ID: 1104658714

View in Genome Browser
Species Human (GRCh38)
Location 12:130593182-130593204
Sequence TGGGTGGAGGGTCCCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104658714_1104658723 30 Left 1104658714 12:130593182-130593204 CCCAAGGAGGGACCCTCCACCCA 0: 1
1: 0
2: 3
3: 24
4: 173
Right 1104658723 12:130593235-130593257 CGCCCTCATCATCACAGCACTGG 0: 1
1: 0
2: 0
3: 13
4: 117
1104658714_1104658721 3 Left 1104658714 12:130593182-130593204 CCCAAGGAGGGACCCTCCACCCA 0: 1
1: 0
2: 3
3: 24
4: 173
Right 1104658721 12:130593208-130593230 ACAGCAGTCTCTAACTGTAGTGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104658714 Original CRISPR TGGGTGGAGGGTCCCTCCTT GGG (reversed) Intronic
900310874 1:2032596-2032618 TGGGTGGAAGGCCCGCCCTTGGG - Intergenic
900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG + Intronic
900739511 1:4322200-4322222 TGGGTGGGGGGTCCTTCCATGGG - Intergenic
900942393 1:5808393-5808415 TGGGGTGAGGGTCCCTCCTTGGG + Intergenic
901214525 1:7548445-7548467 CTGGTGGAGGGTGCCCCCTTAGG + Intronic
901214548 1:7548511-7548533 CTGGTGGAGGGTGCCCCCTTAGG + Intronic
901214595 1:7548642-7548664 CTGGTGGAGGGTGCCCCCTTAGG + Intronic
901214676 1:7548869-7548891 CTGGTGGAGGGTGCCCCCTTAGG + Intronic
901214719 1:7549000-7549022 CTGGTGGAGGGTGCCCCCTTAGG + Intronic
901439404 1:9268474-9268496 TGGCAGAAGGGCCCCTCCTTTGG + Exonic
902255421 1:15186058-15186080 AGGGGGCAGGGTCCCTCCCTTGG - Intronic
902292981 1:15447135-15447157 GGGGTGGGGGGTCCCTGCTAGGG - Intronic
903131118 1:21280122-21280144 TGGCTGGTGTGTCCCTCCTCGGG - Intronic
904753288 1:32754210-32754232 AGGGAGGAGGGTCCCTACTGCGG + Intronic
904804108 1:33118977-33118999 GTGGTGAAGGGTCCCTCTTTTGG + Intronic
905325123 1:37146416-37146438 TGGGTGGAGGAGTCCTCCTCAGG - Intergenic
915632003 1:157159889-157159911 TGGGAACAGGGTCCCTCCTCTGG - Intergenic
917578204 1:176346169-176346191 TGGGTGTAGATTTCCTCCTTTGG - Intergenic
918367753 1:183826819-183826841 TGTTTAAAGGGTCCCTCCTTGGG + Intronic
918992943 1:191721841-191721863 TAGGTGTAGGGTCTCTCATTAGG + Intergenic
919046348 1:192457486-192457508 TGGGGGAAGGCTCTCTCCTTAGG + Intergenic
920293589 1:204941747-204941769 TAGCCAGAGGGTCCCTCCTTGGG + Intronic
921161397 1:212474761-212474783 TGGGTGCAGGATCCCACATTAGG - Intergenic
922776343 1:228215831-228215853 TAGGTGGAGGGCCCCAGCTTGGG + Intronic
1062787239 10:275302-275324 TGTGTGGTGGTTCCCCCCTTAGG + Exonic
1062799470 10:368657-368679 TGGGGCGAGGGTCCCTGCTGAGG + Intronic
1063474695 10:6318171-6318193 TGGGTGCAGGGCTCCTCCTGTGG + Intergenic
1070621067 10:78011546-78011568 TGGTTGAAGGGTCCCTGCTTTGG - Intronic
1074912538 10:117924623-117924645 TTGGTGGAGGGTTGCTCCTGGGG - Intergenic
1075619253 10:123913866-123913888 TGGGAGGGGGGTGCCTCCTGAGG - Intronic
1076374887 10:129976635-129976657 TGGATGGGCGGTCCCACCTTGGG - Intergenic
1077171103 11:1166175-1166197 TGGGTGCAGGGTCTCACCATAGG - Intronic
1077171108 11:1166210-1166232 TGGGTGCAGGGTCTCATCTTGGG - Intronic
