ID: 1104663314

View in Genome Browser
Species Human (GRCh38)
Location 12:130628054-130628076
Sequence CTGGGTGTCTGGAGCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 10, 3: 32, 4: 415}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104663314_1104663319 10 Left 1104663314 12:130628054-130628076 CCATCTGTGCTCCAGACACCCAG 0: 1
1: 0
2: 10
3: 32
4: 415
Right 1104663319 12:130628087-130628109 ATCAAGTTCTTTCTTGCCTCAGG 0: 1
1: 0
2: 6
3: 66
4: 436
1104663314_1104663320 11 Left 1104663314 12:130628054-130628076 CCATCTGTGCTCCAGACACCCAG 0: 1
1: 0
2: 10
3: 32
4: 415
Right 1104663320 12:130628088-130628110 TCAAGTTCTTTCTTGCCTCAGGG 0: 1
1: 1
2: 16
3: 85
4: 440
1104663314_1104663321 22 Left 1104663314 12:130628054-130628076 CCATCTGTGCTCCAGACACCCAG 0: 1
1: 0
2: 10
3: 32
4: 415
Right 1104663321 12:130628099-130628121 CTTGCCTCAGGGCCTTTGCACGG 0: 3
1: 17
2: 46
3: 103
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104663314 Original CRISPR CTGGGTGTCTGGAGCACAGA TGG (reversed) Intronic
900346447 1:2212720-2212742 CTCGTTGCCTGGAGGACAGAGGG + Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
901167308 1:7229693-7229715 CTGTGAGCCAGGAGCACAGAGGG + Intronic
901219831 1:7577241-7577263 ATGAGTTTCTGGAGCACATAGGG - Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
902826291 1:18976558-18976580 CTGAGTGCCTGGAACACAGTAGG - Intergenic
902873481 1:19327580-19327602 CTGGGTGCCTGGCACACAGGAGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903568387 1:24285869-24285891 CACGGTGCCTGGAGCACAGTGGG - Intergenic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904461648 1:30684366-30684388 GTGGGTGGATGGAGCAGAGATGG - Intergenic
904678380 1:32212373-32212395 CTGGGTGCCTAGAGGCCAGAGGG + Intronic
905394433 1:37657864-37657886 CTGGGAGGGAGGAGCACAGAAGG + Intergenic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
905789575 1:40783130-40783152 CAGGGTGTGTGGAACACAGTGGG - Intergenic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906577677 1:46905409-46905431 GTGCATGTCTGAAGCACAGAAGG - Intergenic
906615944 1:47232721-47232743 CTGGGTGTCTGGGACACTGGAGG - Intergenic
906785557 1:48612405-48612427 CTGGATGGCTGGGGCAGAGAAGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907918145 1:58889369-58889391 TTGTGTGTCTGGGGAACAGAGGG - Intergenic
908728610 1:67203177-67203199 AGAGGTGTCTGGAACACAGAAGG - Intronic
910092479 1:83481372-83481394 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
912488536 1:110048178-110048200 CTGGGTGTCTCAATCACAGCTGG - Intronic
912522091 1:110252491-110252513 CTGGCTGTCTTGAGCACAGATGG + Intronic
912739610 1:112181960-112181982 CTGGGTATTTGGACCTCAGAAGG + Intergenic
915102856 1:153513234-153513256 GTGGGTGCTTGGAGCAGAGAAGG - Intergenic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
916850063 1:168694695-168694717 TTGGGTATGTGGAGCACAGCAGG - Intergenic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
918423693 1:184387473-184387495 CGGGGTGTCTGCCGCACGGAAGG + Intronic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
922433066 1:225575129-225575151 CTGTGTGTGTGGAGCAGTGAGGG - Intronic
922717952 1:227886798-227886820 CAGGGTGTCTGGAGCTCCCAGGG - Intergenic
923668307 1:236018368-236018390 CTGGGTGTCTGGAACATTGTTGG - Intronic
923716011 1:236425325-236425347 CTGGGGGTCAGGAGAACACATGG + Intronic
923867911 1:237960355-237960377 CTGAATGTGTGGGGCACAGAAGG + Intergenic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
924606733 1:245541868-245541890 CTGGGTTTCTGGGCCTCAGAAGG + Intronic
1062841955 10:679207-679229 CTGGGTGTGGGGAGTAGAGATGG - Intronic
