ID: 1104655645

View in Genome Browser
Species Human (GRCh38)
Location 12:130572133-130572155
Sequence ATGGCCAGGAGTTATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 265}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104655641_1104655645 -5 Left 1104655641 12:130572115-130572137 CCCAGTGCGTGAAACAGCATGGC 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 265
1104655635_1104655645 7 Left 1104655635 12:130572103-130572125 CCCTGCTCCACCCCCAGTGCGTG 0: 1
1: 0
2: 2
3: 16
4: 248
Right 1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 265
1104655638_1104655645 -3 Left 1104655638 12:130572113-130572135 CCCCCAGTGCGTGAAACAGCATG 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 265
1104655636_1104655645 6 Left 1104655636 12:130572104-130572126 CCTGCTCCACCCCCAGTGCGTGA 0: 1
1: 0
2: 0
3: 12
4: 313
Right 1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 265
1104655642_1104655645 -6 Left 1104655642 12:130572116-130572138 CCAGTGCGTGAAACAGCATGGCC 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 265
1104655639_1104655645 -4 Left 1104655639 12:130572114-130572136 CCCCAGTGCGTGAAACAGCATGG 0: 1
1: 0
2: 0
3: 18
4: 148
Right 1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 265
1104655637_1104655645 0 Left 1104655637 12:130572110-130572132 CCACCCCCAGTGCGTGAAACAGC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104655645 Original CRISPR ATGGCCAGGAGTTATGAGGA AGG Intronic
900901953 1:5523173-5523195 ATGGCAAGGAGCTTTGAGCAGGG - Intergenic
901272005 1:7959478-7959500 ATGGCCAAGAGATATGAAAAAGG + Intronic
901453603 1:9351041-9351063 ATGTCCAGGAATTGTGATGATGG + Intronic
903549185 1:24145886-24145908 ATGGGCTGGAGTTATCAAGAAGG - Intergenic
904301818 1:29559190-29559212 GTGGGCAGGAGTTAGGAGGTGGG + Intergenic
905256841 1:36690235-36690257 ATGGCCATGAGCCAAGAGGAAGG + Intergenic
906701667 1:47864081-47864103 GTGGCCAGGTGTTGTGGGGAGGG + Intronic
907025838 1:51117520-51117542 GTTGCCAGGAGTTAGGGGGAGGG - Intronic
907175376 1:52516509-52516531 ATATCCAGGAGTTCTGTGGAAGG - Intronic
907342199 1:53743366-53743388 GTGTCCAGGAGATAGGAGGAAGG + Intergenic
908331486 1:63074983-63075005 ATGGCCACGGGTATTGAGGATGG - Intergenic
910280956 1:85501289-85501311 AAGGCCAGGCGGTAGGAGGAGGG - Intronic
911256939 1:95644143-95644165 AAAGGCAGGAGTTATGATGATGG - Intergenic
911932911 1:103927641-103927663 ATTGCCAAGAGTAATGTGGAAGG + Intergenic
914515293 1:148369171-148369193 ATGACCAGGAATTTTGATGATGG + Intergenic
915740501 1:158115193-158115215 ATGGCCTGGTGTTATGGTGAGGG - Intergenic
916193080 1:162197937-162197959 ATGCAAAGGAGGTATGAGGAGGG + Intronic
916220921 1:162444589-162444611 ATCGCGAGGAGTTAAGAGGAAGG - Intergenic
