ID: 1104662444

View in Genome Browser
Species Human (GRCh38)
Location 12:130620891-130620913
Sequence CTCACCACTGCTGGGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 488}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104662444_1104662453 6 Left 1104662444 12:130620891-130620913 CCACCCCACCCAGCAGTGGTGAG 0: 1
1: 0
2: 2
3: 63
4: 488
Right 1104662453 12:130620920-130620942 GAACCTGCAGACCTGGACTCCGG 0: 1
1: 0
2: 0
3: 15
4: 226
1104662444_1104662454 7 Left 1104662444 12:130620891-130620913 CCACCCCACCCAGCAGTGGTGAG 0: 1
1: 0
2: 2
3: 63
4: 488
Right 1104662454 12:130620921-130620943 AACCTGCAGACCTGGACTCCGGG 0: 1
1: 0
2: 4
3: 40
4: 256
1104662444_1104662456 12 Left 1104662444 12:130620891-130620913 CCACCCCACCCAGCAGTGGTGAG 0: 1
1: 0
2: 2
3: 63
4: 488
Right 1104662456 12:130620926-130620948 GCAGACCTGGACTCCGGGCCTGG 0: 1
1: 0
2: 1
3: 35
4: 243
1104662444_1104662458 14 Left 1104662444 12:130620891-130620913 CCACCCCACCCAGCAGTGGTGAG 0: 1
1: 0
2: 2
3: 63
4: 488
Right 1104662458 12:130620928-130620950 AGACCTGGACTCCGGGCCTGGGG 0: 1
1: 0
2: 2
3: 27
4: 200
1104662444_1104662457 13 Left 1104662444 12:130620891-130620913 CCACCCCACCCAGCAGTGGTGAG 0: 1
1: 0
2: 2
3: 63
4: 488
Right 1104662457 12:130620927-130620949 CAGACCTGGACTCCGGGCCTGGG 0: 1
1: 0
2: 2
3: 22
4: 211
1104662444_1104662451 -1 Left 1104662444 12:130620891-130620913 CCACCCCACCCAGCAGTGGTGAG 0: 1
1: 0
2: 2
3: 63
4: 488
Right 1104662451 12:130620913-130620935 GCACCTGGAACCTGCAGACCTGG 0: 1
1: 0
2: 2
3: 35
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104662444 Original CRISPR CTCACCACTGCTGGGTGGGG TGG (reversed) Intronic
900290446 1:1921511-1921533 CTGGCCCCTGCTGGGTGGAGGGG + Intergenic
900421142 1:2556443-2556465 CTCAGGCCTGCTGGGTGGAGCGG - Exonic
900458585 1:2789498-2789520 CTCACCCCTCCTGCGTGGTGGGG + Exonic
900573272 1:3370525-3370547 CTCTCCTCTGGTGGGTGGTGGGG - Intronic
901300007 1:8192926-8192948 TTAACCTCTGCTGGGTGTGGTGG + Intergenic
901854751 1:12037568-12037590 TTCCCTGCTGCTGGGTGGGGGGG + Intergenic
901934259 1:12617015-12617037 CTCAGCACTCGTGGGTGGCGCGG + Intronic
902264225 1:15249811-15249833 TCCATCACTGCTGGGTGGGGAGG - Intronic
902752634 1:18528042-18528064 CTCACCACTGGGCGGGGGGGGGG + Intergenic
903214692 1:21837236-21837258 CTCCTCGCTTCTGGGTGGGGAGG + Intronic
903374704 1:22858635-22858657 CTCCCAACTTCTGGGTGGGAAGG - Intronic
903562555 1:24238723-24238745 CTCCCCTCAGCTGGGTGTGGTGG - Intergenic
903812372 1:26041867-26041889 CCCAGCAGTGCTGGGTGGGAGGG - Intronic
903829440 1:26165716-26165738 CTAACCACTGAGGGCTGGGGAGG - Intergenic
903996555 1:27308393-27308415 CTCAGCCCTGCTGGGCTGGGTGG - Exonic
904211034 1:28887193-28887215 CTCACCTGGGCTGGGTGCGGCGG - Exonic
904389355 1:30171596-30171618 CAGACCATTCCTGGGTGGGGTGG - Intergenic
904408971 1:30313425-30313447 CTCCCCAGTGCGGTGTGGGGAGG - Intergenic
904745449 1:32707918-32707940 CCCCCCACAGCTGGGTGTGGTGG + Intergenic
904945984 1:34199001-34199023 TGCACCAATGGTGGGTGGGGTGG - Intronic
905292979 1:36935565-36935587 CTCATCTTTGCTGGGTGCGGGGG - Intronic
905441015 1:37996631-37996653 CTCATCCTTGCAGGGTGGGGTGG - Intergenic
905873089 1:41416129-41416151 CCCACCAGGGCTGAGTGGGGCGG + Intergenic
906078296 1:43068040-43068062 CTCACCGAGGCTGGATGGGGAGG - Intergenic
906535792 1:46550371-46550393 CTCCCCAGGTCTGGGTGGGGAGG - Intronic
906537609 1:46560337-46560359 CTACCCACTGCTGGCTTGGGTGG - Intronic
906556127 1:46715958-46715980 GTGACCACTGCTGGGTGTGGTGG + Intronic
906988935 1:50716832-50716854 GTCGCCACTGCTGGCTGGGGTGG - Intronic
907150779 1:52285387-52285409 CTCACCTCTGCTGTGTGGCCTGG - Intronic
907418873 1:54333101-54333123 CACACCACTGCTTGGGGGTGGGG + Intronic
909747237 1:79112927-79112949 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
911379648 1:97096781-97096803 GTTGCCACTGCTGGTTGGGGTGG - Intronic
911496386 1:98637094-98637116 CACACCACTGCTGCCAGGGGTGG - Intergenic
912675975 1:111680957-111680979 CTGAAAACTGCTGGGTGTGGTGG + Intronic
913279026 1:117167560-117167582 CTCACCAATACTGGGTGTTGTGG - Intronic
913968135 1:143393614-143393636 CTCTCCACAGCTTGGTGGGTGGG + Intergenic
914062516 1:144219204-144219226 CTCTCCACAGCTTGGTGGGTGGG + Intergenic
914116634 1:144747150-144747172 CTCTCCACAGCTTGGTGGGTGGG - Intergenic
914779984 1:150776667-150776689 CTCACTCCAGCTGGGTGTGGTGG + Intergenic
915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG + Intergenic
917042830 1:170825214-170825236 CTAATCACAGCTGGGTGTGGTGG + Intergenic
917856868 1:179108295-179108317 CTCATCACTGGTGGTGGGGGTGG + Exonic
919205977 1:194422362-194422384 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
919558473 1:199091472-199091494 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
920100123 1:203512129-203512151 CCCACCCCTGGGGGGTGGGGTGG - Intergenic
920204857 1:204283981-204284003 CTCACCACTGCCTGGAGGAGGGG + Intronic
920387500 1:205579255-205579277 CTCACCATTCCTGTGTGGGGAGG + Intronic
920459708 1:206129953-206129975 CTCACCATTGTGGGGTGGGGGGG - Intergenic
920774840 1:208925781-208925803 CTGACCACTGGCGGGGGGGGCGG - Intergenic
921384826 1:214558080-214558102 CTCACCCCTTCAGGCTGGGGTGG - Intergenic
