - Exonic
1104963300 12:132498226-132498248 GCTCACAGTGAGGCCTGTGTCGG + Intronic
1105591931 13:21800219-21800241 GGCCAGAGAGAAGCCAGGGTTGG - Intergenic
1107431532 13:40344955-40344977 GGCCACAGGGAGTGCAGTGGGGG + Intergenic
1107505623 13:41030324-41030346 GGCAACATGGAGGTCACTGTTGG + Intronic
1111126796 13:83919998-83920020 GCCCTCAGGGTGGCCAGGGTAGG + Intergenic
1112333738 13:98497254-98497276 GGGCACAGGGAGGCTTGGGTGGG - Intronic
1113374858 13:109755664-109755686 GTCCACACCGAGCCCAGTGTGGG - Exonic
1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG + Intergenic
1114159207 14:20144224-20144246 GGCCACAGAAAGGCAAGTGCAGG - Exonic
1114414978 14:22536616-22536638 TGGGACAGGGAGGCCAGTTTTGG - Intergenic
1114487506 14:23071670-23071692 GGCCACAGGGAGCCGACTGCTGG + Intronic
1116444285 14:44990741-44990763 GGCTACAGAGAGTTCAGTGTGGG + Intronic
1116446818 14:45020965-45020987 GGCCTCATGGAGCCCAGTGAGGG + Intronic
1118042753 14:61935308-61935330 GGCCAGAATGAGGACAGTGTGGG - Intergenic
1118386224 14:65257635-65257657 GGCAACAGTGAGGCCAGTAGGGG - Intergenic
1119348173 14:73943409-73943431 GGGCACAGGGAAGCCACTGAGGG - Intronic
1120207170 14:81599383-81599405 GGCCACATGGAGAACAGTGAGGG + Intergenic
1121758484 14:96423192-96423214 GGCAACTGAGAGGCCCGTGTTGG + Intronic
1122088005 14:99320454-99320476 GGACACAGGGATGCCAGTGTCGG + Intergenic
1122324736 14:100875425-100875447 GGCAGCAGGGCAGCCAGTGTGGG + Intergenic
1122938565 14:104971019-104971041 GGCTGAAGGGAGGCCAGGGTCGG - Intronic
1123762960 15:23446808-23446830 GGGCCCAGGGAGGTCAGTTTTGG + Intronic
1124571321 15:30866806-30866828 GGCCACAGGCAGGTCAGCCTTGG + Intergenic
1124687343 15:31793406-31793428 GGACACAGGGAGACCAGGTTGGG - Intronic
1125227641 15:37413085-37413107 GGCCACAGGGTGGCCTGGGTGGG - Intergenic
1125686449 15:41566356-41566378 GGCCAAAGGAGGGCCAGAGTAGG - Intronic
1127012700 15:54647449-54647471 GACAACAGGGAGGGCACTGTAGG + Intergenic
1127613796 15:60663066-60663088 TGCCACAGGGAGATCAGAGTGGG - Intronic
1127734913 15:61831227-61831249 CCCCACAGGGACCCCAGTGTGGG + Intergenic
1128314762 15:66653618-66653640 GGCCACAGGGAGGCCACTGATGG + Intronic
1128421183 15:67492767-67492789 GGCCACAGGAAGAGCAGTGCAGG + Intronic
1129152386 15:73697121-73697143 GGCCTCAGGGTGGCCCTTGTGGG + Intronic
1130688854 15:86062798-86062820 GGTCACAGGGAGGCGAGGGGAGG + Intergenic
1131729085 15:95260163-95260185 TGCCAGAGAAAGGCCAGTGTTGG + Intergenic
1132146593 15:99433125-99433147 GTTCACAGGGAGTCCTGTGTGGG + Intergenic
1132346857 15:101113840-101113862 GGCGACAGAGAGGCCACTGAGGG + Intergenic
1132632569 16:926902-926924 GGCCACAGGGACCCCAGCATAGG - Intronic
1132747880 16:1444495-1444517 GTCCCCAGGGAGGCAGGTGTGGG + Intronic
1132854648 16:2039316-2039338 GGGCAAAGGGTGGCCCGTGTGGG - Intergenic
1133051771 16:3120957-3120979 GACCACAGGCAGGCCATGGTGGG - Intergenic
1135033904 16:19060639-19060661 GGCCACAGGGTGGTGAGTGATGG + Intronic
1136293612 16:29289993-29290015 TGCCACAGGGAGGCTGGTGTGGG - Intergenic
1137056749 16:35749749-35749771 GGTCACAGCGAGGGCAGAGTCGG - Intergenic
1137326035 16:47438115-47438137 GGCCACAGCGAGGCTGGGGTAGG + Intronic