1062841982 10:679286-679308 CTGGGCGTGGGGAGCAGAGATGG - Intronic
1062842027 10:679425-679447 CTGGGTGTGGGGAGTACAGATGG - Intronic
1063207970 10:3853132-3853154 CTGGGTGGCGGGAGCTCAGAGGG + Intergenic
1063487886 10:6436945-6436967 CTGGGTTTGTGAAGCACAGGGGG + Intronic
1064271470 10:13870078-13870100 CTGGGAATCTGGATCAGAGAGGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1066242208 10:33549222-33549244 CGGGATGTCTGGAGGTCAGATGG + Intergenic
1067074972 10:43172948-43172970 TAGGGTGTTTGGAGCACAGCCGG + Intronic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067227478 10:44385264-44385286 CTGCGCCTCGGGAGCACAGAGGG - Intronic
1069086692 10:64148622-64148644 CTGAGTTTCTGTAGTACAGAAGG - Intergenic
1069107376 10:64399607-64399629 ATAGGTGTTTGGAGAACAGATGG + Intergenic
1071876155 10:89845457-89845479 CTGTGTGGCTGGAACACAGGTGG + Intergenic
1071954526 10:90743425-90743447 ATGTGTCTGTGGAGCACAGATGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1074570081 10:114616312-114616334 GTGGGTGTCCTGAGCACACATGG + Intronic
1076114059 10:127883029-127883051 CTGGGAGGATGGAGCCCAGATGG - Intronic
1076128912 10:127998154-127998176 CTGGCTGTCTGCAGTAGAGATGG + Intronic
1076368142 10:129935424-129935446 GTGGGAGTTTGCAGCACAGAAGG - Intronic
1076922591 10:133462490-133462512 CTGGGTGTTGGGATTACAGATGG - Intergenic
1077497881 11:2895319-2895341 CAGGGTGCCTGGAGCAGGGAAGG + Intronic
1078252616 11:9629112-9629134 CTGGGTGTTTGAAGCAAAGGGGG + Intergenic
1078368066 11:10722737-10722759 ATGGGTGAGTGGAGCTCAGAGGG - Intergenic
1078859660 11:15235425-15235447 CTGGGTGGCAGGAGCCCATAAGG + Intronic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1079899238 11:26160729-26160751 ATGGGTGCCTGGAACATAGAAGG + Intergenic
1082309746 11:50632141-50632163 CTGCATGTCTGAGGCACAGAGGG + Intergenic
1084489265 11:69469483-69469505 TGGGGTGACTGGATCACAGAGGG + Intergenic
1084617029 11:70243281-70243303 CTGGGGGTCTGCAGCAGAGCAGG + Intergenic
1085531486 11:77194683-77194705 CTGTGTGCCTGGCACACAGATGG - Intronic
1086740065 11:90355799-90355821 CTGAGTGGCTGAATCACAGAAGG - Intergenic
1088318435 11:108530759-108530781 GAGGGTGCCTGGAGCACAGCTGG + Intronic
1088686835 11:112290716-112290738 CTTTGTGTCTTGAGCACTGAGGG - Intergenic
1088813235 11:113405406-113405428 CCTGGTGTCTGGAGCTCAGAGGG + Intergenic
1089621736 11:119726599-119726621 CTGAGTGGGTGGAGCACAGCAGG + Intronic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1089859257 11:121574247-121574269 CTGGGTGTCCAGGTCACAGATGG - Exonic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1090668813 11:128931874-128931896 ATGTGTGTCTGGAGAACACAGGG - Intergenic
1090780627 11:130003236-130003258 CTGGGTGTCTCGGGCGCCGAGGG + Intergenic
1091013395 11:132026919-132026941 ATGGGTGTCGGAAGGACAGAAGG - Intronic
1091883503 12:3999209-3999231 CTGAGTGACTGGAGAAGAGAAGG + Intergenic
1092154518 12:6273773-6273795 CTGGCTGACTGGAACCCAGAGGG + Intergenic
1092795199 12:12103975-12103997 CTGGGTGACTGGGTGACAGAGGG + Intronic
1094865733 12:34528301-34528323 ATGCATGTCTGAAGCACAGAAGG - Intergenic
1096423954 12:51485050-51485072 CTGTGTGTTTGGAGCAGAGTGGG + Intronic
1097577018 12:61407428-61407450 CTATGTGTCTGGAACACTGAAGG + Intergenic
1099003235 12:77205905-77205927 ATGGGTCTCTGGATCACACAGGG + Intergenic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1101251335 12:102939088-102939110 CAGGGTGTCAGGAGCTCACAGGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1103145752 12:118594512-118594534 CTGGGTGTCAGGGGTACAGGAGG + Intergenic
1103184583 12:118945422-118945444 CTATGTATCTGCAGCACAGAAGG - Intergenic