921975968 1:221203644-221203666 CTGCCCCCTGCTGGCTGGGGAGG + Intergenic
922054055 1:222023392-222023414 TTCACCACTGCTGCCTGGGTTGG + Intergenic
922482825 1:225950944-225950966 CTCCCCACTTCTGGGTATGGAGG - Intergenic
922696330 1:227732872-227732894 ACCACCACTGCCAGGTGGGGTGG - Exonic
924688503 1:246322076-246322098 CTAACAGGTGCTGGGTGGGGTGG + Intronic
1062832817 10:617327-617349 CACATCACAGCTGAGTGGGGTGG - Intronic
1062860039 10:803723-803745 CTCAGCCCTGCTGGGAGGGAGGG + Intergenic
1062990391 10:1809294-1809316 CTCAACACCGCTGGGTTTGGGGG - Intergenic
1063440057 10:6065566-6065588 CCCACAACCGCTGGGTGTGGTGG - Intergenic
1063859406 10:10291369-10291391 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1064775477 10:18772366-18772388 CTCAACACTGCTGGGACGGAGGG - Intergenic
1065083084 10:22146300-22146322 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1066318328 10:34272612-34272634 CTCACCTCAGCTGGGTGGCTGGG - Intronic
1066433334 10:35373364-35373386 CCCAACACTGCTGGGTGGCAAGG - Intronic
1066984468 10:42453109-42453131 CTCTACACTGCTGGGAGAGGCGG - Intergenic
1067226921 10:44382612-44382634 ATCACCACTGCTTGGTTGGGGGG - Intronic
1067534209 10:47096110-47096132 CTTACCGCTGCTGGCTGGTGTGG - Intergenic
1067536357 10:47113221-47113243 CTAACCATGGCTGGGTGCGGTGG + Intergenic
1069650205 10:70041787-70041809 CTGACCACTGCTGAGCCGGGAGG + Intergenic
1069690442 10:70348285-70348307 CTCACCCCTGCTGGGAGGAGAGG + Intronic
1069823126 10:71239705-71239727 CACACCCCTGCTGGATGGGTGGG + Intronic
1070085558 10:73233629-73233651 TTAACCCCTGCTGGGTGCGGTGG - Intronic
1070647617 10:78212575-78212597 ATCTCCACTGCTGGGGGGCGGGG - Intergenic
1070660211 10:78300250-78300272 CTTGCCACTGCTGGCTGGGGTGG + Intergenic
1071037890 10:81269173-81269195 ATTGCCACTGCTGGCTGGGGAGG - Intergenic
1072416672 10:95252300-95252322 CTCATTACTGCTGGATGGGGTGG - Intronic
1073769350 10:106718634-106718656 GTTGCCACTGCTGGCTGGGGTGG + Intronic
1074352559 10:112752217-112752239 CTCACCACAGCTTAGTTGGGAGG - Intronic
1074403016 10:113157412-113157434 TTCACAACTGCTGAGTGGGCTGG - Intronic
1074974960 10:118572659-118572681 CTTATTACTGCTGGGTGGGGTGG - Intergenic
1075369011 10:121919097-121919119 GTTGCCACTGCTGGGTAGGGTGG - Intronic
1076998873 11:312342-312364 CACATCACTGCGGAGTGGGGTGG - Intronic
1077200890 11:1306934-1306956 CTCACCAGGGCTGGGTGTTGGGG - Intronic
1077231541 11:1460070-1460092 CTCACGGCTGCAAGGTGGGGAGG + Intronic
1077254227 11:1573267-1573289 CTCCCCGCTGCCGGGTGGAGAGG + Intergenic
1077516709 11:3006660-3006682 CTTCCCACTGCTGCGTGTGGTGG - Intronic
1078665664 11:13323082-13323104 CTCACAACGGCTGGGTGCAGTGG - Intronic
1079209527 11:18448970-18448992 CTGAGGACTGCTGGGTGGGCTGG - Intronic
1080025106 11:27605014-27605036 TTCATCGCTGCTGGGTAGGGTGG - Intergenic
1081111721 11:39143644-39143666 GCCACCACAGCTGGGTGTGGTGG + Intergenic
1081286329 11:41274665-41274687 GTTGCCACTGCTGGCTGGGGTGG - Intronic
1081640358 11:44749107-44749129 CTCAAGACTGCAGGGTGTGGTGG - Intronic
1082767708 11:57182059-57182081 AGCAGCATTGCTGGGTGGGGTGG - Exonic
1083628980 11:64086111-64086133 CTCAGCACTGGTGGGGTGGGTGG + Intronic
1083744420 11:64727245-64727267 CTCCCCACTGAGGGCTGGGGGGG - Intronic
1084019988 11:66411625-66411647 CTGAGCACTGGTGGGAGGGGAGG - Intergenic
1084484984 11:69443072-69443094 CTGGCCAGTGCTGGGGGGGGCGG - Intergenic
1084653019 11:70500073-70500095 CACACCAGCCCTGGGTGGGGAGG + Intronic
1085971315 11:81594677-81594699 CTCACAATTGCTAGGTGGGTTGG + Intergenic
1086054324 11:82629182-82629204 GTTGCCACTGCTGGCTGGGGCGG - Intergenic
1087539317 11:99495080-99495102 ATCACCCCTGCTGGGCGTGGTGG + Intronic
1087880812 11:103414331-103414353 TTCACCACTGCTGGGCGCAGTGG + Intronic
1088795181 11:113261491-113261513 CTCCCCAGTGCTTGCTGGGGTGG + Intronic
1089961768 11:122623057-122623079 CTCACCACTGATGGGAGTGTTGG - Intergenic
1090407618 11:126486567-126486589 CTCAACACAGCTGGGTTGGTGGG + Intronic
1090802386 11:130181020-130181042 CTCATCCCTGCTGGGTGGGATGG + Intronic
1090802426 11:130181175-130181197 CTCGTCCCTGCTGGGTGGGATGG + Intronic
1091308678 11:134557770-134557792 CACACCCCTGCTGGCTGGGGTGG - Intergenic
1093678815 12:21976286-21976308 CTCCCCACTTCTGGGTGGGTGGG - Intergenic
1094448111 12:30554825-30554847 CTTAACATTGCTGGGTGTGGTGG - Intergenic
1094598004 12:31883059-31883081 GTTGCCACTGCTGGCTGGGGGGG - Intergenic
1094776095 12:33729795-33729817 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1094851854 12:34385818-34385840 CTCACGAATGCGCGGTGGGGAGG + Intergenic
1096189660 12:49607985-49608007 CTAACCTCAGCTGGGTGCGGTGG - Intronic
1096538442 12:52289811-52289833 CTCCCCTGCGCTGGGTGGGGAGG - Intronic
1096540337 12:52303553-52303575 CTCCCCTGCGCTGGGTGGGGAGG + Intronic
1096867706 12:54575149-54575171 CCAACCACTGCTTGGTTGGGTGG - Exonic
1100854855 12:98749760-98749782 CTGATCTCTGCTGTGTGGGGAGG + Intronic
1100984160 12:100188956-100188978 GTTGCCGCTGCTGGGTGGGGTGG + Intergenic
1101477277 12:105062787-105062809 CACTCCATTGCTGGCTGGGGAGG - Intronic
1102150787 12:110688294-110688316 TTTACCAGTGCTGGGTGTGGGGG - Exonic
1102770320 12:115470587-115470609 CTTATCTCTGCTGGCTGGGGTGG - Intergenic