916540477 1:165748854-165748876 GTTGCCAGGAGTTAGGAGGAAGG - Intronic
918094318 1:181322028-181322050 ATGGACAGGAGTTAGATGGAGGG + Intergenic
918147004 1:181765834-181765856 AAGGCAAGGAGATATGAGGCAGG - Intronic
918181344 1:182087932-182087954 CTGACCAGGAGCTATGAGGGAGG - Intergenic
919712898 1:200746215-200746237 AGGGCCAAGAGTTATGAAGGAGG + Intronic
920067397 1:203278547-203278569 TTGGCCAGGAGAGAGGAGGAGGG + Intergenic
922375236 1:224957284-224957306 AAGGTCAGGAGTTTAGAGGAAGG + Intronic
1064282632 10:13965421-13965443 GTGTCCAGGAGGTATGAGAATGG - Intronic
1065428463 10:25630184-25630206 ACGGCCAGGGGTTCTGAGGCAGG + Intergenic
1069039345 10:63678625-63678647 AAAACAAGGAGTTATGAGGAAGG + Intergenic
1070065924 10:73034451-73034473 ATTACCAGGGGTTGTGAGGAGGG - Intronic
1070981111 10:80648672-80648694 ATTGCCAGGAGTTTGGAGGAGGG - Intergenic
1073125652 10:101147168-101147190 ATCTCCAGGAGTTATGGGGCGGG + Intergenic
1074107300 10:110398211-110398233 CTGGCCTGGAGTTATGAGCCCGG + Intergenic
1074387714 10:113030081-113030103 ATTGCCAGGAGCTATGGGGAAGG - Intronic
1074562967 10:114550717-114550739 GTTTCCAGGAGTTAGGAGGAGGG - Intronic
1074657573 10:115611917-115611939 AAGGCCAAAAATTATGAGGAAGG + Intronic
1074711462 10:116181421-116181443 TGGGCCAGGAGTCAGGAGGAAGG + Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075529299 10:123214208-123214230 ATGGCCAGGAGTAGTGAGGTGGG - Intergenic
1075646704 10:124101503-124101525 ATGGCCTGGAGTGATGTGGCTGG - Intergenic
1076196416 10:128521555-128521577 AGTGCCAGGAAATATGAGGATGG + Intergenic
1078201299 11:9186379-9186401 ATGGACAGGGCTTATGAGGCAGG - Intronic
1078538204 11:12192077-12192099 AGGGCAAGGGGTTATGGGGAGGG + Intronic
1081021175 11:37949191-37949213 ATGGACAGCAGATATAAGGAAGG + Intergenic
1082981575 11:59128722-59128744 ACAGCCAGGAGTGATCAGGAAGG + Intergenic
1084366417 11:68703858-68703880 ATTGCCAGGAGTTGTGGGGAGGG + Intergenic
1087150177 11:94852549-94852571 ATGCCCAGGATTTATGAACATGG + Intronic
1087728256 11:101748688-101748710 ATGGCCAAGAGTCTTCAGGAGGG + Intronic
1088721252 11:112593824-112593846 GTGGTCAGGATTTATGAGGATGG - Intergenic
1090564835 11:127978069-127978091 TTGACCAGGAGTAGTGAGGAGGG + Intergenic
1090667146 11:128922041-128922063 AAGGCCAGGAGCTCTGGGGATGG + Intergenic
1091965186 12:4734777-4734799 AGTGCCAAGAGATATGAGGACGG - Intronic
1092746426 12:11676510-11676532 AAGGCCAGGAGAGAAGAGGATGG - Intronic
1094160603 12:27385959-27385981 ATGCACAGGAATGATGAGGACGG - Intronic
1096138414 12:49222009-49222031 ATTACCAGGAGCTAGGAGGAAGG - Intronic
1097012493 12:55963216-55963238 ATGGCAAGCAGTGAGGAGGATGG + Intronic
1097194390 12:57235697-57235719 AGGACCAGGAGATAAGAGGATGG + Intronic
1098803270 12:74988317-74988339 ATGTCCAGGATATATCAGGAAGG + Intergenic