1103542135 12:121673321-121673343 GTGTGTGGCTGGAGCAGAGACGG - Intergenic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1105858984 13:24393158-24393180 CTGGCTCTCGGGACCACAGAGGG - Intergenic
1106411416 13:29514037-29514059 CTGGGTGTCTGGGGCTGAGCGGG + Exonic
1107430970 13:40339893-40339915 CCAGGTGTTAGGAGCACAGATGG - Intergenic
1108536966 13:51392832-51392854 CTGGGTGTTGGGAGTACAGCAGG - Intronic
1108571355 13:51754978-51755000 GGGGATGGCTGGAGCACAGATGG - Intronic
1109281632 13:60363482-60363504 CTGGGTGCCAGGGGCACAGTGGG + Intergenic
1110413041 13:75224116-75224138 ATGGGAATCTGGAGCACAGATGG - Intergenic
1110590530 13:77251875-77251897 CAGGGTGTTTGGAGAGCAGAGGG - Intronic
1112338894 13:98536867-98536889 CTGGGCGGCTGGAGGACAGGCGG - Intronic
1112338903 13:98536900-98536922 CTGGGCGACTGGAGGACAGGCGG - Intronic
1112998598 13:105604539-105604561 CTTGGTGTCTGGAGAGGAGAGGG + Intergenic
1113555811 13:111233034-111233056 CTGGGTTTCTGGGGCACTGAGGG + Intronic
1113634495 13:111910318-111910340 CTGGCTGGCTGGCTCACAGATGG - Intergenic
1113729893 13:112633866-112633888 ATTGGTGTCTGGAGCACTGGAGG - Intergenic
1114538188 14:23436154-23436176 CTGAGTGTCAGCAGCAGAGAAGG + Intergenic
1114542275 14:23469936-23469958 CTGGGTGTCTGACGGAGAGAGGG + Intronic
1117342203 14:54802174-54802196 CTGGGTTTTTGGGGAACAGATGG - Intergenic
1118044292 14:61949954-61949976 CTGGGACTCTGAGGCACAGAAGG - Intergenic
1119437714 14:74609078-74609100 CTGGCTGTCTGCAGCTCACAAGG + Intronic
1119557709 14:75566365-75566387 GTGCGTGTCTGGGACACAGAGGG + Intergenic
1120333861 14:83128382-83128404 CTTGATGTTTAGAGCACAGAGGG - Intergenic
1120334032 14:83130842-83130864 CTTGATGTTTGGAGCGCAGAGGG - Intergenic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1120734149 14:88034664-88034686 CTGGGTGTCAGGATCACATCTGG + Intergenic
1122297854 14:100715241-100715263 CTGCATGGCTGGGGCACAGAGGG + Intergenic
1122304694 14:100755478-100755500 CTGGCTTTCTGGTTCACAGATGG + Intergenic
1122698344 14:103569606-103569628 CCGGGTGTCTGCAGCTCAGTGGG - Intronic
1122846164 14:104500349-104500371 CTGGCTCTCGGGACCACAGAGGG - Intronic
1124604191 15:31158861-31158883 CTGGATATCTGGAGAACAAAGGG - Intronic
1124682050 15:31740246-31740268 CTGAGTGCCTGGAGCAGAGGTGG + Intronic
1125340620 15:38671970-38671992 CTGGGGGTGTGGAGAACAGCAGG + Intergenic
1125449796 15:39796259-39796281 CTAGGTGTTAGGAGAACAGAGGG - Intergenic
1126384560 15:48080732-48080754 CTGAGTGTAGGGAGTACAGAGGG + Intergenic
1128968478 15:72085671-72085693 GTGGTTGTCTGGAGAAAAGAAGG + Intronic
1130098931 15:80877292-80877314 CTGTGTCTCTTGAGCAAAGAAGG - Intronic
1131511002 15:93049445-93049467 ATGGGTATCAGCAGCACAGATGG + Intronic
1132415260 15:101614658-101614680 CTGGGTGTCGGGACCCCATAAGG - Intergenic
1132884167 16:2175233-2175255 CCTGGAGTCTGGAGCCCAGACGG - Intronic
1132984410 16:2756793-2756815 CTGTGTGTCTGGGGCATAGATGG + Intronic
1133317409 16:4893186-4893208 CTGCGGGTCAGGAGCACAGGTGG - Intronic
1134665229 16:16013881-16013903 GTGTGTGGCTGGAGCAGAGATGG + Intronic
1136092030 16:27927522-27927544 TTGTGTGGCTGGAGCACAGTGGG - Intronic
1136289707 16:29264245-29264267 GTGAGTGGCAGGAGCACAGAGGG - Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1138728554 16:59168178-59168200 CTGGATATCTGGAGCCCAAAGGG + Intergenic
1138897555 16:61226318-61226340 GTGGGTATTTGGAGCACAAAGGG + Intergenic
1139381884 16:66537654-66537676 TTGTGTGTCTAGACCACAGATGG - Intronic
1139528957 16:67532645-67532667 ATGGGTGTCTGAAGCCCAAAAGG + Intronic
1140273197 16:73484468-73484490 CTGGGTGCCTGGTGACCAGATGG + Intergenic
1140393225 16:74606509-74606531 CTGGGAGTGAGGAGCAAAGAGGG + Intronic
1141019040 16:80477750-80477772 CTGGGTCGCTGGATCACAAAAGG + Intergenic