1103596028 12:122024633-122024655 TTCACCACTGGTGGGGGGGTGGG + Intronic
1104662444 12:130620891-130620913 CTCACCACTGCTGGGTGGGGTGG - Intronic
1105415948 13:20211428-20211450 CTCATTACTGCTAGGTGGGATGG - Intergenic
1105599807 13:21876612-21876634 GTTACCACTGCTGGCTGGGGTGG + Intergenic
1106119456 13:26847433-26847455 GTCACCTCTGCTGGAGGGGGAGG + Intergenic
1106800699 13:33253560-33253582 TGCAGCACTGCTGGGTGAGGGGG + Intronic
1107556728 13:41521865-41521887 CTCACCTCTGCTGAGGGTGGTGG + Intergenic
1107741900 13:43459704-43459726 CTATCCTCTGCTGGGTGCGGTGG + Intronic
1108735463 13:53279119-53279141 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1108848299 13:54700650-54700672 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1109501130 13:63236935-63236957 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1111337377 13:86840784-86840806 CTCACCACAGCTTGGGGCGGGGG + Intergenic
1113098012 13:106687108-106687130 GTCAACAATGCTGGGTGCGGGGG - Intergenic
1114679693 14:24474065-24474087 GTTGCCACTGCTGGCTGGGGCGG - Intergenic
1115347452 14:32358510-32358532 CTGACCTGTGTTGGGTGGGGGGG + Intronic
1117166662 14:53041216-53041238 CTGACAACTGTTGGGTGGGGAGG + Intronic
1117650494 14:57899946-57899968 GTTACCACTGCTGGCTAGGGTGG + Intronic
1118333596 14:64833261-64833283 CCCACCTCTGCTGGGCGCGGTGG + Intronic
1118371877 14:65144421-65144443 CTCTCCACTGTGGGTTGGGGTGG - Intergenic
1118987244 14:70767094-70767116 CTCATCCCGGCTGGGTGCGGTGG + Intronic
1119426227 14:74536089-74536111 CTCACTGCTGCCGGGTGGGCTGG - Intronic
1119427301 14:74544021-74544043 CCCACCCCTGCTGGGTTGGGAGG + Intronic
1121791800 14:96704592-96704614 CTCACCACTGCCCTGTGGGGAGG - Intergenic
1121796276 14:96738140-96738162 GTCTCCACTGCAGGGTGGGGGGG + Intergenic
1122361488 14:101169457-101169479 CTCACCGGTTCTGGGTAGGGGGG + Intergenic
1122711921 14:103664961-103664983 CACATCACTGCTGGGTGCTGGGG + Intronic
1122838597 14:104443482-104443504 CAGAGCCCTGCTGGGTGGGGAGG - Intergenic
1122960293 14:105091069-105091091 GGCACCTGTGCTGGGTGGGGTGG - Intergenic
1123025892 14:105423874-105423896 CTCAGCACTCCAGGGTAGGGCGG - Intronic
1123468077 15:20530762-20530784 CTCACCAGTACACGGTGGGGAGG + Intergenic
1124491728 15:30162101-30162123 CTCTCCACTGCAGGGTGGGCAGG + Intergenic
1124751808 15:32376208-32376230 CTCTCCACTGCAGGGTGGGCAGG - Intergenic
1124844978 15:33281334-33281356 GTGACCAGTGCTGAGTGGGGAGG + Intergenic
1126188166 15:45850915-45850937 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1127634904 15:60859756-60859778 CTCACCAGAACAGGGTGGGGTGG + Intronic
1128054994 15:64692718-64692740 CTCACTCCAGCTGGGTGTGGTGG - Intronic
1128572173 15:68741717-68741739 CTCACTATTGCTGGGATGGGTGG + Intergenic
1128728331 15:70004347-70004369 CTCACTACTACTGGGTGTGTAGG - Intergenic
1129208787 15:74053454-74053476 ATTGCCACTGCTGGCTGGGGCGG - Intergenic
1129477611 15:75796594-75796616 GTGACCACTGCTGGGGGAGGGGG + Intergenic
1129541159 15:76347658-76347680 CTCGACACTGCGGGGCGGGGAGG - Intergenic
1130829594 15:87585680-87585702 CTCACCAATCCTAGATGGGGAGG - Intergenic
1130883380 15:88073783-88073805 CTCTTCCCTGCGGGGTGGGGCGG - Intronic
1131048159 15:89329169-89329191 CCCACCACTGCTTGGTGGTGTGG + Intronic
1131111594 15:89767926-89767948 CACCCCACTGCTGGTTGGGGAGG + Intronic
1131119520 15:89813980-89814002 CACCGCACTGCTGGGGGGGGGGG + Intronic
1131410757 15:92205730-92205752 CACACCACTGCTGCAGGGGGAGG + Intergenic
1132806420 16:1777136-1777158 CTCGCGACTGCTGGGGTGGGCGG + Exonic
1134104750 16:11477536-11477558 CTCCTCCCTTCTGGGTGGGGTGG + Intronic
1134609066 16:15593398-15593420 GTCCCCATTGCTGGGGGGGGGGG - Intronic
1134892749 16:17855406-17855428 CTCAGCATGGCTGGGTGTGGTGG + Intergenic
1135507720 16:23053142-23053164 CTAGCCACTGCTGGGGGTGGAGG - Intergenic
1135681685 16:24462687-24462709 ATCATCCCTGCTGGGTGTGGTGG + Intergenic
1136233895 16:28903170-28903192 CTCCCCAGTGCTGGGGTGGGCGG - Intronic
1136247684 16:28984967-28984989 CTCCCCACTGGCGGGTGGGGTGG + Intronic
1137484913 16:48882727-48882749 CTGACCACAGCAGGATGGGGAGG - Intergenic
1138219908 16:55241738-55241760 CTCACCAAAGCAGGATGGGGAGG + Intergenic
1138401297 16:56746755-56746777 GTCACCCCGGCTGGGTGTGGTGG + Intronic
1138596540 16:58032214-58032236 CTCAACGCTGCTTGGTGGGTCGG + Intronic
1139448738 16:67014277-67014299 CTCGCCTCCGCTGGGTGGTGGGG + Intergenic
1140761111 16:78109653-78109675 GTGACAACTGCTGGGTGGGAGGG + Intronic
1141050971 16:80763321-80763343 TTCACCAGGGCTGGGTGAGGTGG + Intronic
1141166764 16:81666071-81666093 CTCCCCACTGGGGGATGGGGCGG + Intronic
1141181043 16:81753694-81753716 GTCAGCACTGCTGGGTGCAGTGG - Intronic
1141547484 16:84780888-84780910 GTTGCCACTGCTGGCTGGGGCGG - Intergenic
1142229432 16:88892911-88892933 CGCACCCCTGCTGGGTGTGAAGG - Intronic
1142962065 17:3557375-3557397 CTCACCACTGCTGGGGGCAGAGG - Intronic
1142976844 17:3649970-3649992 CCCACCACAGCTGGGTGCAGTGG + Intronic
1143512955 17:7405877-7405899 TTCACCACTGCAGGAAGGGGGGG + Intronic
1143604385 17:7973496-7973518 CACACCACTGCTGGGCACGGTGG + Intergenic
1143949550 17:10621843-10621865 GTAGCCACTGGTGGGTGGGGAGG + Intergenic
1144017399 17:11208995-11209017 GTTACCGCTGCTGGCTGGGGTGG + Intergenic