1137369718 16:47894035-47894057 GACCTCTGGGAGGCCAATGTGGG + Intergenic
1137409664 16:48217347-48217369 GGGCACAGGGAGGCCAAGGTGGG + Intronic
1138093559 16:54195037-54195059 GGCCACAGGGAGGCCTGCTGGGG + Intergenic
1138460858 16:57146844-57146866 GCCCACAAGGAGGCCGGGGTTGG + Intronic
1138475194 16:57266469-57266491 GCCCACAGCGAGGCCTGTGTTGG - Intronic
1139633981 16:68246897-68246919 GGCCTCAGGGAGTCCTGGGTTGG + Intronic
1140306746 16:73809880-73809902 GGCCACAGGGAAGGCTGGGTGGG - Intergenic
1141763544 16:86044416-86044438 GGGCACCGGGAGGCCAGCTTAGG - Intergenic
1142070002 16:88086848-88086870 GACCAAAGGGAGGCGAGTGCAGG - Intronic
1142099494 16:88263999-88264021 TGCCACAGGGAGGCTGGTGTGGG - Intergenic
1142284874 16:89167607-89167629 GGCTCCAGGGATGCCAGTGGAGG - Intergenic
1142407019 16:89895963-89895985 GGGCACAGGGACGCCAGGGGAGG - Intronic
1143010312 17:3862408-3862430 GGCCAGAGGGAGGCCAAGCTTGG - Intronic
1143019172 17:3907799-3907821 GGGCCCAAGGAGGCCAGTGGGGG - Intronic
1143096409 17:4480767-4480789 GGCCACAGGGAGCCCTGAGGTGG - Intronic
1143866241 17:9926051-9926073 GACCACAGAGATGCCAGTGGTGG - Intronic
1144370995 17:14591710-14591732 GGCCACACAAAGTCCAGTGTGGG + Intergenic
1144867662 17:18347271-18347293 GGCCACAGGGAAACCAGTGAGGG - Intronic
1145974670 17:28977317-28977339 GGGCACAGGGTGGCCAGAGCGGG - Intronic
1146558461 17:33847789-33847811 GGCCAATGGGAGCCCAGTGGAGG + Intronic
1146933380 17:36793776-36793798 GGACATTGGGAGGCCAGGGTAGG - Intergenic
1147563474 17:41522654-41522676 GGCCCCAGGCAAGCCAGGGTTGG + Intergenic
1149427201 17:56566561-56566583 GGCCACAGGCAGGTCAGCCTTGG - Intergenic
1151559828 17:74864279-74864301 GGCCACAGAGAAGCCAGGGCCGG - Exonic
1151714595 17:75824985-75825007 GGCCTCAGGGAGGCCCGAGGGGG + Exonic
1151850676 17:76687928-76687950 GGCTACAGGCAGGCCAGGGCAGG + Intronic
1151956555 17:77383009-77383031 GGCCACAGCAAGGCCAGGCTGGG + Intronic
1152314378 17:79571833-79571855 GGCAACAGGAAGGCCTGTGGTGG + Intergenic
1152315418 17:79577784-79577806 GGGGCCAGGGAGGCCAGTGTAGG + Intergenic
1152457785 17:80426032-80426054 GGCCCCAGAGACGCCAGTCTGGG + Intronic
1152580061 17:81161926-81161948 GCCCACAGGGTGGCCACTGCAGG + Intronic
1153545195 18:6197686-6197708 TGCCCCAGGAAGGCCAGTGTTGG - Intronic
1153947180 18:10028399-10028421 GGGCAGATGGAGGCCAGTGCAGG - Intergenic
1154165625 18:12012244-12012266 GGCCAGAGGGAGCCCAGGGAGGG - Intronic
1156259669 18:35433188-35433210 GTGTACAGGGAGGCCAGTCTTGG + Intergenic
1156353822 18:36323679-36323701 GGCAACAGGGAGAGCAGTCTTGG - Intronic
1156367391 18:36441468-36441490 GGAGACAGGGAGGCCAGAATTGG + Intronic
1156799479 18:41091725-41091747 GGCAACAGGAAGCCCAGTATGGG - Intergenic
1157213544 18:45763698-45763720 GGCTAGAGGGAGGTCAGTTTGGG - Intergenic
1157403909 18:47407955-47407977 GGCCAAGGGGGGGCCAGTGAAGG - Intergenic
1157750118 18:50170985-50171007 AGCCTCAGGGAGGCAGGTGTGGG - Intronic
1157870468 18:51225814-51225836 GGCCAAAGGGAGGCACATGTAGG + Intergenic
1160749712 19:728065-728087 GCCCCCAGGGAGGCCAATGCCGG - Intronic
1161372536 19:3921210-3921232 GGCCACAGGGAGGCTTTTCTTGG - Intronic
1161500901 19:4614969-4614991 GGCCAGAGGGAGGCCTGAATTGG + Intergenic