1142064760 16:88055255-88055277 GTGGGTGTATGGATTACAGATGG - Intronic
1142095443 16:88237225-88237247 GTGCGTGGCAGGAGCACAGAGGG - Intergenic
1142217535 16:88837269-88837291 CTGGATGTCTGGAGCACAGCCGG + Intronic
1142261743 16:89045753-89045775 CTGGATCTCTGGAGCACCCATGG + Intergenic
1142478546 17:204365-204387 GTGGGTGGGTGGAGGACAGATGG - Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142900380 17:3007929-3007951 CCAGGTGTCTGGAGCTCACAAGG + Intronic
1143405834 17:6676734-6676756 ATGGATGGCTGGTGCACAGAAGG + Intergenic
1144376154 17:14644161-14644183 ATAGGTTTCTGGAGCACAGGTGG - Intergenic
1144650835 17:17005757-17005779 GGGGGTCTCTGGAGCAAAGATGG + Intergenic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145092239 17:19995442-19995464 CTTAGTCTCTGGAGCACAGTTGG + Intergenic
1145260177 17:21349867-21349889 CCAGGTGTTTGGAGCTCAGAGGG + Intergenic
1145769006 17:27479114-27479136 CAGGGAGACAGGAGCACAGAGGG - Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146484171 17:33229981-33230003 CTGGGATTCTGGAGCCCAGATGG + Intronic
1147006947 17:37410957-37410979 CTGGGTCTATGGGGCACTGAGGG - Intronic
1147170848 17:38617878-38617900 CAGGGTGTCTGGTGTCCAGAAGG - Intergenic
1147644066 17:42023307-42023329 GTGGGATTCTGGAGAACAGAAGG - Intronic
1148054945 17:44788368-44788390 CTGGCTTTCTGGAGCAGTGATGG - Intergenic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148456283 17:47813215-47813237 TTGGGTGTCTGGGGCAAGGAGGG - Intronic
1148497286 17:48060440-48060462 AGGGGTGGCTGGAGCACGGAGGG - Exonic
1148552453 17:48558597-48558619 CTGGGAGGCTGGAGGACGGAGGG + Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149639058 17:58191486-58191508 CTGGGAGTCTGGAGCAGGCACGG + Intergenic
1150321325 17:64216868-64216890 CTGGGTGTCAGGTGGCCAGATGG + Intronic
1150414754 17:64977701-64977723 CGGGGTGTCTGAAGCATAAAAGG + Intergenic
1150572293 17:66397579-66397601 CTGGGTGCCTGGGTCACAGGTGG + Intronic
1151560405 17:74866667-74866689 CTGGGTGGCATGGGCACAGACGG + Intronic
1151882990 17:76905995-76906017 CTGGGTGGGCGGAACACAGAGGG - Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152285041 17:79407628-79407650 CGAGTTGTCTGGAGGACAGAGGG + Intronic
1152976711 18:228155-228177 GTGGGTAGCTGGAGCAGAGATGG - Intronic
1154172963 18:12063913-12063935 CTGGGGGCCTGGAGCAGAGCAGG + Intergenic
1155410331 18:25537178-25537200 CTGTGTGTGTGTGGCACAGAGGG + Intergenic
1156268755 18:35512123-35512145 CTGGGTGTCAGGAGATCACAAGG - Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156795850 18:41045462-41045484 CTGGGTCTTTGGATCACAGCAGG - Intergenic
1157529852 18:48410694-48410716 ATGTCTGTCTGGAGCGCAGAGGG - Intronic
1157608749 18:48942752-48942774 CTGGCTGCCCGGAGCCCAGACGG - Intronic
1158131420 18:54157042-54157064 CACCGTCTCTGGAGCACAGAGGG - Intronic
1158679619 18:59555421-59555443 CTGGGCTTATGGAGCAGAGATGG - Intronic
1159817907 18:73099915-73099937 CTGGGTGACAGGTGCACTGAAGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160910498 19:1471709-1471731 TTGGGTGGATGGAGCTCAGAAGG + Exonic
1161645818 19:5452759-5452781 CCTGGAGTCTGGTGCACAGAAGG + Intergenic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162421053 19:10566212-10566234 CTGGGTGCCCGGAGCACAGGGGG - Intergenic
1163339559 19:16696471-16696493 CTGGCTATCTGGTTCACAGATGG + Intergenic
1163486620 19:17591385-17591407 CTGGGAGTCTGGAAAACAAAAGG - Intergenic
1164621103 19:29696580-29696602 CTGGGTGTCTGGATGTCAGGTGG - Intergenic
1165330093 19:35136680-35136702 CTGAGTGCCAGGGGCACAGAGGG + Intronic
1165950928 19:39473577-39473599 CTGGGTGTCTGGGGCATTGGAGG + Intronic