1077171116 11:1166245-1166267 TGGGTGCAGGGTCTCACCATAGG - Intronic
1077171174 11:1166628-1166650 TGGGTGCAGGGTCTCATCTTGGG - Intronic
1077171192 11:1166733-1166755 TGGGTGCAGGGTCTCATCTTGGG - Intronic
1077171199 11:1166768-1166790 TGGGTGCAGGGTCTCATCTTGGG - Intronic
1077171228 11:1166942-1166964 TGGGTGCAGGGTCTCATCTTGGG - Intronic
1077171246 11:1167047-1167069 TGGGTGCAGGGTCTCATCTTGGG - Intronic
1077171253 11:1167082-1167104 TGGGTGCAGGGTCTCATCTTGGG - Intronic
1077171267 11:1167151-1167173 TGGGTGCAGGGTCTCACCATAGG - Intronic
1077171277 11:1167221-1167243 TGGGTGCAGGGTCTCATCTTGGG - Intronic
1079338797 11:19595186-19595208 TTGGTGGAGGGTCACTCCTGGGG + Intronic
1081336584 11:41874275-41874297 TAAATGGAGGGTCCCTCCTTTGG - Intergenic
1082770241 11:57202324-57202346 GGGATGGAGCGTCACTCCTTGGG - Intergenic
1083238767 11:61370289-61370311 TGTGTGGACTGTCCCTCCTCAGG - Intergenic
1083282935 11:61638557-61638579 TGGCTGGAGGGTCTCTCCTAAGG - Intergenic
1084857944 11:72000818-72000840 TGGGTGGAGGGGCTGGCCTTGGG - Intronic
1085834528 11:79938277-79938299 TGGCTGGAGGGTGCTTCTTTGGG - Intergenic
1089681297 11:120120423-120120445 TGGGTGGAGGGTCCAGGCATGGG - Intronic
1090835161 11:130448816-130448838 TGGGAGGAGTCTCCCTCCCTTGG + Intergenic
1096809749 12:54161753-54161775 TGGGATCAGGGTCCCTCCTGAGG - Intergenic
1097449297 12:59716191-59716213 TGGGTGGTGGTTTCCTGCTTTGG + Intronic
1098460090 12:70722904-70722926 TGGGTGGAAGGCCCATCTTTTGG - Intronic
1100939721 12:99712850-99712872 TGGCTGGAGGGTCCATCCTCTGG + Intronic
1103701415 12:122850440-122850462 TGGGTGGGGGGGCCCTGGTTCGG + Intronic
1103701474 12:122850564-122850586 TGGGTGGGGGGGCCCTGGTTCGG + Intronic
1104047253 12:125172131-125172153 TGGGTGCATGGTCCCACCTTAGG + Intergenic
1104658714 12:130593182-130593204 TGGGTGGAGGGTCCCTCCTTGGG - Intronic
1107851962 13:44579379-44579401 TGGGTGGAATGTCCTTTCTTTGG + Intergenic
1108581180 13:51829748-51829770 TGGGTGGCAGGTGCCTCCTTGGG - Intergenic
1112043145 13:95568557-95568579 TGGGTGGGGTGTCCCTGTTTTGG + Intronic
1113138185 13:107117101-107117123 TGGGTGGAGGGCACCAGCTTGGG + Intergenic
1113454189 13:110436333-110436355 TGGGTGGAAGGTGACTCCTGTGG - Exonic
1113880067 13:113620000-113620022 AGGGAAGAGGGTCCCTCCTCTGG - Intronic
1114306569 14:21429067-21429089 TGGGTGGAGGGTGGCTGCTGGGG + Exonic
1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG + Exonic
1116679388 14:47946424-47946446 TAAGTAGAGGGTACCTCCTTAGG - Intergenic
1120710757 14:87790653-87790675 TGGGTGGAGGGTGTGTCCTAAGG + Intergenic
1121386961 14:93536752-93536774 TGGGTGGGGGGTGCCTTCTAAGG - Intronic
1121437846 14:93930690-93930712 TGGTTGCAGGATCCCTTCTTTGG + Intergenic
1124918712 15:34002394-34002416 TGGCTGCAGGGTCCCTACTGAGG - Intronic
1126914402 15:53449562-53449584 TGGGAGCAGAGTACCTCCTTTGG - Intergenic
1128326127 15:66725372-66725394 TGAGGGTAGGGTCCCTCCCTGGG - Intronic
1128389859 15:67175569-67175591 TGGGGGGAGGGTCCTCCCTTTGG - Intronic