1161535701 19:4817508-4817530 GGTATCAGGGAGGCCAGTGGAGG + Exonic
1161551663 19:4916417-4916439 GGGCACAGGGAGGCCTTTGGAGG - Intronic
1161680700 19:5678381-5678403 GGCCCCAGGGAGCACAGGGTTGG - Intronic
1162018870 19:7859776-7859798 GCCCAAAGGGAGGCCACTGCAGG + Intronic
1162503708 19:11069626-11069648 GGCCACATGGAGCGCAGCGTGGG - Intergenic
1162820978 19:13223542-13223564 GACCGAAAGGAGGCCAGTGTGGG - Intronic
1162962443 19:14136145-14136167 GGTCACGGGGAGGTCCGTGTTGG + Intronic
1163440920 19:17322253-17322275 GGCCACAGGGAGGCAAGCTGGGG - Exonic
1163475405 19:17523207-17523229 GGCCCCAGGGACGACAGTGTGGG + Intergenic
1163510960 19:17734617-17734639 TGCGACATGGAGGCCAGAGTGGG - Intergenic
1163520425 19:17788392-17788414 GGCCTCAGGGAGGCTGGGGTGGG - Exonic
1164248618 19:23457447-23457469 GGCCACAGTGAGGCTAGGGGAGG - Intergenic
1164548159 19:29186134-29186156 GGGCACAGAGAGGCCAGTGGAGG + Intergenic
1164575587 19:29403664-29403686 GTCCTCAAGGAGGGCAGTGTGGG - Intergenic
1164809867 19:31147410-31147432 GGCCAGCGTGGGGCCAGTGTGGG + Intergenic
1165319350 19:35075948-35075970 GGACCCAGGGAGGCCCCTGTGGG - Intergenic
1165399199 19:35586876-35586898 GGCCAAATGGAGGACAGGGTAGG - Intergenic
1165475631 19:36028790-36028812 GGACAGAGGGAGCCCAGTGTGGG - Intronic
1165638225 19:37362059-37362081 GGCCATAGGTAGGGCTGTGTAGG - Intronic
1165648954 19:37469161-37469183 GGCCGGGGAGAGGCCAGTGTGGG + Exonic
1165659750 19:37566894-37566916 GGCCACAGGCAAGCTTGTGTAGG - Intronic
1166010295 19:39936266-39936288 GGCCTCTGGGAGGCCAGAGCGGG + Intergenic
1166062639 19:40336248-40336270 GGCCCCAGGTGGGCCAGAGTGGG + Intronic
1166069827 19:40380590-40380612 GGGCACATGGTGGCCAGTGATGG + Exonic
1166292232 19:41870510-41870532 GGCCACAGGGAGGCCAAGACAGG - Intronic
1166310087 19:41957936-41957958 GGCCACCTGGTGTCCAGTGTGGG + Intronic
1166564177 19:43753749-43753771 GGGCACAGGGAGGCCAGGTGCGG - Intronic
1166783321 19:45353343-45353365 GGACCCAGGGAGGTCAGGGTGGG + Intronic
1167148300 19:47695207-47695229 GGACACAGGAAGGCCAGAGGTGG + Intronic
1167569317 19:50276932-50276954 GGCCACGGGGAGGGCAGGGCAGG + Intronic
1167906437 19:52664706-52664728 GGCCTGAGTGAGGCCAGGGTGGG + Intronic
1168146265 19:54421302-54421324 GGCAACAGTGAGACCAGTGATGG + Exonic
1168353808 19:55690267-55690289 GGCCACAGGGAGGAGGGTGCAGG + Intronic
926269658 2:11355660-11355682 GACCACAGAGAGCCCAGAGTAGG - Intergenic
927047893 2:19298330-19298352 GGCCTCTGGGATGCCAGTTTTGG - Intergenic
927555414 2:24027694-24027716 GGACACTGGGAGGCCAAGGTGGG + Intronic
927641773 2:24849980-24850002 GGCCACAAGGAGAGCAGTGGGGG - Intronic
928387093 2:30879854-30879876 GGCCCTGGGGAGGCCTGTGTGGG + Intergenic
928504921 2:31940986-31941008 GGGAACAGGGAGTCCAGTTTAGG - Intronic
929583274 2:43097988-43098010 GTGCACAGGGAGGCCAGGGAGGG + Intergenic
929968172 2:46551053-46551075 GGGCCCTGGGAGTCCAGTGTGGG - Intronic
930747093 2:54896073-54896095 GGCCAGAGGGTGGCCAGTGACGG - Intronic
931327229 2:61239194-61239216 GGATACAGAGAGGCCATTGTAGG - Intronic
931464662 2:62475706-62475728 GGCCACTTGAATGCCAGTGTCGG + Intergenic
932559717 2:72856434-72856456 GGAGTCAAGGAGGCCAGTGTGGG - Intergenic
934055449 2:88247743-88247765 GGGCACAGGGAGGTGGGTGTGGG + Intergenic