1166262258 19:41648567-41648589 CTGGGTGTCTGTCACAGAGATGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
1167099341 19:47394407-47394429 CTGGGTGTGAGGACGACAGAAGG - Intergenic
1167487708 19:49772862-49772884 CTGTGTGGCTGGTGCAGAGAGGG + Intronic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
1168151964 19:54454095-54454117 ATGGGTGTCTTGTGCTCAGATGG + Intronic
1168618414 19:57856738-57856760 CTGGGAGCCTGGAGCAAAGCAGG - Intronic
1168625088 19:57911869-57911891 CTGGGAGCCTGGAGCAAAGCAGG + Intronic
925131681 2:1498237-1498259 GTGGGTCTCTGGTGCACACAGGG - Intronic
926135530 2:10333033-10333055 CTGGATGTGTGGGGCACAGTGGG + Intronic
926358607 2:12064311-12064333 CAGGGCTTCGGGAGCACAGAGGG - Intergenic
926814761 2:16789328-16789350 CTGGGGGTCTGGATCTCACAGGG - Intergenic
926980955 2:18567493-18567515 CTGTGTGTCTGCTGCAGAGAAGG - Intronic
927481360 2:23456815-23456837 CTGGGTGACTGGACCCCACAAGG - Intronic
927560567 2:24069524-24069546 CTGGGTGGTTGGAACACAGATGG - Intronic
928070114 2:28206571-28206593 CTGGGTGAGTGGAGCACTGGTGG - Intronic
928433631 2:31239786-31239808 CGCGGTGCCTGGAGCACAGCTGG - Intronic
929271414 2:39976564-39976586 CAAGGCCTCTGGAGCACAGAAGG - Intergenic
929824288 2:45298338-45298360 TTGGTTGCCTGGAGGACAGAGGG + Intergenic
929985798 2:46730946-46730968 GTGGGGGTTTGGAGCACAGCAGG + Intronic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
930612270 2:53555640-53555662 CCGGGTGTCTGCAGGGCAGAGGG + Intronic
930847698 2:55923568-55923590 CAGGGTGTCTCGGGCAGAGAGGG - Intronic
930864331 2:56107970-56107992 CTGGGTGTTGGGATCACTGATGG + Intergenic
932306136 2:70705373-70705395 CTGGCTCTCTGGAGCCCAGAAGG + Intronic
932419423 2:71592676-71592698 CCGGGTGTCTGGGGCAGAGAGGG + Intronic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
932556059 2:72825770-72825792 CCGGGTGCCGGGACCACAGAGGG - Intronic
932699068 2:73981292-73981314 CTGGATGCCTGGAGCATGGAGGG - Intergenic
933354391 2:81195464-81195486 AGGGGTGTCGGGGGCACAGAGGG + Intergenic
934602457 2:95667987-95668009 CTGGCTGTGTGGAACAGAGAGGG + Intergenic
936535826 2:113310141-113310163 CTGGCTGTGTGGAACAGAGAGGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937121775 2:119445384-119445406 CTGGAGGTCTGGGGCACTGACGG + Intronic
937229671 2:120390344-120390366 CTGCAGGTCAGGAGCACAGAGGG + Intergenic
937366201 2:121263845-121263867 CTGGGTGCCTGGGGCAGAGGTGG + Intronic
938310477 2:130285748-130285770 CTGGGGGCCTGGAGCAGAGCAGG - Intergenic
938312623 2:130302796-130302818 CTGGGGATCTGGAGCACTGCAGG + Intergenic
938444452 2:131366619-131366641 CTGGGGGCCTGGAGCAGAGCAGG + Intergenic
939429837 2:142089061-142089083 AAGGGTGTCTGGAACATAGAAGG - Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941422528 2:165300671-165300693 CTGAGTGGCTGGAGCAGAGTGGG + Intronic
941997714 2:171616535-171616557 CTAGTTTTCTGGAGCACAGGTGG - Intergenic
942910709 2:181241063-181241085 CTGGGTTTGAGGAGCACAGCAGG - Intergenic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
948018491 2:234710060-234710082 CGAGGTGGCAGGAGCACAGAAGG - Intergenic
948029942 2:234809294-234809316 ATGGGTGGCAGGAGCAAAGAAGG + Intergenic
948130728 2:235598758-235598780 CTGTGTGTTTGGTGCACAGTGGG + Intronic
1169029159 20:2394850-2394872 CTGGGTGTCTGGTACACACAGGG - Intronic
1171336811 20:24392764-24392786 CTGGGTGTCAGAAGCAGACAAGG - Intergenic
1172600209 20:36178031-36178053 CTGGCTGTCAGCATCACAGAAGG - Exonic
1173328941 20:42058319-42058341 CTGGGTCCCTGGAGCCCAGGTGG + Intergenic
1174078156 20:47952578-47952600 CTGGCTGTTTGTGGCACAGAAGG - Intergenic
1174578866 20:51556806-51556828 CTGGGTGGCTGAAGCCCAGCTGG - Intronic
1175676669 20:60952005-60952027 GAGGGTGTCTGATGCACAGAAGG + Intergenic