1144459502 17:15446701-15446723 CTAACCACATCAGGGTGGGGAGG + Intronic
1144886090 17:18463196-18463218 CTCAACCCTACTGGGAGGGGCGG + Intergenic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145004884 17:19332207-19332229 CTCGCCAGTGCTGCATGGGGTGG + Intronic
1145106238 17:20120098-20120120 CTCAGTACTGCCGGGTGGGGTGG + Intronic
1145146119 17:20481173-20481195 CTCAACCCTACTGGGAGGGGCGG - Intergenic
1146497549 17:33336576-33336598 CTCACGACAGCTGTGTGGGGAGG + Intronic
1146791175 17:35751378-35751400 CTCAGCCCAGCTGGGTGTGGTGG + Intronic
1147426776 17:40349562-40349584 CTCAACACTGCAGGATGGGCAGG - Intronic
1147535891 17:41323235-41323257 CTCCACCATGCTGGGTGGGGAGG + Intergenic
1147602260 17:41754012-41754034 CTCATCCCTGCTGGGGGCGGAGG + Intergenic
1147607938 17:41784957-41784979 ATCCCCAATTCTGGGTGGGGGGG + Intronic
1148400486 17:47355856-47355878 CCCAGCACTGCTGGGTGCAGTGG - Intronic
1148991359 17:51669451-51669473 GTTGCCACTGCTGGCTGGGGCGG - Intronic
1149077878 17:52617849-52617871 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1149850371 17:60030345-60030367 CTGACCAAAGCAGGGTGGGGAGG + Intergenic
1149859795 17:60116179-60116201 CTGACCAAAGCAGGGTGGGGAGG - Intergenic
1150304085 17:64069700-64069722 CTCACCACTGCATGTTGGGTGGG + Intronic
1150608565 17:66714652-66714674 CTCACCACTGCAGGATGGCGAGG + Intronic
1150838482 17:68586050-68586072 GTCAGCCCTGCTTGGTGGGGAGG - Intronic
1151397389 17:73832701-73832723 TGCACAACTGCTGGGTGGGCTGG - Intergenic
1151791255 17:76307372-76307394 CTCACCCCTCCAGGGTGGTGGGG + Intronic
1151814894 17:76466955-76466977 ATCTGCACTGCTGGGTGGGGCGG + Intronic
1151917821 17:77131555-77131577 CCCACTACAGCTGGGTGTGGTGG - Intronic
1152464147 17:80456366-80456388 ATTACTAGTGCTGGGTGGGGGGG - Intergenic
1152491876 17:80640569-80640591 TTCACCCCTCCTGGGTGGGCAGG + Intronic
1155289164 18:24323509-24323531 CTCACCCTGGCTGGGTGTGGTGG - Intronic
1156454346 18:37284601-37284623 CTGAGCAGTGCTGGCTGGGGCGG - Intronic
1157888112 18:51388497-51388519 CTTGTTACTGCTGGGTGGGGTGG + Intergenic
1158322129 18:56275062-56275084 CTCACAACTGCCCGGTGGAGTGG + Intergenic
1158750500 18:60253788-60253810 CTCACTACCACTGGGTGGGGTGG + Intergenic
1160037950 18:75318853-75318875 CTCTCCAGTGCTGTGTGGGCTGG + Intergenic
1160118772 18:76108582-76108604 CTCATTACTGCTAGGTGGGATGG + Intergenic
1160209292 18:76862647-76862669 CTCATCACTGATGGGGAGGGAGG - Intronic
1160590018 18:79938637-79938659 GTCACCTCTGGAGGGTGGGGTGG + Intronic
1160846394 19:1168000-1168022 CTCACCAGAGCTGGGGGAGGGGG + Intronic
1160875309 19:1294003-1294025 CTCACCCCTGCAGGCCGGGGTGG + Intronic
1161412997 19:4127429-4127451 CTCACTACTGCTGGGTGCAGAGG - Intergenic
1161833783 19:6630525-6630547 ATCACCAAGGCTGGGTGTGGGGG - Intergenic
1162298795 19:9831893-9831915 CCCACCACTGGTGGGAGGAGTGG - Intergenic
1162588291 19:11574957-11574979 ATCTCCACTGTTGGGTGGGTGGG - Exonic
1163434339 19:17286313-17286335 CACACTTCTGCTGGATGGGGAGG + Intronic
1163664426 19:18596617-18596639 CTCACCACTGCGGGGAGTGGAGG + Exonic
1163720837 19:18897445-18897467 CTCACCTCTGTGGGGTGAGGAGG - Intergenic
1163773652 19:19205558-19205580 CCCACCCCTGCTGCCTGGGGTGG - Intergenic
1164551502 19:29216377-29216399 CTCAGCACGGCTGGTTGGGGGGG + Intergenic
1164575548 19:29403430-29403452 CTCACCACTTCTGGCTTGGGTGG - Intergenic
1165779706 19:38425445-38425467 CACTAAACTGCTGGGTGGGGAGG + Intronic
1166035561 19:40165694-40165716 CTGAGAACTACTGGGTGGGGAGG - Intergenic
1166369070 19:42291449-42291471 CTCACCTTTGGGGGGTGGGGCGG - Exonic
1166530494 19:43540277-43540299 AGCAGCACTGCTGGGTTGGGAGG - Intergenic
1166706598 19:44911402-44911424 CTCACCAGGGCTGAGTGAGGAGG + Intergenic
1167073774 19:47236471-47236493 CTCCCCACAGCTGGGCGTGGTGG + Intergenic
1167211326 19:48135898-48135920 CTCCTCTCTCCTGGGTGGGGGGG - Intronic
1167595857 19:50427859-50427881 CTCACCACGGGGGGGGGGGGGGG - Intronic
1167622458 19:50567514-50567536 CACACCGCTGCTGCTTGGGGTGG - Intronic
1168028138 19:53658592-53658614 CTCTCCATGGCTGGGTGCGGTGG + Intergenic
1168391954 19:56016438-56016460 CTCAGCACAGCTGGGTGTGGTGG - Intronic
1202701922 1_KI270712v1_random:171082-171104 CTCTCCACAGCTTGGTGGGTGGG + Intergenic
925414058 2:3657196-3657218 CTAACTACGGCTGGGTGGCGGGG + Intergenic
925872200 2:8281153-8281175 CTCACCTGGGCTGGGTGCGGTGG - Intergenic
926114029 2:10200118-10200140 CTGGCCACAGCTGGGTGCGGTGG - Intronic
926251306 2:11156762-11156784 CTCTACCCTGCGGGGTGGGGAGG + Intronic
926512632 2:13801617-13801639 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
927687590 2:25182644-25182666 GTCTCCACAGCTGGGTGTGGTGG - Intergenic
927765400 2:25802841-25802863 CTGATCACGGCTGGGTGCGGTGG + Intronic
928662745 2:33520153-33520175 CTCTCCTCTGTTGGGTGGGGTGG + Intronic
931881053 2:66571395-66571417 ATCATCACTGTTGGGTGGTGAGG - Exonic
932961371 2:76415884-76415906 CTCTAGACTGCTGGGCGGGGGGG - Intergenic
933042214 2:77483626-77483648 CTCTTCCCTGCTGGGTGCGGTGG - Intronic
933347705 2:81110531-81110553 CTCACAATAGCTGGGTGTGGTGG + Intergenic
933522532 2:83391581-83391603 CACAACACAGCTGGGTGTGGTGG + Intergenic
933537854 2:83599628-83599650 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