935033083 2:99341008-99341030 GGCCTTTGGGAGGCCAGGGTGGG - Intronic
935064512 2:99636269-99636291 GGCCACAGGGAGGCCATGTGGGG + Intronic
937029440 2:118725909-118725931 GGCCACAGGGAAACCATTGTGGG - Intergenic
937337172 2:121069167-121069189 GGGCACCTGGAGGCCAGTGGTGG - Intergenic
937868594 2:126771784-126771806 GGCCACAGGGAGCACAGAGTAGG + Intergenic
938405128 2:131028271-131028293 GGGCACAGGGAGTCCTGTGTTGG - Intronic
941871442 2:170389931-170389953 GGCTACAGGGAAACCAGTGAGGG - Intronic
942247837 2:174023938-174023960 GGCCAGTGGGAGGCCAGGGAGGG + Intergenic
942991963 2:182212820-182212842 GGCGGCAGGGAGGCCAGGGGAGG + Intronic
945664665 2:212725720-212725742 GCCCACAGAGAGGCCTGTTTGGG - Intergenic
946146799 2:217737403-217737425 GGCCAGAGGAAGGCCAGAGTGGG - Intronic
946153915 2:217794498-217794520 GGCCACAGGGAGGCCAGAGCGGG - Intergenic
947863598 2:233380408-233380430 GGCCACAAGGTAGCCAGTGTGGG - Intronic
947948457 2:234126824-234126846 GGCCACAGGGTGGGCAGGGCAGG - Intergenic
948388505 2:237596425-237596447 GGCCAGAGGAAGGCCAGTGTGGG - Intronic
948703816 2:239777370-239777392 GGCCTCAGGCAGGGCAGCGTGGG - Intronic
948942240 2:241202368-241202390 GCCCCCAGGGAGGCGGGTGTGGG + Intronic
1168894311 20:1313126-1313148 GCCCACGGAGAGGCCAGTGGAGG + Intronic
1168917915 20:1506419-1506441 GGCTATAGGGAGACCAGTGAGGG + Intergenic
1172195920 20:33091424-33091446 GGCCAGATGCAGGCCAGTGCTGG - Intronic
1172311080 20:33918892-33918914 GGCAGCAGGGAGGCCAGGGAGGG - Intergenic
1172331025 20:34076231-34076253 GGGCACAGAGAGTCCAGTGCTGG + Intronic
1172619617 20:36310351-36310373 GGCCACAGGGAGGCTGGTGGTGG + Intronic
1172707246 20:36891305-36891327 GGCTACACGGTGGCCAGTGATGG + Exonic
1172781089 20:37437453-37437475 TGCCCCATGGAGGCCAGTGCTGG + Intergenic
1173433255 20:43010170-43010192 GGACACAGGTGGGTCAGTGTGGG - Intronic
1173501899 20:43559872-43559894 GGACAGAGGGAGGCAAGTCTGGG + Intronic
1174503624 20:51003012-51003034 GGGCACGGGGAGGCCTGTGGGGG + Intergenic
1175337744 20:58207056-58207078 GGACACAGGGAAGCCAGGCTAGG + Intergenic
1175646777 20:60680979-60681001 GGCCACACTGAACCCAGTGTTGG - Intergenic
1176066228 20:63197470-63197492 CTACTCAGGGAGGCCAGTGTGGG - Intronic
1176380052 21:6107870-6107892 AACCACAGGGAGCCAAGTGTAGG + Intergenic
1178259492 21:31085806-31085828 GGCCCCAGAGAGGGCAATGTGGG - Intergenic
1179438712 21:41379061-41379083 GGCAGCAGGGAGGCCAGGGGAGG - Intronic
1179743422 21:43430368-43430390 AACCACAGGGAGCCAAGTGTAGG - Intergenic
1179982976 21:44906010-44906032 GGCCACAGTGAGGCCAGGGAAGG - Intronic
1179999930 21:44991012-44991034 GGCCACAGGGAGTCCAGCCGAGG + Intergenic
1180038731 21:45264873-45264895 GGCCTCAGGGAGCCCCGTGGAGG - Exonic
1180172495 21:46067068-46067090 GGCCAGAGGGAGGGGACTGTTGG + Intergenic
1181237345 22:21455690-21455712 GGCCACATGGGGACCAGGGTTGG + Intergenic
1181305769 22:21916487-21916509 GGCCACAGTGTGGCAAGTGGGGG - Intergenic
1181539464 22:23565767-23565789 GGGCAGAGGGAGGTCAGTGCTGG - Intergenic
1182355956 22:29722288-29722310 GGCCGCAGGGTGGGCAGTGCAGG + Intronic
1182359828 22:29739936-29739958 GGCCTCAGGGTAGCCAGTGAAGG - Intronic
1182520590 22:30882426-30882448 GGCCACAAGGAGGTGTGTGTAGG - Intronic