1175699008 20:61123850-61123872 ATGGGTGGCTGGAGCCTAGAAGG - Intergenic
1176028078 20:62996316-62996338 CAGTGTGTCTGGACCACAGCAGG + Intergenic
1176660981 21:9634738-9634760 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1176715651 21:10347095-10347117 CTGAGTCTCTTGAGCATAGAAGG - Intergenic
1178571450 21:33741100-33741122 TTAGGGGTCTGCAGCACAGATGG + Intronic
1179934787 21:44595570-44595592 CTGGGTGTCCGGAGCTCAGAAGG - Intronic
1180602693 22:17032858-17032880 CTGAGTCTCTTGAGCATAGAAGG + Intergenic
1181855816 22:25780750-25780772 CTGAAAGTCTGAAGCACAGACGG - Intronic
1181866139 22:25857004-25857026 CTGGGTGTCTAGAGGAGACAGGG - Intronic
1181944938 22:26509198-26509220 CTTGGGGGCTGGAGCAGAGAGGG - Intronic
1182304090 22:29356096-29356118 CTGGGTGTCTGGGGCTCTGCCGG - Intronic
1182687579 22:32132814-32132836 CTGGGTGTCTGGGGCTCTGCCGG + Intergenic
1183475107 22:38031795-38031817 CTGGGTCACTGGAGAACAGTGGG - Intronic
1183960667 22:41410190-41410212 GTGGGAGTCTGAAGCCCAGATGG - Intergenic
1184109043 22:42384490-42384512 CTGGGGGCATGGAGCAGAGAGGG - Exonic
1184277600 22:43419070-43419092 CTGGGCTGCTGGAGCACTGAAGG - Intronic
1184355755 22:43978528-43978550 AGGGGTGGCTGGAGGACAGAGGG + Intronic
1185338809 22:50282667-50282689 CTGGGTGTGGGGAGCAGAGGGGG + Intronic
949335845 3:2974509-2974531 ATGGCAGTCTGGAGCCCAGAGGG + Intronic
949534545 3:4985965-4985987 CTGGTTGTCTGGAGTACAGCAGG + Intergenic
950130742 3:10544689-10544711 CTGGGGCTCTTGAGCACAGGTGG - Intronic
950175064 3:10867513-10867535 CTGGGTATCAGGTTCACAGAAGG + Intronic
950284924 3:11737110-11737132 TTGGGTGGCTGAAGAACAGATGG - Intergenic
950708402 3:14797976-14797998 CAGGGCCTCTGGAGCACACAGGG - Intergenic
951931225 3:27969178-27969200 CTGTGTGGTTGGAGCAGAGAGGG - Intergenic
952817276 3:37456541-37456563 CAGGGCGTCTGGGGCAGAGAAGG - Intronic
952971207 3:38651300-38651322 TGGGGTGTCTGGGGTACAGACGG + Intergenic
953137534 3:40195380-40195402 GAGGGTCTCTTGAGCACAGAAGG - Intronic
954258118 3:49420181-49420203 CAAGGTGTCTAGAACACAGAGGG + Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
955214121 3:56970985-56971007 CTTAGTGACTGGAGCACAGAAGG + Intronic
955648181 3:61163401-61163423 TTAGGTGTCTGGCACACAGAAGG + Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
959403875 3:105936842-105936864 ATGAGTGACTGGAGCACAGAGGG - Intergenic
959644585 3:108683539-108683561 CTTGCTGGCTGGAGCAGAGAAGG - Intronic
960059268 3:113303205-113303227 CTGGGTCTCTGGGTTACAGAGGG - Intronic
960944822 3:122958668-122958690 CTGGGGGACTGGGGCCCAGAGGG + Intronic
961075317 3:123976770-123976792 CTGACTGTCAGGAGAACAGAGGG + Intronic
961201372 3:125048379-125048401 CAGGGTGTCTGGATCACCCAGGG - Intronic
961607490 3:128107555-128107577 CTGGGTTTCTGGGGTAGAGAAGG - Intronic
961860756 3:129915519-129915541 CAGGGTGTGAGGAACACAGATGG - Intergenic
962249136 3:133824363-133824385 TTGGCTGTGAGGAGCACAGAGGG - Exonic
963364159 3:144313344-144313366 CTGGGTGTCTACAGGAAAGAAGG - Intergenic
964375934 3:156049102-156049124 CTTCGGGTCTGGAGCACAGCAGG + Intronic
966294348 3:178401775-178401797 CTGAATGTCTGAATCACAGAAGG + Intergenic
966839394 3:184076542-184076564 CTGCCTGCCTGGAGCCCAGAAGG + Intergenic
967408009 3:189138765-189138787 CTTTGTGTCTGGAGAACAGGAGG + Intronic
968313512 3:197703493-197703515 CTGGGTCCCTGGAGCTCAGCAGG - Intronic
968516191 4:1016632-1016654 CTGGGGGCCTGCAGCACAGGTGG - Intronic
968619524 4:1597516-1597538 CTGGGGGTCTGGAGCAGGCAGGG - Intergenic
968984584 4:3868219-3868241 CTGCGTGTGTGGAGCTCACAGGG + Intergenic
970034269 4:11714697-11714719 CTGGTGGTCTGCAGCACAGTAGG - Intergenic