1099128983 12:78802905-78802927 ATGGCTGGGATTTAGGAGGATGG + Intergenic
1100024349 12:90109547-90109569 ATGGCCAGGAGTCATGGTCACGG - Intergenic
1101066521 12:101027486-101027508 ATGGCCTGGAGTTATAGAGATGG - Intronic
1101070331 12:101068119-101068141 ATGGCCAGAAGAAATAAGGAAGG + Intronic
1103735758 12:123059795-123059817 GTGGCCAGGAGCTGTGGGGAGGG + Intronic
1104024752 12:125017686-125017708 ATGTCCAGGAGTTGGAAGGATGG + Intronic
1104655645 12:130572133-130572155 ATGGCCAGGAGTTATGAGGAAGG + Intronic
1106979633 13:35262657-35262679 GTGGCCAGGAGTTATGGGTGAGG + Intronic
1107068037 13:36238108-36238130 ATTGCCAGGAGTTTAGTGGAAGG + Intronic
1108523817 13:51268283-51268305 ATGGAAAGGAGTAATGAGAACGG + Intronic
1108975368 13:56436929-56436951 ATGGCCAGTAGGTATGTGAAAGG - Intergenic
1109570986 13:64189561-64189583 ATTGTCAGGGGTTAGGAGGAAGG + Intergenic
1110921151 13:81087597-81087619 ATGGCCAGCAGGTATATGGAAGG + Intergenic
1111294367 13:86259721-86259743 ATTGCCAGGGGCTAGGAGGAGGG + Intergenic
1111454478 13:88462447-88462469 TTGGCCAGCGGTTAGGAGGAAGG - Intergenic
1112684707 13:101811275-101811297 GTTGCCAGGGGTTATGAGGAGGG - Intronic
1113209291 13:107956541-107956563 ATGGGCAGGTCTTCTGAGGATGG - Intergenic
1114469725 14:22951879-22951901 ATGGACTGTAGTTATGGGGAAGG - Intronic
1114569176 14:23653872-23653894 GTGGGCAGGAGCTTTGAGGATGG - Intergenic
1118073497 14:62271649-62271671 ATGAGCAGGAATTATGAAGAAGG + Intergenic
1118789469 14:69076608-69076630 GTTGCCAGGAGCTAAGAGGAGGG + Intronic
1120522380 14:85539108-85539130 AGGGCCCGGAGTGATGAGGGTGG - Intronic
1121712375 14:96048352-96048374 ATTGCTAGGAGTTAAGGGGAGGG - Intronic
1124131747 15:26995396-26995418 ATGGGCAGAAATTATGAGAATGG - Intronic
1128542407 15:68545202-68545224 ATGGCAAGGTTTTCTGAGGAGGG - Intergenic
1128716772 15:69914315-69914337 AAGGCCAGGAGGTAAGAGGAGGG - Intergenic
1129977785 15:79836849-79836871 ATGGCCTGGAGTATGGAGGATGG + Intronic
1129999962 15:80037668-80037690 ATGACCTGGAGCTTTGAGGAAGG - Intergenic
1130222444 15:82031565-82031587 ATCAGCAGTAGTTATGAGGAAGG - Intergenic
1131402212 15:92134223-92134245 AGGGCCAGGCTATATGAGGAGGG - Intronic
1131445646 15:92496208-92496230 ATGGCCGGGAGCTCTGGGGAAGG - Intronic
1131650827 15:94397580-94397602 CTGGCCAGCAGCTAAGAGGAAGG - Intronic
1132578314 16:673976-673998 GTGGCCAGTGGGTATGAGGAGGG + Exonic
1132694694 16:1196654-1196676 TTGGCCAGCAGGTGTGAGGAGGG + Intronic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1135064265 16:19296137-19296159 TTGGCCAGGATTGATCAGGAGGG + Intronic
1135124378 16:19796017-19796039 ATTGCCAGGGGCTAGGAGGAGGG - Intronic
1135597634 16:23755745-23755767 GAGGCCAGAAGTTATGAGGCCGG - Intronic
1135605122 16:23817487-23817509 ATGCCCAGGATCTATGTGGAGGG + Intergenic