1182770138 22:32789011-32789033 GGCCAAGGGGCGGCCAGGGTAGG + Intronic
1183215453 22:36476691-36476713 TGCCACAGGGAAGCCAGTATAGG - Intronic
1183510098 22:38229690-38229712 GACCACAGGGAGGCCAGCCCAGG + Intronic
1183510143 22:38229918-38229940 GACCACAGGGAGGCCAGCCCAGG + Intronic
1183510166 22:38230032-38230054 GACCACAGGGAGGCCAGCCCAGG + Intronic
1183510189 22:38230146-38230168 GACCACAGGGAGGCCAGCCCAGG + Intronic
1184254427 22:43278990-43279012 GGCCACAGACAAGCCAGAGTGGG + Intronic
1184286730 22:43476238-43476260 GGCCACAGGGTGCCCAGTGCTGG + Intronic
1184448960 22:44571534-44571556 GGGCACAGAGAGGTCAGTGGGGG - Intergenic
1184532022 22:45062156-45062178 GGCCACAGTGGAGACAGTGTGGG + Intergenic
1184648332 22:45908092-45908114 GGCCACAGAGAAGGCAGTGCTGG - Intergenic
1184913754 22:47552919-47552941 GGTCACAGTGAGGGCAGTGAGGG - Intergenic
1185039146 22:48495571-48495593 GGGCACAGGGAGCCCAGGGAAGG - Intronic
1185101051 22:48841016-48841038 GACCACGGGGAGGCCAGGGCAGG - Intronic
1185245745 22:49771827-49771849 GTCCCCAGGGAGGCCGCTGTCGG - Intergenic
1185275126 22:49947446-49947468 GTCCACTGGGAGCCAAGTGTGGG + Intergenic
1185334472 22:50265493-50265515 GGCTGCAGGGAAGCCAGTGGTGG + Exonic
1185340114 22:50287394-50287416 GACCACAGAGAGGCCTGTATTGG - Intronic
949198753 3:1345360-1345382 GCACACTGGGAGGCCAGGGTGGG - Intronic
950288305 3:11762674-11762696 GGGCACAGGAAGGCCAGGATAGG - Intergenic
950529695 3:13546129-13546151 AGCCACAGTGGGGGCAGTGTGGG - Intergenic
950558970 3:13711088-13711110 GGCCACAAGGAGGGAAGTGTGGG + Intergenic
950559056 3:13711504-13711526 GGCCACATGGAGGAAAGTGAGGG + Intergenic
950787675 3:15449785-15449807 GGCCAGAGGAGGGCCAGGGTAGG + Intronic
951838292 3:27005567-27005589 GACCACATGGAGCCCAGTGAGGG - Intergenic
953431551 3:42844538-42844560 GGCCACAGACAGAGCAGTGTGGG + Intronic
953744969 3:45567183-45567205 GCCTGCAGGGAGGCCTGTGTGGG - Intronic
954014358 3:47673439-47673461 GCACACCGGGAGGCCAATGTGGG + Intronic
954625348 3:52019406-52019428 GCCCACATGGCGGCCAGTGGAGG + Intergenic
955085237 3:55696358-55696380 GGCCACAGGAAGGCCAGGGCTGG + Intronic
957826112 3:85446846-85446868 GCACATAGGGAGGCCAGGGTGGG - Intronic
960611949 3:119562708-119562730 GGCAACAGTGAGCCCACTGTGGG - Intergenic
961519600 3:127459357-127459379 GACCACAGGGAGCCCAGAATGGG + Intergenic
961662531 3:128477317-128477339 TGCCACAGTGAGGGCAGGGTTGG - Intergenic
962754692 3:138458625-138458647 GGGCACAGGGAGCCCAGAATGGG - Intronic
962832914 3:139159865-139159887 GGACAAAGGCAGGGCAGTGTGGG - Intronic
964325469 3:155541436-155541458 GGACACTTGGAGGCCATTGTAGG + Intronic
965451987 3:168849514-168849536 GGACACAGTGAGGACAGTGAGGG - Intergenic
965599037 3:170437281-170437303 GAGGACAGGGAGGCCAGTGTGGG + Intronic
967603658 3:191418174-191418196 GGACACTTGGAGGCCACTGTAGG - Intergenic
968462785 4:733574-733596 GCCCCCAGGGAGGACAGTGCAGG - Intronic
968545156 4:1194501-1194523 GGCCGCAGGCAGGGCTGTGTGGG + Intronic
968622594 4:1610559-1610581 GACAACAGGGAGGGCAGTGGGGG + Intergenic
968768492 4:2487973-2487995 GGAGAAAGGGAGGCCAGAGTAGG - Intronic
969480744 4:7445629-7445651 GGCTGCAGGGAGGCCAGAGGAGG + Intronic