1129601021 15:76998229-76998251 AGAGTGGAGGGACCCTACTTTGG + Intronic
1132645663 16:998222-998244 TGGGTGGAGGGACCCTGGCTGGG + Intergenic
1133023036 16:2975228-2975250 AGGGTGGAGCTTCCCTCCTGGGG + Intronic
1133319194 16:4902577-4902599 TGGGTGGGGGGCCCCTCCTGGGG - Intronic
1134203598 16:12219185-12219207 TGGGTGCAGCGTCCATCATTTGG + Intronic
1134204866 16:12228913-12228935 TCGGTGGAGGCTCCCTCGTGTGG - Intronic
1135920350 16:26643863-26643885 AGGGTGGAGGATCCCTCCTGTGG + Intergenic
1136514174 16:30757706-30757728 TGGGGGGATGGTCCCTAGTTGGG + Exonic
1136683001 16:31978777-31978799 TGGGTGGTGAGACCCTCCCTGGG + Intergenic
1136783641 16:32922333-32922355 TGGGTGGTGAGACCCTCCCTGGG + Intergenic
1136886147 16:33931473-33931495 TGGGTGGTGGGACCCTCCCTGGG - Intergenic
1136928595 16:34397842-34397864 TGGGTGCAGGGTTTCTTCTTGGG - Intergenic
1136975979 16:35013962-35013984 TGGGTGCAGGGTTTCTTCTTGGG + Intergenic
1137256322 16:46778219-46778241 TGGGCGGAGGGTCCTTCCTGGGG - Intronic
1141555718 16:84835475-84835497 GGGTCGGAGGGTCCCTGCTTGGG - Intronic
1142240367 16:88941885-88941907 TGGGGGGGAGGTCGCTCCTTCGG + Intronic
1203086292 16_KI270728v1_random:1186334-1186356 TGGGTGGTGGGACCCTCCCTGGG + Intergenic
1143401553 17:6648277-6648299 TGAGTTGAGGTTCCCTCCTTTGG - Intronic
1143831308 17:9653852-9653874 TAGGGGCTGGGTCCCTCCTTAGG + Intronic
1146809240 17:35890285-35890307 TGGGGGGAATGTCCCTGCTTTGG - Intergenic
1146845403 17:36178982-36179004 TGGGTGGAGGGCCTGGCCTTTGG + Intronic
1146873618 17:36390825-36390847 TGGGTGGAGGGCCTGGCCTTTGG + Intronic
1146880977 17:36441913-36441935 TGGGTGGAGGGCCTGGCCTTTGG + Intergenic
1147065770 17:37922048-37922070 TGGGTGGAGGGCCTGGCCTTTGG - Intergenic
1147143908 17:38474486-38474508 TGGGTGGTGGGACCCTCCCTGGG + Intronic
1148505150 17:48121404-48121426 AGAGTGGAGGTTCCCTCTTTGGG - Exonic
1149567503 17:57650483-57650505 TTGGTTGGGGGTCCCTCCCTTGG + Intronic
1151185834 17:72363349-72363371 TGGCTGGAGAGAACCTCCTTGGG - Intergenic
1151414650 17:73953149-73953171 TGCGTGGAGGGGACTTCCTTCGG - Intergenic
1151711317 17:75808611-75808633 TGGGTCGAGGATCCCTTTTTTGG + Intronic
1152566071 17:81100986-81101008 TCTGTTGAGGGCCCCTCCTTGGG + Intronic
1153833236 18:8941380-8941402 TGGGTGGACCGTCCCTGCTGTGG - Intergenic
1154373453 18:13787810-13787832 TGGGTGCAGGGTTCCTTTTTGGG - Intergenic
1158402145 18:57130885-57130907 TGGGAGGAGGGGCCCATCTTGGG + Intergenic
1160330108 18:77983484-77983506 TGGGTGGAAGGACCCTCTGTGGG + Intergenic
1161298845 19:3533091-3533113 TGGGTGGAGGGGTCCACCTGTGG + Intronic
1161467999 19:4442806-4442828 CAGGTGGAGGGTCCCGCCCTGGG + Intronic
1162958244 19:14111822-14111844 AGGGTGGAGGGTGCCCTCTTGGG + Intronic
1163170601 19:15528385-15528407 TTGGTTGAGGGTCACTCCTGGGG - Intronic
1163763386 19:19149069-19149091 TGAGTGGAGGGTCCCTTCTAGGG + Intronic
1165022458 19:32935842-32935864 TGGGTGGTGGGGGCCTTCTTGGG - Intronic