1137692602 16:50439942-50439964 GTTGCCAGGGGTTAGGAGGAAGG + Intergenic
1138129477 16:54467309-54467331 ATGGGCAGGAGTTACTCGGAAGG + Intergenic
1139387912 16:66586098-66586120 ATGGGCAGGAGGGTTGAGGAAGG + Intronic
1140418637 16:74797324-74797346 ACGGACAGGAGTTAGAAGGATGG + Intergenic
1143406926 17:6683892-6683914 ATGGCCAGGGGTAATGGGGGAGG - Intergenic
1145819469 17:27820990-27821012 GTGGCAGGGAGGTATGAGGAAGG + Intronic
1148088565 17:45009068-45009090 ATGGCTGGGAGTTGTGGGGATGG + Intergenic
1149458894 17:56811377-56811399 ATGACCAGGAGTTCTCAGGCAGG - Intronic
1153297028 18:3556425-3556447 GTTGCCAGGGGTTAGGAGGAAGG - Intronic
1153492490 18:5663879-5663901 GTGGCCAGGAGTTCTGTGGTTGG - Intergenic
1155334632 18:24751368-24751390 ATTGGCTGGAGCTATGAGGATGG + Intergenic
1155812686 18:30258281-30258303 ATTGCCAGGAGTTAGGAGAGAGG - Intergenic
1156216360 18:35002100-35002122 GTTGCCAGGGGTTAAGAGGAGGG - Intronic
1157470802 18:47986612-47986634 AAGGAAAGGAGTGATGAGGAAGG + Intergenic
1160178933 18:76617926-76617948 ATGAACAGGAGTTGTAAGGATGG + Intergenic
1164473970 19:28559108-28559130 ATATCCAGGAGTTAGGAGGGAGG - Intergenic
1164826962 19:31290825-31290847 ATGGCCAGGACTTCTGCAGAAGG + Intronic
1165936777 19:39394054-39394076 AGGGGCAGGAGTTGAGAGGAGGG + Intronic
1166911343 19:46160481-46160503 ATGGGCAAGAGTGAAGAGGAAGG + Intronic
925751422 2:7093452-7093474 ATGGACAGGAGTGAGCAGGACGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927150717 2:20194248-20194270 AGGGTCAGGAGGTGTGAGGAGGG - Intergenic
927308296 2:21598978-21599000 ATGGCCAGGAGATATGAGCTGGG - Intergenic
928660632 2:33498794-33498816 ATGGACAGAAGTTATGATCAGGG - Intronic
928781272 2:34824207-34824229 ATGGTCAGAAGTTATGCGTATGG - Intergenic
929652949 2:43700465-43700487 ATGGACACGAGTTGTGATGATGG + Exonic
930109710 2:47668132-47668154 CTGGCCAGGGGCTATGAGGAGGG + Intergenic
935268751 2:101415914-101415936 ATAGCCAGGAGTAATGGGGCAGG + Intronic
936020561 2:108991595-108991617 ATGGCCAGGAGTCTTATGGAGGG + Intergenic
939219408 2:139282059-139282081 ATGGCTAGGAGACATGAAGATGG + Intergenic
940313034 2:152298566-152298588 ATTGTCAGGGGTTGTGAGGAGGG - Intergenic
941158887 2:162012769-162012791 ATGTCCAGGAGTTGTGTAGATGG - Intronic
942672470 2:178390662-178390684 ATGGCCAAATTTTATGAGGAGGG - Intronic
942960986 2:181829654-181829676 ATGGCAAGGGGTTGGGAGGAAGG - Intergenic
943542246 2:189231155-189231177 GTTGCCAGGAGCTAGGAGGATGG + Intergenic
1169595794 20:7196765-7196787 ATTGCCAGGGATTAGGAGGAGGG - Intergenic
1170400212 20:15974499-15974521 GTGGCCAGGAGTTGTGGGGGTGG + Intronic
1172129439 20:32645870-32645892 GTGGCCAGCAGTGTTGAGGATGG + Intergenic
1172169819 20:32922714-32922736 ATGGCCTGCAGTTATTTGGAAGG + Intronic