969625645 4:8304031-8304053 GGACACAGAGTGGCCAGTGGTGG + Intronic
970425098 4:15938532-15938554 GGCCACAGGGTGGACAGGGAAGG - Intronic
972349516 4:38223727-38223749 AGCCACTGGGAGCCCAGTTTGGG + Intergenic
972676199 4:41261901-41261923 TGGCACAGGAAGGCCAATGTCGG + Exonic
973651808 4:53004302-53004324 GGCCACACGGAGGACATGGTAGG + Intronic
974258409 4:59492139-59492161 TGCAGCAGGGAGGCCTGTGTGGG - Intergenic
974674350 4:65071321-65071343 GGCCACAGGGAAGACTGTATGGG - Intergenic
976154251 4:82125626-82125648 CACCACAGGGAGGCCAAGGTAGG - Intergenic
980872165 4:138623685-138623707 GGCCTCATGGAGCCCAGTGAGGG + Intergenic
980993843 4:139762023-139762045 GAGCCCAGGGAGCCCAGTGTGGG + Intronic
983181778 4:164656680-164656702 GGCCTCAGGGATCCCAGTGAGGG - Intergenic
985524525 5:395220-395242 GGACGCAGGGCAGCCAGTGTCGG - Intronic
985524929 5:396922-396944 AGTCACAGAGAGGCCGGTGTGGG - Intronic
985699721 5:1363301-1363323 AGCCCCAGGGAGGGCAGTGCAGG - Intergenic
985942655 5:3150893-3150915 CCCCACAGGGAGGCCAGGGCAGG + Intergenic
986903668 5:12467911-12467933 GGGCACAGGCAGGCTTGTGTGGG - Intergenic
987646284 5:20676398-20676420 GGCCATAGGCAGGTCAGTCTTGG + Intergenic
989456439 5:41649462-41649484 GGCAAAAGTGAGGCCAGTGATGG - Intergenic
991484855 5:67124219-67124241 TTTCACAGGGAGGTCAGTGTAGG + Intronic
993289325 5:86044131-86044153 GACCACAGGTAGGCAAGTTTGGG - Intergenic
993319943 5:86459471-86459493 GGCCACAGCCAGGTCAGTCTTGG - Intergenic
996836342 5:127797178-127797200 GACCACAAGGAAGCCAGTGGGGG + Intergenic
997303977 5:132825376-132825398 GGGCCCAGGGAGGCCAGAGCTGG + Exonic
998129560 5:139644498-139644520 GGCCACATGGAGAGGAGTGTGGG - Intergenic
999199506 5:149805901-149805923 TTCCCCAGGGAGCCCAGTGTGGG + Intronic
999340155 5:150763245-150763267 GGCAACAGGGAGGCCCTGGTTGG + Intergenic
1000170681 5:158700558-158700580 GGACACAGGGAGGCCACCCTGGG + Intronic
1001270972 5:170311510-170311532 GCCCAGAGTGAGCCCAGTGTAGG + Intergenic
1001953151 5:175830147-175830169 GGGCACATGAAGGGCAGTGTGGG + Intronic
1002879529 6:1238695-1238717 GGGCACAGGGAGGGCACAGTAGG - Intergenic
1003880238 6:10473928-10473950 AGCTACTGGGAGGCCAATGTGGG + Intergenic
1004306631 6:14507185-14507207 GGCCTCAGGAAGGGCAGTGCAGG - Intergenic
1004426940 6:15513142-15513164 GTCTGCAGGGAGGCCGGTGTGGG + Intronic
1005959687 6:30686462-30686484 TACCCCAGGGAGGCTAGTGTGGG + Exonic
1006168055 6:32077145-32077167 GGCCTCACAGAGCCCAGTGTGGG + Intronic
1006797122 6:36738883-36738905 GGCCAGAGGGAGGGCACTGAGGG - Intergenic
1007693617 6:43718223-43718245 GGCCGGAGGGAGGGCAGTCTGGG - Intergenic
1008319915 6:50098348-50098370 GGTGACAGAGAGACCAGTGTGGG + Intergenic
1008820521 6:55626034-55626056 GGCCATAGCCAGGTCAGTGTTGG - Intergenic
1013473490 6:110486841-110486863 GGCCAAGGGGAGGACAGGGTGGG - Intergenic
1015046586 6:128783393-128783415 GGCCACAGGGACGTCTGAGTAGG + Intergenic
1017741996 6:157414663-157414685 GGGCACAGGGAGCCTAGTTTAGG + Intronic
1018388041 6:163322314-163322336 GACCACAGTGAGGCCAGGGGAGG - Intergenic
1019324489 7:431632-431654 GGCCACAGGGAGCAGAGGGTCGG - Intergenic
1019477803 7:1252345-1252367 GGCCACAGAGAAGCGAGGGTGGG + Intergenic