970380142 4:15499118-15499140 CTGAATGGGTGGAGCACAGAAGG + Intronic
970510968 4:16781443-16781465 GAGGGAGTCTGGAGGACAGAAGG + Intronic
972333571 4:38085509-38085531 CTGGGGGACTGGAACCCAGAAGG + Intronic
973040141 4:45459769-45459791 CTGGGAGTTCAGAGCACAGAGGG + Intergenic
973638799 4:52883951-52883973 TTGGGTGTCTGGAGACCAGCAGG + Intronic
975238829 4:72032387-72032409 CTGGATGTCTGCACCACAGATGG + Intronic
975683028 4:76895881-76895903 CTTGGTGTCTGGAGCAAAGAAGG - Exonic
976672128 4:87665535-87665557 CTGGGTGCCTGAGGCACAGGTGG + Intergenic
980736403 4:136895250-136895272 CTGAGAATCAGGAGCACAGAGGG - Intergenic
981828401 4:148971715-148971737 CTGGGTGTTTGGATCTCAGTAGG - Intergenic
982735265 4:158999625-158999647 CTGGGTGTCTTAAGTAGAGAAGG - Intronic
983412632 4:167419313-167419335 CTGGGAATCTGAAGCACAAAAGG + Intergenic
983722334 4:170871085-170871107 CTGGGAGTCTGGGGCACGCAGGG + Intergenic
985631305 5:1015483-1015505 CTGGGTCCCTGGAGCTCTGAAGG + Intronic
986526866 5:8688445-8688467 CTGGGGGTCAGGAGCTCAGCTGG + Intergenic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991925870 5:71704429-71704451 CAGGGACTCTGGACCACAGATGG + Intergenic
992011796 5:72534869-72534891 GCAGGTGTCTGGAGCATAGATGG + Intergenic
992024219 5:72654564-72654586 CTGGGCCTCTGGAGCAGAGCTGG + Intergenic
992169922 5:74091526-74091548 CTGGTGTTCTGTAGCACAGATGG - Intergenic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
995497744 5:112765445-112765467 GTGAGTGACTGGAGCAAAGACGG - Intronic
996695133 5:126385963-126385985 CTGGGTCTCTGGAGCAGAGAGGG + Intronic
997015053 5:129923006-129923028 CTTGATGGCTGGAGCATAGAAGG + Intronic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
1000166759 5:158657314-158657336 CAGGGTGGCTGGACCACAGATGG - Intergenic
1001100309 5:168808836-168808858 CAGGGTGTTTGAAGTACAGATGG + Intronic
1001929899 5:175665425-175665447 CTGGATGCCTGGAGCACAGAGGG + Intronic
1001936303 5:175708237-175708259 CTGGGAGTCATGAGCAGAGACGG + Intergenic
1002108243 5:176890973-176890995 CTGGGTGGCTAGGGCTCAGATGG - Intronic
1002193718 5:177491525-177491547 CTGAGTGTCTGGGGCTCAGCTGG + Intronic
1002857659 6:1052435-1052457 CAGGGTGTCTCGGGCAAAGAAGG - Intergenic
1003890635 6:10560914-10560936 CTGTGTGGCTTGTGCACAGATGG + Intronic
1003942071 6:11039308-11039330 CTGTGTGCCTGGTGAACAGAGGG - Intronic
1005732303 6:28709878-28709900 CTGTGTTCCTGGAGCACAAAAGG - Intergenic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006740142 6:36302208-36302230 CTGGGTGGCTTGTGCACAGCTGG - Exonic
1006750187 6:36372188-36372210 GTGGGTATCTAGAGCAGAGAGGG + Intronic
1008583746 6:52930147-52930169 CTTTGTGTCTGAAGCACTGATGG - Intergenic
1011000648 6:82584354-82584376 CTGGGGGCCTGCAGCAGAGAGGG + Intergenic
1012660627 6:101886044-101886066 CTGAATATGTGGAGCACAGAAGG - Intronic
1014188837 6:118468018-118468040 CTTAGTGTCTGGACCATAGAAGG + Intronic
1015200759 6:130577619-130577641 CTGGGTGTCAGGGACAGAGAGGG - Intergenic
1015635612 6:135271168-135271190 CTGGGTGTGTGCAGCAATGAAGG - Intergenic
1016873781 6:148844557-148844579 CTGAGTGGCTGGAGCAGACAGGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019007901 6:168817962-168817984 CTGGGTTTCTGGACCTGAGATGG + Intergenic
1019409444 7:900234-900256 CGGGGTGAGGGGAGCACAGAGGG - Intronic
1019686546 7:2384991-2385013 CTGGGTGGCTGCAGCTCAGCAGG + Intergenic
1021033230 7:15764434-15764456 CTGGGTGCCTGGAGTTCAGCTGG + Intergenic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021490609 7:21216207-21216229 CTGGGTGTCAGGATTTCAGATGG + Intergenic
1022783134 7:33606590-33606612 CTTAATGTCTGGAGCAGAGAGGG + Intergenic
1024078931 7:45839629-45839651 CTGGGATTTTGTAGCACAGAGGG - Intergenic