1173097560 20:40051179-40051201 ATACCTAGGAGATATGAGGAAGG + Intergenic
1175627449 20:60500961-60500983 ATGTCCTGAGGTTATGAGGATGG + Intergenic
1177761435 21:25406737-25406759 ATGGCCAGGAGTGATGGTGGTGG - Intergenic
1179199462 21:39203073-39203095 TAGGCCAGGAATTATGAGAAAGG + Intronic
1179509047 21:41860104-41860126 TCGGCCAGGAGTTCTGAGAAAGG + Intronic
1181033630 22:20159686-20159708 TAGGCCAGGAGTGATCAGGAGGG + Intergenic
1181509679 22:23383559-23383581 AGGGCCAGGAGTGATCAGGAGGG - Intergenic
1182313614 22:29427198-29427220 GTGCCCAGGACTGATGAGGAGGG + Intergenic
1182394477 22:30025574-30025596 TTGGCCAGCAGGTATGCGGAGGG - Intronic
1183232847 22:36593626-36593648 ATGGCAAGGATTTAGGAGGGCGG + Intronic
1183829238 22:40409219-40409241 ATGGCCAGGAGTGGGGAGCAGGG - Intronic
1183986904 22:41575093-41575115 CTGGCCAGGAGGTAGGTGGAGGG + Exonic
1184038460 22:41929447-41929469 ATTTACAGGAGTTAGGAGGAGGG + Intergenic
1184928254 22:47659557-47659579 ATGCCCAGGAGCTCTGAGGTTGG - Intergenic
950146825 3:10656118-10656140 ATGGCTGGGAGTTTGGAGGAGGG + Intronic
951853490 3:27169382-27169404 ATGGTCAGAAGTAATGGGGAGGG - Intronic
953391192 3:42534851-42534873 ATGACCAGGAAGTATGAGGATGG - Intronic
955130680 3:56164260-56164282 ATTGCCAGGAGCTAGGGGGAAGG - Intronic
956206302 3:66758570-66758592 ATGGCCAAGTGTTATGAGGTGGG + Intergenic
956939962 3:74146994-74147016 ATGCCCAGGTGTTCTGATGAAGG - Intergenic
958001814 3:87760710-87760732 ATGTCCAGGAGTTAGAAGGAAGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
961264794 3:125633223-125633245 AGGGTCAGGAGTCATGAGGCTGG - Intergenic
962433485 3:135342828-135342850 ATTGCCAGGGGCCATGAGGAGGG + Intergenic
962669400 3:137689757-137689779 ATGGCTAGCAGATATGAAGATGG - Intergenic
963465682 3:145678532-145678554 ATGGACAGGAGATCAGAGGACGG - Intergenic
963829081 3:149987842-149987864 ATGGCCCAGAGTTAAAAGGAAGG - Intronic
964732536 3:159882735-159882757 ATGCACAGGAGTTGAGAGGATGG - Intronic
965938018 3:174139274-174139296 ATTGCCAGGGATTAGGAGGAAGG - Intronic
966050863 3:175617003-175617025 CTGTCCTGGAGTCATGAGGATGG + Intronic
966184315 3:177214464-177214486 AAGGCCAGGAGGTGAGAGGAAGG + Intergenic
969146549 4:5129079-5129101 ATGTCCATAAGTTATGGGGAAGG + Intronic
970569675 4:17367561-17367583 GTGGCCAGCAGTGATGGGGAGGG + Intergenic
970899175 4:21138825-21138847 ATGGAAAGGAGTCATGAGGCAGG + Intronic
973342997 4:49025703-49025725 ATGGCCAAGAGATTTGAAGATGG - Intronic
973789726 4:54366795-54366817 AAGGCCAGGAGTGGGGAGGAAGG + Intergenic
975195702 4:71520933-71520955 AAGGCCAGGAGTTCTGAGGTGGG - Intronic
976814994 4:89137997-89138019 ACGGCCATGAGGTCTGAGGAAGG - Intergenic
977311125 4:95388574-95388596 ATCACCAGGAGTTAAGAAGAAGG - Intronic
978870333 4:113568175-113568197 ATGACCAGGAGTTCTGAAAATGG - Intronic