1019568020 7:1694266-1694288 ACCCGCAGGGAGGCCAGTGTGGG - Exonic
1019654488 7:2182974-2182996 GCCCTCTGAGAGGCCAGTGTGGG + Intronic
1019735248 7:2647167-2647189 GGCAACGGGGAGACCAGTGATGG + Exonic
1020073593 7:5243250-5243272 GGGCCCAGGGAAGCCAGGGTGGG - Intergenic
1021877815 7:25064808-25064830 GGCCACAGTGAGACATGTGTAGG + Intergenic
1023081198 7:36528083-36528105 GGGCACAGTGAGACCACTGTGGG - Intronic
1023943379 7:44784645-44784667 GCCCCCATGGTGGCCAGTGTAGG + Intergenic
1024323690 7:48092479-48092501 GGCCAAATGAAGGACAGTGTAGG - Intronic
1024648348 7:51386670-51386692 GGCCGCCGGGAGGCCAGAGCTGG + Intergenic
1024924998 7:54602814-54602836 GAGCACAGGGAGGCGTGTGTGGG - Intergenic
1025176080 7:56803154-56803176 GGCCACAGTGAGGCCCGAGCTGG + Intergenic
1025176318 7:56804152-56804174 GGCCACCGGGAGGCCGGAGCTGG - Intergenic
1025695714 7:63773268-63773290 GGCCACAGTGAGGCCCGAGCTGG - Intergenic
1025951152 7:66146351-66146373 GGCCACAGCGTGCCCAGTGGTGG - Intronic
1027230946 7:76272104-76272126 GGCTGGAGGGAGGCCAGTGAAGG - Intronic
1029506128 7:100965178-100965200 AGGCACAGGGAGGGCAGTGAGGG - Intronic
1029627173 7:101727209-101727231 GGTCACAGGAAAGCCAGTCTTGG + Intergenic
1031235272 7:119168235-119168257 GGCCCCAGGAATGGCAGTGTTGG + Intergenic
1032247233 7:130223337-130223359 GGCCTCAGGGAGGCCAGGTGCGG + Intergenic
1032399045 7:131610982-131611004 GGGCGCAGGGAGGCCTGAGTGGG - Intergenic
1032769031 7:135029812-135029834 GAGCACATGGAGGCCATTGTAGG + Intronic
1034291361 7:149934697-149934719 GGCCACAGGCTGGTCAGTGCGGG + Intergenic
1034526272 7:151664976-151664998 GGTCACAGGGATGCAAGTGTAGG - Intronic
1034814737 7:154162197-154162219 GGCCACAGGCTGGTCAGTGCGGG - Intronic
1034844586 7:154432442-154432464 GGACAAAAAGAGGCCAGTGTGGG + Intronic
1035373667 7:158394353-158394375 GGCCACAGGGAGGGCATTGGAGG + Intronic
1036025543 8:4904525-4904547 GTCCACAGAGAGGGCAGTGTAGG - Intronic
1037407140 8:18554964-18554986 TACCGTAGGGAGGCCAGTGTGGG + Intronic
1037806311 8:22059577-22059599 GGCCTCAGGCAGGCCGGGGTAGG + Intronic
1038048656 8:23789084-23789106 GGCAAAAGGGAGGACACTGTTGG + Intergenic
1039128114 8:34227898-34227920 GGGCACAGGGAAGCCATTGGAGG + Intergenic
1039445235 8:37625879-37625901 GCCCACAGGCAGGCCAGTCCTGG + Intergenic
1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG + Intergenic
1040284056 8:46091113-46091135 GGCCTCAGGCAGGCCTCTGTGGG + Intergenic
1040284519 8:46093044-46093066 GGCCGCAGGCAAGCCAGGGTGGG + Intergenic
1040284872 8:46094550-46094572 GGCCACAGGTGGGCCTGTGCAGG + Intergenic
1040285526 8:46098658-46098680 GGCCTCATGCAGGCCTGTGTGGG + Intergenic
1040285654 8:46099203-46099225 GGCCACAGGCAGGCTGGTGAGGG + Intergenic
1040289781 8:46118346-46118368 GGCCACAGGGTGGCGTGTGCAGG - Intergenic
1040296409 8:46151352-46151374 GGTCACAGGCAGGCATGTGTAGG - Intergenic
1040296752 8:46152856-46152878 GGCCACAGGTGGGCCTTTGTGGG - Intergenic
1040298631 8:46176372-46176394 GGCCACAGGGTGGCTTGGGTGGG + Intergenic
1040303895 8:46202219-46202241 GGCCACAGGGTGGCGTGGGTGGG + Intergenic
1040311792 8:46240606-46240628 GGCCACAGGGTGGCGTGGGTGGG + Intergenic
1040319760 8:46286636-46286658 GGCCACATGTGGGCCAGTGCAGG - Intergenic