1165263665 19:34642276-34642298 AGGGTGGAGGGGCTCTCCTGTGG - Intronic
1166134398 19:40766839-40766861 TGGTTGGGGGGACCATCCTTAGG + Intergenic
1167303928 19:48696233-48696255 GGAGAGGAGGGTCCCTCCCTCGG + Intronic
1168523049 19:57067928-57067950 GGGGTGGAGAGTTCCTCCTTGGG - Intergenic
926348752 2:11975610-11975632 TGGGTAGAGGGGCTCTCCTGTGG + Intergenic
927155784 2:20220408-20220430 AGGGTGGCGGGCCCCTCCATTGG - Intronic
927476701 2:23419368-23419390 AGGCTGGAGGGTCCCACCTGGGG + Intronic
928115042 2:28540181-28540203 AGGGTGGGTGGTCCCTTCTTGGG - Intronic
937115773 2:119404157-119404179 TGGGTGGGGGCTCCCTCCATGGG - Intergenic
940038250 2:149331271-149331293 TGGGTGGATGGTCCCTTCCCTGG - Intronic
945064293 2:205935636-205935658 TGGGTGCAGGTGCCCTCCTAGGG - Intergenic
948615875 2:239198452-239198474 TGAGTAGGGGGTCCCTCCCTTGG - Intronic
948749743 2:240124808-240124830 TGGGTGGAGTGTCCCTACCACGG - Intergenic
948917066 2:241039759-241039781 TTGGGGGATGGTCCCTCCCTAGG - Intronic
948990531 2:241551721-241551743 TGGGCGGAGGGACCCCCCTGAGG - Intergenic
1168959892 20:1861843-1861865 TGGGCGGAGAGTCCCTGCTGAGG + Intergenic
1170165451 20:13357301-13357323 TGGGTGGGGGGTTGTTCCTTTGG - Intergenic
1170849813 20:19994617-19994639 GGGGTGGAGGGGGGCTCCTTTGG - Intronic
1170949904 20:20926960-20926982 TGGGTGGAGGGCTGCTCATTGGG + Intergenic
1173007913 20:39155320-39155342 TGGCTGGAAGGTCAATCCTTAGG + Intergenic
1173275329 20:41575528-41575550 TGAGTGGATGGGCCCTCCTTTGG - Intronic
1174221304 20:48957729-48957751 TGGGTGGAGTCTTCCTGCTTTGG + Intronic
1176240128 20:64072074-64072096 TGGGTGGAGAGCCCAGCCTTGGG + Intronic
1180714848 22:17864853-17864875 TGGGTGGCGCGTCACTCCCTCGG - Intronic
1181082626 22:20424928-20424950 TGGCTGGAGGCTCCCTCCCTTGG - Exonic
1183061073 22:35336732-35336754 AGGGTGGAGGGTCACTCCTTAGG - Intronic
1183663241 22:39233676-39233698 TGCTTGGAGGGTCCCTGCTCAGG - Intronic
1184620151 22:45671367-45671389 TGGGTGGAGGGGACCCTCTTGGG - Intergenic
950485942 3:13274068-13274090 TGGAGGGAGGGTCCCGGCTTTGG - Intergenic
954367459 3:50154262-50154284 TGGGCAGAGGGTCCCTTCCTGGG + Intergenic
954452090 3:50577181-50577203 TGGGTGGAGGGGCTCACCTGGGG - Exonic
955391624 3:58526383-58526405 TGGGTGGAGGGTTCCGTCTGAGG - Intronic
956553005 3:70482895-70482917 TTGGTGGAGGGTACCACTTTTGG + Intergenic
966311312 3:178596988-178597010 TGGGTGGAGTTTCCATCCTGAGG + Intronic
966491412 3:180531853-180531875 TGGGGGGGGGGTCCTTCCTGGGG - Intergenic
970809459 4:20074774-20074796 TGGCTGGAGTGTCCCTACTCTGG + Intergenic
973107208 4:46355076-46355098 TGGGTGGAGGGTGCCTCGGAAGG - Intronic
973575332 4:52282183-52282205 TGGGAGGAGGATCCCTCAATAGG + Intergenic
973850932 4:54960904-54960926 AGGGTGAGGGGTCCCTGCTTGGG - Intergenic
987491438 5:18584555-18584577 TTGGATGAGGGTCCATCCTTAGG + Intergenic
992684488 5:79186209-79186231 TGGTTGGATGGTGCCTGCTTGGG + Intronic
997271324 5:132540725-132540747 AGAATGGAGGGTCTCTCCTTTGG + Intergenic
1001093147 5:168756361-168756383 TGGGGGCCTGGTCCCTCCTTGGG - Intronic