980163950 4:129201376-129201398 ATGTCAAGCATTTATGAGGATGG + Intergenic
980629605 4:135414921-135414943 TTGGGGAAGAGTTATGAGGATGG + Intergenic
982676368 4:158380717-158380739 ATGATCAGGGGTTATGGGGAAGG + Intronic
982824571 4:159986207-159986229 ATGGCCAGGAATAATCAGGGGGG - Intergenic
984816662 4:183844163-183844185 ATTGCAAGTAGATATGAGGATGG + Intergenic
985524984 5:397156-397178 ATGGTCAGGAGCTACGTGGATGG - Intronic
985524992 5:397195-397217 ATGGTCAGGGGCTATGTGGATGG - Intronic
985525051 5:397425-397447 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525059 5:397464-397486 ATGGTCAGGGGCTATGTGGATGG - Intronic
985525092 5:397596-397618 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525100 5:397635-397657 ATGGTCAGGGGCTATGTGGATGG - Intronic
985525159 5:397882-397904 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525177 5:397959-397981 ATGGTCAGGAGCTATGTGGATGG - Intronic
985525190 5:398016-398038 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525198 5:398055-398077 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525206 5:398093-398115 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525222 5:398170-398192 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525225 5:398189-398211 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525228 5:398208-398230 ATGGTCAGGAGCTACGTGGATGG - Intronic
985525236 5:398247-398269 ATGGTCAGGAGCTACGTGGATGG - Intronic
985935206 5:3092324-3092346 ATGTGCAGGAGTTTTGAGGGAGG + Intergenic
987051517 5:14150292-14150314 ATTGCCAGGAGTTAGGGGGTGGG + Intronic
987328895 5:16837454-16837476 GTTGCCAGGGGTTAGGAGGAGGG + Intronic
988422619 5:31024635-31024657 GTGGGCAGGAGGTAGGAGGAGGG - Intergenic
988591022 5:32549587-32549609 GTTGCCAGGAGTTGAGAGGAAGG - Intronic
989151359 5:38302902-38302924 ATAGCCAGGAGTAGTGAGGATGG - Intronic
990366374 5:55074906-55074928 ATGGGAAGGAGTTAGGAGGAGGG + Intergenic
990414540 5:55573564-55573586 ATTGCCAGGAGTTCAGGGGAGGG + Intergenic
992208278 5:74452297-74452319 CTGCCCAGCAGTTATGAGAAGGG + Intergenic
992322539 5:75628202-75628224 GTTGCCAGGAGCTAGGAGGAAGG + Intronic
994208153 5:97059268-97059290 ATGGCTGGGAGATATGAAGATGG - Intergenic
994628225 5:102248585-102248607 ATGACAAGGAGTTATTAGGAAGG - Intronic
994976190 5:106810237-106810259 ATTGCCAGGGGTGATGGGGAGGG - Intergenic
996474648 5:123903064-123903086 AAGGCCAGGAGAGATGGGGAAGG - Intergenic
997613334 5:135230208-135230230 AAGCCCTGGAGTTCTGAGGAAGG - Intronic
997833702 5:137175132-137175154 ATGGAAATGAGTTATGAAGAGGG + Intronic
998928184 5:147150928-147150950 AGGGACAGGATTTATGAAGATGG - Intergenic
1000980600 5:167812777-167812799 ATGGCCAGGTGATATGACCAAGG + Intronic