934149928 2:89136417-89136439 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
934172834 2:89554528-89554550 CTCTCCACAGCTTGGTGGGTGGG + Intergenic
934217367 2:90045614-90045636 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
934283148 2:91628881-91628903 CTCTCCACAGCTTGGTGGGTGGG + Intergenic
934969038 2:98748382-98748404 CTCAAGGCTGCTGAGTGGGGTGG - Intergenic
934986974 2:98894514-98894536 CTCACCAGTGCTGGGCCAGGAGG - Intronic
935789412 2:106577326-106577348 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
936242494 2:110800071-110800093 GTTGCCACTGCTGGCTGGGGTGG - Intronic
937221293 2:120344521-120344543 GTCGCCTCTGCTGGTTGGGGAGG + Intergenic
937706626 2:124928179-124928201 CCTGCCACTGCTGGCTGGGGTGG - Intergenic
937956273 2:127423258-127423280 CTCACCTCTGCGGGCAGGGGAGG - Exonic
938566609 2:132524382-132524404 ACCACCACTGCTAGGTGGGAAGG - Intronic
939461189 2:142497339-142497361 CTCACCAGTGGTGGATAGGGGGG + Intergenic
939551941 2:143626563-143626585 GTTACCCCTGCTGGCTGGGGTGG + Intronic
940145516 2:150541699-150541721 GTTGCCACTGCTGGCTGGGGGGG + Intergenic
941956447 2:171210401-171210423 CTGACCATGGCTGGGTGTGGTGG - Intronic
942101746 2:172590704-172590726 GTTGCCACTGCTGGCTGGGGTGG + Intronic
942290687 2:174467326-174467348 CCCACCTCTACTGGGTGTGGTGG + Intronic
942830407 2:180232637-180232659 CCCAACACTTCTGGGTTGGGAGG + Intergenic
944718646 2:202401160-202401182 CTCACTACTGCTGAGTTGGGTGG - Intronic
946074073 2:217059362-217059384 CTCAGAACTGCAGGGTGGAGCGG - Intergenic
947589302 2:231376273-231376295 CTGACCACTGGTGAGTCGGGCGG + Intergenic
947752591 2:232540589-232540611 CGCACCACTGCTGCAGGGGGAGG - Exonic
948212272 2:236203576-236203598 ATCACCAAGGCTGGGTGTGGTGG + Intronic
948273415 2:236690928-236690950 CTCTCCTCTCCTAGGTGGGGTGG + Intergenic
948490008 2:238306618-238306640 TTCATCACTGCTGTGTTGGGTGG - Intergenic
948965058 2:241372757-241372779 CTTGCCTCTGCTGGGTGGGTGGG + Intronic
949014336 2:241701414-241701436 CTCACTGGTGCTGGGCGGGGCGG + Intergenic
949050349 2:241894558-241894580 CTGACCAGTGGTTGGTGGGGGGG + Intronic
1169600097 20:7248653-7248675 CTCCCCACTGCTTGCTGAGGTGG + Intergenic
1169853557 20:10078930-10078952 GTTGCCACTGCTGGGTGGGGTGG + Intergenic
1170389355 20:15854924-15854946 CTCACCAGTGCAGGGTTGGATGG - Intronic
1170632117 20:18074645-18074667 CCCACCTCTGCTAGGAGGGGTGG - Intergenic
1171271108 20:23818052-23818074 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1171398877 20:24858851-24858873 GTTACCACTGCTGGCTCGGGTGG + Intergenic
1172182872 20:33014274-33014296 CTCATCTCTGCTAGGAGGGGTGG - Intronic
1173079354 20:39850937-39850959 ATGACCACAGCTGGGTAGGGGGG + Intergenic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1174611139 20:51800249-51800271 CTCACACCTGGTGGGTGGGACGG - Intronic
1175940652 20:62536158-62536180 CTCAGCACTGCTGGGGGTGGAGG - Intergenic
1176031573 20:63015523-63015545 GTCTCCACTGGTGGGTGGTGTGG + Intergenic
1176146250 20:63566789-63566811 CGCACCCCTGCTGGGGGAGGGGG - Intronic
1177399544 21:20584839-20584861 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1179190035 21:39115762-39115784 CGCACCACTCCTGGTGGGGGTGG - Intergenic
1179502230 21:41817057-41817079 GTCACCAATGCTGGCTGTGGTGG - Intronic
1179923578 21:44520639-44520661 CTTACTCCTGCTGGGTGGAGGGG + Intronic
1179950173 21:44704759-44704781 CTCCCCAGTGATGGGTGTGGAGG - Intronic
1180949277 22:19714080-19714102 CTGACCTCGGCGGGGTGGGGCGG + Intergenic
1181008479 22:20026110-20026132 TTCACCAAGGCTGGGCGGGGTGG + Intronic
1181305803 22:21916596-21916618 CTCAGGACCTCTGGGTGGGGGGG - Intergenic
1181565508 22:23734654-23734676 CCTCCCACTGCTGGGTGTGGTGG + Intergenic
1182293644 22:29300578-29300600 CACCCCTCTCCTGGGTGGGGTGG - Intergenic
1182492154 22:30680393-30680415 CTCATCTCGGCTGGGTGCGGTGG - Intergenic
1183602906 22:38850433-38850455 CTGGCCCCTGCTGGGTGAGGAGG + Intergenic
1184250004 22:43254549-43254571 CTCAGCCCTGCAGGGTGGTGTGG + Intronic
1184773778 22:46613169-46613191 GTTACCACTGCTGGCTGGGCAGG + Intronic
1185246545 22:49776045-49776067 CTCACCAGTGCCGGGTAGGAGGG + Exonic
1185301108 22:50081649-50081671 CACAGCAGTGCTGGGTGAGGAGG + Intronic
949510344 3:4761600-4761622 CTCACACCTGCCAGGTGGGGTGG + Intronic
949619433 3:5793857-5793879 CTCAACATGGCTGGGTGTGGTGG - Intergenic
951102202 3:18702547-18702569 GCCACCACTGCTGGATGTGGGGG - Intergenic
951301829 3:21007965-21007987 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
951950937 3:28199841-28199863 GTTGCCACTGCTGGCTGGGGCGG + Intergenic
953325293 3:42007749-42007771 CTCCACACTGCTGGCTGTGGAGG - Intergenic
953416993 3:42728232-42728254 CTTTCCACTGCAGGGTGGGGTGG + Intronic
953679898 3:45031149-45031171 CTGGCCACAGCTGGGTGGTGTGG + Intronic
954107227 3:48415883-48415905 CCCACCACAGCTGGCTAGGGAGG + Intronic
954685278 3:52366870-52366892 CTCACCACTCATGGGTGAGGAGG - Exonic
955405629 3:58623991-58624013 CTGGCCACTGCTGATTGGGGTGG + Intronic
956262947 3:67364568-67364590 CTTATCACTCCTGGGTGGGTGGG - Intronic
958491612 3:94781944-94781966 TTAACCTCGGCTGGGTGGGGTGG + Intergenic
958601038 3:96297829-96297851 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