1040323040 8:46328096-46328118 GGCCACAGGCAGGCCTCTGTGGG - Intergenic
1040325901 8:46341362-46341384 GGCCACAGTGAGGCCAGATCGGG + Intergenic
1040332865 8:46401213-46401235 GGCCACAGGCAGGCCTGTTCGGG - Intergenic
1040332965 8:46401638-46401660 GGCCACAGGCAGGCCTGTGCGGG - Intergenic
1040336414 8:46418319-46418341 GGCCACAGGGTGGCCTGGGTGGG + Intergenic
1040337448 8:46423251-46423273 GGCCACAGGGTGGCGAGGGCAGG + Intergenic
1040338843 8:46429767-46429789 GGCCGCAGGGTGGCCAGGGCGGG + Intergenic
1040342702 8:46448934-46448956 GGTCACAGGAGGGCCTGTGTGGG - Intergenic
1040563472 8:48545341-48545363 GGCCACAGGGGGGCGAGCCTGGG + Intergenic
1044230960 8:89777046-89777068 GGAAACAGGGATGACAGTGTGGG + Intronic
1047191219 8:122680856-122680878 GCCCACAGGGATCCCAGGGTGGG - Intergenic
1048821131 8:138381850-138381872 TCCCACAGAGAAGCCAGTGTCGG + Intronic
1049130952 8:140840288-140840310 GCACACTGGGAGGCCAGGGTAGG - Intronic
1049274320 8:141712082-141712104 GACCACCAGGAGGCAAGTGTGGG + Intergenic
1049311210 8:141934850-141934872 GGCCTCAGCCAGGCCAGGGTGGG - Intergenic
1050398811 9:5229325-5229347 GGCCACAGGGGCTCCAGTCTAGG - Intergenic
1051504487 9:17812381-17812403 GCCAGCTGGGAGGCCAGTGTGGG + Intergenic
1053417557 9:37956305-37956327 GGCCACAGGGAGGTTTCTGTGGG - Intronic
1057218649 9:93243781-93243803 GACCCCAGGGAGGCCAGTGACGG - Intronic
1057299933 9:93872074-93872096 GGCCATAGGGACCCCACTGTTGG + Intergenic
1059456990 9:114406042-114406064 GAACACAGGGTGGCCAGGGTAGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060792404 9:126495323-126495345 TGCCACAGGGAGGGAAGGGTTGG + Intronic
1060887687 9:127167194-127167216 TGTCACAGGGAAGCCAGGGTGGG + Intronic
1061420701 9:130471667-130471689 GGGCAGAGGGGGGCCAGTGCGGG - Intronic
1061579813 9:131530089-131530111 GTCCTCAGAGAGGCCAGTGTGGG - Intronic
1061669010 9:132178140-132178162 GGCCACAGTGAGGCCTGAGGAGG + Intronic
1061681714 9:132245713-132245735 TGCCACATGGAAGCCAGTGATGG - Intergenic
1062001500 9:134218132-134218154 TCCCACAGAGAGGCCAGGGTGGG + Intergenic
1062171250 9:135136027-135136049 GGACACAGGGAGGACAGGGATGG + Intergenic
1062173612 9:135148814-135148836 GACCACAGGGTGGCCAGGGCAGG + Intergenic
1062340520 9:136092052-136092074 CGCCTCAGGGAGGCCGGTGTGGG + Intronic
1062453720 9:136626247-136626269 GGAGCCAGGCAGGCCAGTGTGGG + Intergenic
1203577763 Un_KI270745v1:21565-21587 GGCCCCTGGGAGGCAAGGGTGGG - Intergenic
1188148470 X:26643758-26643780 GGACACAGGCAGGAAAGTGTAGG + Intergenic
1188421096 X:29991714-29991736 GACCACAGGGAGCCCACTGTGGG - Intergenic
1189148835 X:38683974-38683996 GGCCACAGAGAGGACAAAGTAGG + Intronic
1193509078 X:82377648-82377670 GGCCACATCGATGCAAGTGTGGG + Intergenic
1195153089 X:102094225-102094247 GGCCACAGGCAGGTCAGCCTTGG + Intergenic
1196746180 X:119073338-119073360 GGCCACAGTGTTGCCACTGTCGG - Intergenic
1199800522 X:151246874-151246896 GGACAGAGGGAGCCCAGGGTAGG + Intergenic
1200239125 X:154484651-154484673 TTCCACAGGGAGGCCAGTGCTGG + Exonic
1201260603 Y:12155462-12155484 GCACACTGGGAGGCCAGGGTGGG + Intergenic
1202369730 Y:24188528-24188550 CTCCACAGGGAGGCCAGAGGAGG + Intergenic
1202501055 Y:25481589-25481611 CTCCACAGGGAGGCCAGAGGAGG - Intergenic