1001290224 5:170452002-170452024 ATCAGCAGGACTTATGAGGATGG - Intronic
1001574503 5:172753773-172753795 GTTGCCAGGAGTTATGGGGAGGG + Intergenic
1001664149 5:173418737-173418759 ATGGCCAGAATTAATGTGGATGG - Intergenic
1002236053 5:177803671-177803693 ATCCCTAGGTGTTATGAGGAGGG - Intergenic
1002283717 5:178148558-178148580 TTGGCCAGGAGAAATGAGAAGGG - Exonic
1003032084 6:2610373-2610395 GTTGCCAGGAGTTAGGGGGAGGG - Intergenic
1005168156 6:22949894-22949916 TTAGCCAGTATTTATGAGGAAGG + Intergenic
1005325950 6:24700743-24700765 ATGGCTAGGAGGTATAAGAAAGG - Intronic
1007277502 6:40685970-40685992 AGGGCAAGGAGGTAGGAGGAAGG - Intergenic
1007995812 6:46306497-46306519 ATGGTAAGGAGAGATGAGGAGGG + Intronic
1008561366 6:52728034-52728056 CTGTCCAGGAGAGATGAGGATGG - Intergenic
1010489949 6:76463618-76463640 TTGGCCAATAGATATGAGGAAGG - Intergenic
1010676187 6:78746320-78746342 GTTGCCAGGGGTTATGGGGAGGG + Intergenic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1012741184 6:103018400-103018422 ATGGCCTGGAGTTATAGAGATGG + Intergenic
1014741848 6:125155093-125155115 ACGGGCAGGACTTAGGAGGATGG - Intronic
1015156179 6:130098794-130098816 ATGCCCAGCAGTTAAGAGCAGGG - Intronic
1017719024 6:157232261-157232283 GTGGCCAGGAGATACGTGGAGGG + Intergenic
1020765464 7:12314304-12314326 ATGGGCTGGAGATAGGAGGATGG - Intergenic
1021154016 7:17186916-17186938 CTGGCCAGGAGATATCAGGATGG - Intergenic
1023117565 7:36877066-36877088 ATGGCCGTGAGCTGTGAGGAAGG + Intronic
1023502265 7:40863568-40863590 ATGGTGAGCAGTTATGAGAAGGG - Intergenic
1023558404 7:41447346-41447368 CTCCCCAGCAGTTATGAGGATGG + Intergenic
1024621210 7:51159071-51159093 CTGGCCAGGAGCTTGGAGGAGGG + Intronic
1024855224 7:53770853-53770875 CTTGCCAGGAATAATGAGGAAGG - Intergenic
1025521508 7:61737842-61737864 ATTGCCAAGAGATATTAGGAGGG - Intergenic
1027836543 7:83251218-83251240 ATTGCCAGGGGTTAGGGGGAAGG - Intergenic
1030049478 7:105524981-105525003 GTCGCCAGGAGTTAGGAGAAAGG + Intergenic
1035325116 7:158060835-158060857 ATGGCCTGGAGGGATGAAGAAGG + Intronic
1035605266 8:926349-926371 AAGGCCAGGAGGTGTGAGGGGGG - Intergenic
1035884950 8:3281657-3281679 ATTGCTAGGAATTAGGAGGAAGG + Intronic
1037323428 8:17665225-17665247 ATGCCCAGGAGTAATCAGAAAGG - Intronic
1038738476 8:30194485-30194507 GTTGCCAGGGGTTAGGAGGAAGG - Intergenic
1039104028 8:33970915-33970937 ATGGACAGGAGGCATGAGGGTGG - Intergenic
1039325691 8:36483266-36483288 ATGGCCCTGAGTTTTGATGAAGG + Intergenic
1040704506 8:50109645-50109667 AAGTCCAGGTGTTATCAGGAAGG + Intronic
1040817220 8:51520774-51520796 AGGGCCAGGAGTGTTGAGCAAGG - Intronic
1041150948 8:54933748-54933770 ATGAGCAGGATATATGAGGAAGG - Intergenic
1042568793 8:70140273-70140295 AGGGCCAGGAGTTGTGGGGAGGG - Intronic
1043650829 8:82589374-82589396 ATGCCCAAGAGTTATTAGGTTGG - Intergenic