960295650 3:115940256-115940278 GTTGCCACTGCTGGCTGGGGTGG + Intronic
960997922 3:123351794-123351816 TGCACCACTCTTGGGTGGGGTGG - Intronic
961459386 3:127040551-127040573 CTCCCCACTGCTGGTGGGGAAGG + Intergenic
961459938 3:127043837-127043859 CCCTCCCCTGCAGGGTGGGGTGG + Intergenic
962855464 3:139340931-139340953 TTCACCACTGGGGGTTGGGGAGG - Intronic
962865391 3:139444321-139444343 CTCCTCCTTGCTGGGTGGGGTGG - Intergenic
963165314 3:142195637-142195659 CTCAACAAGGCTGGGTGTGGTGG - Intronic
967448938 3:189600203-189600225 CTCATCACTGTTGGGAGAGGGGG + Intergenic
968384366 4:123276-123298 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
968518233 4:1023702-1023724 CACCCCACTGCTGGCTGGCGGGG - Exonic
968660235 4:1795781-1795803 CAGACCCCTGCTGGGTGGGGTGG - Intronic
969314151 4:6371451-6371473 CTGACCACTGCTGGGTGCCCAGG + Intronic
969349702 4:6591321-6591343 GTCACCTGTGCTGGGTAGGGTGG - Intronic
969493553 4:7513335-7513357 CCCACCTCTGCAGGGTTGGGGGG - Intronic
969625891 4:8305507-8305529 CTCCCCACTGCTGGGAAGGAAGG - Intronic
971343129 4:25788895-25788917 CTGAGCTCTGCTGGGTTGGGGGG - Intronic
971579064 4:28310235-28310257 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
971907330 4:32743307-32743329 CCCAGCATTGCTGGGTGCGGTGG - Intergenic
972361030 4:38325482-38325504 GTTGCCACTGCTGGCTGGGGGGG + Intergenic
972597326 4:40541447-40541469 GTCAACACTGCTGGGTGTGGTGG + Intronic
972889327 4:43537019-43537041 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
973044610 4:45520059-45520081 CTCGCCACTGCTGGCTCCGGTGG + Intergenic
973146338 4:46831267-46831289 CTGAGCGCTGCTGTGTGGGGAGG - Intronic
975263768 4:72336852-72336874 GTTAACACTGGTGGGTGGGGCGG - Intronic
978156674 4:105497159-105497181 CTCCCCATTGTTGGGGGGGGGGG + Intergenic
979282602 4:118884529-118884551 ATCAACACTGCTGGGGTGGGAGG + Intronic
979780251 4:124643104-124643126 CTCATCACTGCCCTGTGGGGAGG + Intergenic
980156813 4:129117701-129117723 CTCCCCACAGCTGGGTTGTGAGG - Intergenic
981538224 4:145822618-145822640 CTCTCCACAGCTGGGAGGGAAGG + Intronic
982876943 4:160662395-160662417 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
983033711 4:162836232-162836254 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
984830042 4:183964624-183964646 TGCACCACTGCTGGGTGCGACGG - Intronic
985560396 5:583217-583239 AGCAAGACTGCTGGGTGGGGCGG - Intergenic
985693943 5:1329447-1329469 CTCACCACTGCTTGGTGGACAGG + Intronic
985807858 5:2060314-2060336 CCCACCAATGCTGAGTGGAGCGG + Intergenic
986620362 5:9666629-9666651 CTTCCTATTGCTGGGTGGGGTGG + Intronic
986785036 5:11106487-11106509 CACACCACTGATGGGCGGGAAGG - Intronic
987710902 5:21499713-21499735 CTCTGCAGTGCTGGGTGTGGTGG + Intergenic
988358398 5:30204925-30204947 CTTACCACTGCTGGCTGGGGTGG - Intergenic
988547919 5:32174747-32174769 CTCTCTGCTGCTGGGCGGGGAGG + Intergenic
988749237 5:34177908-34177930 CTCTGCAGTGCTGGGTGTGGTGG - Intergenic
989292455 5:39785537-39785559 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
989539070 5:42597843-42597865 TCCACCACTGCTGGGTGTTGGGG + Intronic
991674581 5:69078258-69078280 CTCATCAAGGCTGGGTGTGGTGG - Intergenic
992100114 5:73399013-73399035 CACACCACTGCAGGGTAGGAAGG + Intergenic
993541312 5:89156216-89156238 CACCCCACTGCTTGGTGGGAGGG + Intergenic
993595109 5:89844618-89844640 CACATTGCTGCTGGGTGGGGTGG - Intergenic
994054384 5:95399483-95399505 CCCATCACAGGTGGGTGGGGGGG - Intronic
994489726 5:100425567-100425589 GTTTCCACTGCTGGCTGGGGTGG - Intergenic
994943437 5:106355376-106355398 CTCATCAAGGCTGGGTGCGGTGG + Intergenic
995413903 5:111888324-111888346 TTCCCCATTGCTGGGTGGCGGGG + Intronic
995674170 5:114643704-114643726 CTGACCACTGGTGAGTGGGGTGG + Intergenic
997150376 5:131487338-131487360 CTTGCCCCTGCTGGCTGGGGTGG + Intronic
997709242 5:135990147-135990169 CTCATCACAGCTGGTTGTGGAGG + Intergenic
999045066 5:148458627-148458649 CTCACCAAGCCAGGGTGGGGAGG + Intronic
999818649 5:155201975-155201997 GTTACCACTGCTGGCTCGGGTGG + Intergenic
1000549837 5:162647357-162647379 ATTGCCACTGCTGGCTGGGGTGG - Intergenic
1000770956 5:165353308-165353330 CTTACCTTTGCTAGGTGGGGAGG - Intergenic
1001295370 5:170495326-170495348 CGCACCACTGTTGGGTGCAGGGG + Intronic
1001301590 5:170537546-170537568 CTCTCCACTGTTGGCTGGGGAGG + Intronic
1001441624 5:171748222-171748244 CTCAAAACTGCTGGGAGGGATGG + Intergenic
1002297036 5:178237539-178237561 CTGGCCACTGCTGGGTGGGGAGG - Intergenic
1002571533 5:180142342-180142364 CACACCACTGCGGGGAGGGGTGG + Intronic
1003202860 6:3978385-3978407 TTCATCAGTGCTGGGTGGGAAGG - Intergenic
1003643829 6:7898341-7898363 CTCAACTCGGCTGGGTGTGGTGG - Intronic
1003664580 6:8098829-8098851 CTCACAACTGCTGGGCGGAGGGG + Intronic
1004389326 6:15196967-15196989 CACACCCCTGCCGGGTGCGGTGG - Intergenic
1004531027 6:16456041-16456063 GTTGCCACTGCTGGCTGGGGTGG - Intronic
1004744113 6:18492854-18492876 ATAAACACTGCTGGGTTGGGTGG + Intergenic
1005132131 6:22521448-22521470 CTCACCACTGCTCTCTGGGCAGG - Intergenic
1005546788 6:26880784-26880806 CTCTGCAGTGCTGGGTGTGGTGG - Intergenic
1006059924 6:31412074-31412096 CCCCCCACTGCTGGGTGTCGTGG - Exonic
1006072412 6:31507149-31507171 CCCCCCACTGCTGGGTGTTGTGG - Exonic