1001848777 5:174944561-174944583 TGGGTGGAGGGACCCTGACTTGG + Intergenic
1002346580 5:178552072-178552094 TTGGAGGAGGGTCCTTCCTGGGG - Intronic
1003491957 6:6630598-6630620 TGGCTGCAGCTTCCCTCCTTTGG - Intronic
1004496508 6:16168477-16168499 TGGGTGGAGGGTGATGCCTTAGG + Intergenic
1006091631 6:31632052-31632074 TGGGTGAGTGTTCCCTCCTTGGG - Exonic
1006384627 6:33723427-33723449 TGGGTGGAGGGTCACCTCTGTGG - Intronic
1006824487 6:36924308-36924330 TGGGGAGAGGGTGCCTCCCTGGG + Intronic
1007138469 6:39546499-39546521 TGGTTGGATGGTCCCTCCAAAGG - Intronic
1007416227 6:41692806-41692828 GGGCTGGAGGGTCCCATCTTGGG + Intronic
1007428976 6:41765463-41765485 TGGGAGGAGGGTCTCTGCTGGGG - Intergenic
1017311739 6:152983526-152983548 TGGGGGGAGGGTCCGTCTTCCGG - Intronic
1017518677 6:155181985-155182007 TGGGTGCATGGTCTCACCTTTGG + Intronic
1018528662 6:164740705-164740727 TTGCTGGGAGGTCCCTCCTTTGG - Intergenic
1018942547 6:168319266-168319288 TGGATGGAGGGGACGTCCTTTGG - Intronic
1019287040 7:228863-228885 TGGCTGGAGGGTCCCACGCTGGG + Exonic
1019926380 7:4195874-4195896 TGGGTGGAGGCACCCTCCCAAGG - Intronic
1020136938 7:5592874-5592896 TGGGTGGCGGGTCCCTGCGGCGG - Exonic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1026165188 7:67903304-67903326 TAGGTGGATGGTCACTCCTGTGG - Intergenic
1029255295 7:99265528-99265550 AGGATGGAGAGTCCCTCCTCTGG - Intergenic
1031141636 7:117949212-117949234 TGGTGGAAGGGTTCCTCCTTTGG - Intergenic
1032500206 7:132394301-132394323 AGGGAGGAGGGACCCTCCTAGGG - Intronic
1033319091 7:140323391-140323413 TGGGTGGAGGGTTCCTTTTTGGG + Intronic
1034414949 7:150959443-150959465 TGGGTGGGGGGTCCCCCCTTTGG - Intronic
1035048429 7:155984127-155984149 TGGGAGGTGAGTCCCTCCTTGGG - Intergenic
1040342559 8:46448323-46448345 TTTGTGGAGGGCCCCTCCTCGGG - Intergenic
1045312460 8:101014843-101014865 CTGGTTGAGGGTCACTCCTTTGG + Intergenic
1046525740 8:115380287-115380309 AGGGTGGAGAGGCCATCCTTCGG - Intergenic
1047176000 8:122540978-122541000 TGGTTGGAGAGTCCCTACTGTGG - Intergenic
1048470259 8:134698653-134698675 TGGGAGGAGAGTTCCTCTTTGGG - Intronic
1049387770 8:142353037-142353059 TGGATGGAGGTTCCTTCCATGGG - Intronic
1053162607 9:35824047-35824069 GAGGTGGAGGGTCCCTGCATGGG + Intronic
1059053257 9:110952281-110952303 TGGGTTGAGGGGCTCTCCTGTGG - Intronic
1059763641 9:117362752-117362774 TGACTGGACGCTCCCTCCTTTGG + Intronic
1059989817 9:119854373-119854395 TGGGCGGAGGTCCTCTCCTTGGG - Intergenic
1060003599 9:119980599-119980621 AGGGTGGAGGGTTCCTATTTCGG - Intergenic
1061053187 9:128207914-128207936 TGGGCAGAGGGTCGCTCCTCAGG - Intronic
1061108953 9:128553033-128553055 TGGGTGGGGGCTCCCTCGTCGGG + Intronic
1185736786 X:2501306-2501328 TGTGTGGGGGGTCCCTGCTGGGG - Intronic
1185736816 X:2501383-2501405 GGTGTGGAGGGTCCCTGCTGGGG - Intronic
1190233065 X:48597384-48597406 GGGGTGGAGCCTCCGTCCTTGGG + Intronic
1197643596 X:128993320-128993342 TGGGTCGAGGGGCTCTCCTGTGG + Intergenic