1044404311 8:91810246-91810268 AAACCCAGGAGTAATGAGGAAGG - Intergenic
1045619890 8:103963848-103963870 ATTGCCAGGGGTTAGGAGAAAGG - Intronic
1045653602 8:104365493-104365515 ACGGCCAGGAGTCCTCAGGAGGG + Intronic
1047651057 8:126921906-126921928 ATTTCCAGGGGTTAGGAGGAAGG - Intergenic
1047980091 8:130171857-130171879 ATGCCCAGGAGTTAAAAGTATGG + Intronic
1048103303 8:131379020-131379042 GTGGCCAGAAGTTATGAGAGAGG + Intergenic
1048761256 8:137798146-137798168 ATGGGGAGGAGATATGATGAAGG + Intergenic
1053608038 9:39680397-39680419 ATGGCTAGGAGTGATGAGAGTGG - Intergenic
1053865881 9:42436757-42436779 ATGGCTAGGAGTGATGAGAGTGG - Intergenic
1054245494 9:62662012-62662034 ATGGCTAGGAGTGATGAGAGTGG + Intergenic
1054559621 9:66696543-66696565 ATGGCTAGGAGTGATGAGAGTGG + Intergenic
1055311392 9:74985427-74985449 GTGGACAGGAGTTATATGGAAGG + Intronic
1056079095 9:83072242-83072264 ATGGGCAGAAGGTATGAGGATGG - Intergenic
1061057549 9:128232533-128232555 AGGCCAAGGAGTTTTGAGGAGGG - Intronic
1062651333 9:137579222-137579244 ATGGCCAGGAGTAACCGGGAGGG - Intergenic
1186078413 X:5905178-5905200 ATTGCCAGTACTTATGAGAAGGG - Intronic
1186609711 X:11127298-11127320 ATGGTCAGTAGATATGAGGTGGG + Intergenic
1188891895 X:35622057-35622079 ATTGCCAGGGGTTGTGGGGAGGG + Intergenic
1190753183 X:53380005-53380027 AGGGCCAGGAGGTAGGGGGAAGG + Exonic
1192340767 X:70261602-70261624 AAGGCCAGGTGTTGTGAGAAGGG + Intergenic
1193116817 X:77783469-77783491 ATGGCCAGAAGACAAGAGGAAGG - Intronic
1193605930 X:83567552-83567574 ATGGCCTGGAGTTATAGAGATGG + Intergenic
1193979777 X:88168092-88168114 ATGACCATGTGTTTTGAGGATGG + Intergenic
1194801451 X:98278362-98278384 GTTGTCAGGAGTTAGGAGGAGGG - Intergenic
1196021104 X:110992040-110992062 ATGGTCAGGAGTGGTGAGGGAGG + Intronic
1196262703 X:113603415-113603437 ATTGCCAGGAGTTGGGAGAAAGG + Intergenic
1196739787 X:119014703-119014725 AAGGCCAGGACTTAAGAGAAGGG + Intronic
1197018156 X:121652679-121652701 ATTGCCAGGGGTTGTGTGGAAGG - Intergenic
1197049580 X:122042552-122042574 ATGGCCTGGAGCTATGGAGATGG + Intergenic
1197144079 X:123151576-123151598 GTTGCCAGGAGCTGTGAGGAAGG + Intergenic
1197299319 X:124758861-124758883 ATTTCCAGGAGTTGAGAGGAGGG + Intronic
1197485512 X:127045535-127045557 TTGGCCAGGGGTGAGGAGGAGGG - Intergenic
1198410857 X:136366197-136366219 ATTGCCAGGGGTTGAGAGGAAGG - Intronic
1199652982 X:149966232-149966254 ATGGTCAGGAGTGGAGAGGAGGG - Intergenic
1199876329 X:151931838-151931860 ATGGACTGGAGTTCTGTGGAAGG - Intergenic
1199893146 X:152108029-152108051 ATGGACTGGAGTTTTGTGGAAGG + Intergenic
1200015301 X:153157844-153157866 ATTGCCAGGGGCTAGGAGGAGGG + Intergenic
1201516953 Y:14828382-14828404 ATTGCCAGTAGTTATAAGAAGGG + Intronic