1006102604 6:31695010-31695032 CTCACAACAGCTGAGTGAGGTGG - Intronic
1006230145 6:32579545-32579567 GTTGCCACTGCTGGTTGGGGTGG + Intronic
1006498264 6:34439857-34439879 GTCGCCGCTGCTGGGCGGGGGGG - Intergenic
1009017543 6:57921868-57921890 CTCTGCAGTGCTGGGTGTGGTGG - Intergenic
1009386275 6:63086483-63086505 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1009688248 6:66991325-66991347 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1009907688 6:69889842-69889864 GTTGCCACTGCTGGCTGGGGTGG - Intronic
1011225039 6:85096143-85096165 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1011249429 6:85355124-85355146 CACAGCACAGCTGGGCGGGGTGG - Intergenic
1011373318 6:86663950-86663972 GTTACCACTGCTGGCTTGGGTGG - Intergenic
1011617142 6:89207480-89207502 CTCACCTCTGCCAGGTGTGGTGG - Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015513626 6:134063405-134063427 CTCACCACTCCTGGGAGGTAAGG - Intergenic
1015635973 6:135274380-135274402 GTCAACACTGCTGGCTGGGCTGG + Intergenic
1016652936 6:146483983-146484005 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1017699903 6:157058711-157058733 CTCACCCGTGCTGGGTGCTGAGG + Intronic
1017822431 6:158059370-158059392 CTCTCCACAGCTGGGCTGGGCGG + Intronic
1018935919 6:168274067-168274089 CTTACAGCTGCTGGGTGCGGGGG + Intergenic
1019515285 7:1437272-1437294 CTCACAACAGCTGCGTGAGGTGG + Intronic
1019622858 7:2001083-2001105 CACACCCCTGCCGGGTGGAGAGG + Intronic
1019936930 7:4263367-4263389 TAGACCTCTGCTGGGTGGGGAGG + Intronic
1019956890 7:4422862-4422884 CTCACTACTGCTGGGCAGGGTGG + Intergenic
1020002440 7:4763555-4763577 CTCACCACTGCTGCTGGGGTGGG - Exonic
1020278735 7:6639172-6639194 CTGACCACTGCTGGGGGTAGGGG - Intronic
1020325864 7:6974998-6975020 CACCTCACTGCTGGATGGGGCGG + Intergenic
1021355995 7:19654006-19654028 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1021633895 7:22672322-22672344 GTGACCAGTGCTGGGTGGGGTGG + Intergenic
1022253887 7:28636266-28636288 CTCTCCACTGGGGGGTGGGAGGG + Intronic
1022355504 7:29610805-29610827 CTGAACACAGCTGGGTGCGGTGG - Intergenic
1023524967 7:41092663-41092685 GTCCCAACTGCGGGGTGGGGAGG - Intergenic
1023684403 7:42719727-42719749 CCCAACACTCCTGGTTGGGGTGG + Intergenic
1024258708 7:47558493-47558515 TGCTCCACTGCAGGGTGGGGAGG - Intronic
1024294444 7:47831336-47831358 CAAACCACTGCTGGGTGCTGCGG + Exonic
1026285085 7:68955684-68955706 CTGACCACCACTGGGTAGGGAGG + Intergenic
1026352585 7:69530528-69530550 CTCATCACTGCTGGGATGGATGG - Intergenic
1026379665 7:69786485-69786507 GTTGCCACTGCTGGCTGGGGTGG - Intronic
1029530758 7:101123713-101123735 GACACCCCTGCTGGGTGTGGTGG - Intergenic
1029714746 7:102319841-102319863 CTCCCCAGGGCTGGCTGGGGAGG - Intronic
1030116936 7:106069147-106069169 CACACCCTTGCTGTGTGGGGTGG - Intergenic
1030283411 7:107800205-107800227 CTCAGCACAGCTGGGTGCAGTGG + Intronic
1031799406 7:126223601-126223623 GTGGCCACTGCTGGGCGGGGGGG + Intergenic
1032510018 7:132465185-132465207 CTCCACACTGCCTGGTGGGGGGG - Intronic
1033344840 7:140518802-140518824 CGCACCACTTCTGGGTGGAAAGG - Intronic
1033686366 7:143644590-143644612 CTCACCAATGCTGGATGGACAGG - Intronic
1033689372 7:143722725-143722747 CTCACCAATGCTGGATGGACAGG + Exonic
1033698247 7:143813031-143813053 CTCACCAATGCTGGATGGACAGG + Intergenic
1033857736 7:145585393-145585415 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1034324871 7:150220885-150220907 TTAACCCCTGCTGGGTGGGTGGG - Intergenic
1034452800 7:151146429-151146451 CTAACCGCGGCTGGGTGAGGTGG + Intergenic
1034768324 7:153748348-153748370 TTAACCCCTGCTGGGTGGGTGGG + Intergenic
1035100137 7:156389542-156389564 TTCACCACTGCTGGCTAGGGCGG - Intergenic
1035557521 8:577988-578010 CTCACCCCTGCTGCATGAGGTGG - Intergenic
1035694607 8:1585698-1585720 CTGCCCACGGCTGGGTGGTGGGG - Intronic
1035754761 8:2022936-2022958 CTCACAACTGTTGGGTGCGGAGG - Intergenic
1035907353 8:3527707-3527729 CTTACCACTGGTGGGAGGGGTGG + Intronic
1036099077 8:5757549-5757571 GTTACCACTGCTGGCTGGGGTGG + Intergenic
1037842105 8:22252080-22252102 CTCACAGCTGCTGGCTGGGCAGG - Exonic
1037846207 8:22284639-22284661 CACACCACTGATGGGGGAGGGGG - Intronic
1038012982 8:23489480-23489502 GTTGCCACTGCTGGCTGGGGGGG - Intergenic
1038495919 8:28002548-28002570 ATAACCATAGCTGGGTGGGGTGG + Intergenic
1038850377 8:31269537-31269559 GTGGCCACTGCTGGCTGGGGTGG + Intergenic
1039129636 8:34248386-34248408 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1039430595 8:37522169-37522191 CCCAGCACTTCGGGGTGGGGAGG + Intergenic
1039805267 8:40992323-40992345 CTCTCCACTGCTTGGGGTGGGGG + Intergenic
1040518481 8:48153937-48153959 CTCATTACTGCTGGAGGGGGTGG - Intergenic
1040528159 8:48242416-48242438 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1041435893 8:57841361-57841383 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1041722997 8:60993170-60993192 GTCACCACTGATTGGTGGGAGGG + Intergenic
1043613128 8:82091074-82091096 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1044517363 8:93155021-93155043 ATAACCACTGCATGGTGGGGAGG + Intronic
1044679099 8:94759187-94759209 TTTGCCACTGCTGGCTGGGGTGG + Intronic
1045608889 8:103811731-103811753 CTCGCAACAGCTGGGTGTGGTGG - Intronic
1045861815 8:106822066-106822088 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1047015094 8:120715803-120715825 CTCTCCACTGCTGTGTGAGTGGG - Intronic
1047311545 8:123696645-123696667 CTCACTGCTCCTGGGTGGGAGGG + Intronic
1047528114 8:125650986-125651008 CTTACCACAGGTGGCTGGGGTGG + Intergenic
1048210435 8:132450138-132450160 GTTGCCACTGCTGGCTGGGGTGG + Intronic
1048210441 8:132450157-132450179 GTGGCCACTGCTGGCTGGGGTGG + Intronic
1048216894 8:132504479-132504501 GTTACCTCTGCTGGGTGGGTGGG + Intergenic
1048443677 8:134477999-134478021 TTAATCACTGCTGGGTGGGGTGG - Exonic
1048864628 8:138750621-138750643 TACACCACTGATGGGTGGGTAGG - Intronic
1049256975 8:141619381-141619403 GTCACCACTGCAGTGTGGAGAGG - Intergenic
1049362065 8:142216581-142216603 CTGACCAGTGCGGGGAGGGGTGG - Intronic
1049455060 8:142682501-142682523 CTGTCCCCTGCTGGGTGCGGGGG - Exonic
1049687169 8:143943626-143943648 GTCTACACTGCAGGGTGGGGTGG + Intronic
1049788030 8:144460493-144460515 CTCCCCATTGGTGGGTGGGCTGG - Intronic
1049797320 8:144502767-144502789 GCCACCAGTGCTGGGTGGTGTGG + Intergenic
1049805657 8:144537617-144537639 CTAACCGCTTCTGGGCGGGGGGG - Intronic
1049877660 8:145036120-145036142 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1050019307 9:1267449-1267471 CTCAGCACTCCTAGGTGGGGTGG - Intergenic
1050835432 9:10072536-10072558 GTTGCCACTGCTGGCTGGGGTGG + Intronic
1053173200 9:35905354-35905376 CTCATCACTGCTGGGCAGGGAGG + Intergenic
1053282398 9:36829200-36829222 CTAACCCCAGCTGGGTTGGGTGG - Intergenic
1053602505 9:39624734-39624756 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1054251033 9:62717701-62717723 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1054565140 9:66752214-66752236 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1054870417 9:70043713-70043735 CCCACCGCGGCTGGGCGGGGCGG + Exonic
1055913229 9:81374608-81374630 CTCAAAACTGCTGAGTGGGAAGG - Intergenic
1056366421 9:85909441-85909463 CTCACCACTGCTGCTAGAGGAGG - Intergenic
1058379730 9:104364154-104364176 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1060662548 9:125412973-125412995 CTCAGCACTGCAGGGTGTAGGGG - Intergenic
1061160764 9:128892591-128892613 CTCACCCCAGCTGGGTGTGGGGG + Intronic
1061674274 9:132206964-132206986 TGCTCCACTGCTGGGTGGGGCGG + Intronic
1061874870 9:133538641-133538663 CTCAGCAATGCTGGGACGGGCGG + Intronic
1062007594 9:134248956-134248978 CACACCACTGATGGGTGTGTGGG + Intergenic
1062508803 9:136893369-136893391 CACACCACTGCTGGCTTTGGGGG + Intronic
1185451696 X:284178-284200 CTCACCTCTGATGGGTGGGCAGG + Exonic
1186451152 X:9674694-9674716 CTCACAGCTACTGGGGGGGGGGG - Intronic
1188098171 X:26047511-26047533 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1189347855 X:40255869-40255891 CCAACCACTGCTGGGTGGGAAGG + Intergenic
1190148159 X:47917583-47917605 CTCACCACTGCTCCATGTGGTGG - Exonic
1192130071 X:68541478-68541500 GTTGCCACTGCTGGCTGGGGTGG + Intergenic
1192218385 X:69179786-69179808 CTCACCTCTGCTGAGTGGCGTGG + Intergenic
1193933261 X:87582885-87582907 GTAGCCACTGCTGGCTGGGGTGG + Intronic
1193962126 X:87939433-87939455 ATTGCCACTGCTGGCTGGGGTGG + Intergenic
1194408949 X:93533185-93533207 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1194435994 X:93868952-93868974 GTCTCCACTCCTGAGTGGGGGGG - Intergenic
1195465706 X:105176667-105176689 CTCCCCACAGGTGGATGGGGTGG - Intronic
1195551928 X:106181280-106181302 GTTGCCACTGCTGGCTGGGGTGG + Intronic
1195566292 X:106343204-106343226 GTTGCCACTGCTGGGTTGGGTGG + Intergenic
1196720886 X:118852884-118852906 CTCACCCTGGCTGGGTGTGGTGG + Intergenic
1196871085 X:120114267-120114289 CAGACCACAGCTGGGTGTGGTGG + Intronic
1197513019 X:127395058-127395080 GTTACCACTGCTGGCTCGGGTGG - Intergenic
1197554617 X:127938165-127938187 ACCACCACTGCGGGGTGGGGAGG + Intergenic
1198397412 X:136234223-136234245 CTTTCCATTACTGGGTGGGGGGG + Intronic
1198486582 X:137093369-137093391 GTTACCACTGGTGGGTGGGTAGG + Intergenic
1198742066 X:139852442-139852464 CTCAGCAATGCGGGGGGGGGGGG + Intronic
1199443611 X:147896675-147896697 GTTACCGCTGCTGGCTGGGGTGG + Intergenic
1200003928 X:153075315-153075337 GACAGCACTGCGGGGTGGGGTGG + Intergenic
1200060111 X:153480331-153480353 CTCCTCACTGCTGGGGAGGGGGG - Intronic
1200123585 X:153802740-153802762 CTCTCCACTGATGGCTGGGAAGG - Exonic
1200142634 X:153909602-153909624 CTGACCACTCCTGGCTGGCGCGG - Intronic
1200213132 X:154355741-154355763 GCCACCACTGCTGGGTTGCGAGG + Intronic
1200694537 Y:6347218-6347240 ATTGCCACTGCTGGGTGGGTTGG + Intergenic
1200775889 Y:7170142-7170164 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1200880246 Y:8205186-8205208 GTTGCCACTGCTGGGTTGGGTGG + Intergenic
1200912094 Y:8539705-8539727 GTCACCACAGCTTGGAGGGGGGG - Intergenic
1201040740 Y:9827492-9827514 ATTGCCACTGCTGGGTGGGTTGG - Intergenic
1201909695 Y:19121420-19121442 ATTGCCACTGCTGGCTGGGGTGG + Intergenic
1201918924 Y:19213193-19213215 GTTGCCACTGCTGGCTGGGGTGG - Intergenic
1201919855 Y:19222481-19222503 GTTTCCACTGCTGGCTGGGGTGG - Intergenic
1201989209 Y:20006615-20006637 GTTGCCACTGCTGGCTGGGGTGG + Intergenic