1026087617 7:67275455-67275477 CTGGGTTTCTGGGTCCCAGAAGG + Intergenic
1026726615 7:72874776-72874798 CTGGGTTTCTGGGTCCCAGAAGG - Intergenic
1026748484 7:73031234-73031256 CTGGGTTTCTGGGTCCCAGAGGG - Intergenic
1026752132 7:73059379-73059401 CTGGGTTTCTGGGTCCCAGAGGG - Intergenic
1026755783 7:73087506-73087528 CTGGGTTTCTGGGTCCCAGAGGG - Intergenic
1027034685 7:74916539-74916561 CTGGGTTTCTGGGTCCCAGAGGG - Intergenic
1027091617 7:75305884-75305906 CTGGGTTTCTGGGTCCCAGAGGG + Intergenic
1027095260 7:75333850-75333872 CTGGGTTTCTGGGTCCCAGAGGG + Intergenic
1027117225 7:75490834-75490856 CTGGGTTTCTGGGTCCCAGAAGG + Intergenic
1027274584 7:76544768-76544790 CTGGGTTTCTGGGTCCCAGAAGG - Intergenic
1027309341 7:76937867-76937889 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
1027324078 7:77033819-77033841 CTGGGTTTCTGGGTCCCAGAGGG - Intergenic
1027624084 7:80526956-80526978 CTGGGTGTCTGGGGTAGAGTGGG + Intronic
1029395368 7:100304590-100304612 CTGGGTTTCTGGGTCCCAGAGGG + Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1029619989 7:101684407-101684429 ATGACTGGCTGGAGCACAGAGGG + Intergenic
1029637368 7:101793970-101793992 CTGGAGGGCTGGAGCACTGATGG + Intergenic
1029720278 7:102359225-102359247 CTGGGTTTCTGGGTCCCAGAAGG - Intergenic
1030028293 7:105346384-105346406 CATGGTGACTGGAACACAGAGGG + Intronic
1031433146 7:121697984-121698006 CTGTGTCTCTGGAGTACACATGG - Intergenic
1031863564 7:127012209-127012231 CTGGGTTATTGGAACACAGATGG - Intronic
1032792747 7:135254382-135254404 CTGTGTGTCTGTAGGACAGCTGG - Intronic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033586157 7:142775906-142775928 CCACATGTCTGGAGCACAGATGG - Intergenic
1034526878 7:151670211-151670233 CTGGGGGTATGGAGCAGAGGAGG - Intronic
1035470994 7:159108623-159108645 CTGGGCGCCTGGTGCCCAGATGG + Intronic
1035599777 8:890801-890823 CAGGGTGGCTTGGGCACAGAGGG - Intergenic
1035795791 8:2355528-2355550 CTGGGAGTGAGGCGCACAGAGGG + Intergenic
1035795812 8:2355608-2355630 CTGGGAGTGAGGCGCACAGAGGG + Intergenic
1035795832 8:2355688-2355710 CTGGGAGTGAGGTGCACAGAGGG + Intergenic
1035795872 8:2355844-2355866 CTGGGAGTGAGGTGCACAGAGGG + Intergenic
1037473793 8:19237234-19237256 CTGGGCGTCTGGAGCACACCGGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038438973 8:27558622-27558644 ATTGGTGGCTGTAGCACAGATGG - Intergenic
1039264539 8:35809852-35809874 GTGGTTGTTTGGAGCAAAGAAGG - Intergenic
1040007815 8:42635649-42635671 CTGGGTGTCTGTGGGACAGAAGG - Intergenic
1044677904 8:94748242-94748264 GTAGGTGTCTGGAATACAGATGG - Intronic
1045482066 8:102600717-102600739 CTGGGTGTCTGTGGCAGGGACGG - Intergenic
1045799042 8:106080263-106080285 CTGGGTGCCAGGAGTAGAGAAGG - Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046522996 8:115349625-115349647 CTGGGTGTCTGAGGAACATACGG + Intergenic
1046969223 8:120202794-120202816 TTGGGTGTCTGGAATACAGCAGG - Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1048016996 8:130506593-130506615 CTGGCTGTCAGAGGCACAGAAGG + Intergenic
1048453367 8:134554145-134554167 CTGGGAGTCAGGAGCAAGGAGGG - Intronic
1048744667 8:137600569-137600591 CTGAGTGTCAAGAGAACAGAAGG + Intergenic
1049216180 8:141409415-141409437 CTGGGTGCCGGGTCCACAGATGG - Intronic
1049265938 8:141667961-141667983 GAGTGCGTCTGGAGCACAGATGG + Intergenic
1049606222 8:143530355-143530377 CTGGGTGGGTGAAGCAGAGAGGG + Intronic
1049645735 8:143734871-143734893 CTGGGGGACTGGAGCACCCAGGG - Intergenic
1049802263 8:144523352-144523374 CTGGGTGCCTGGATCAAGGAGGG - Exonic
1050625601 9:7500785-7500807 CCGGGTCTCTGCAGCAGAGAAGG + Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1052084268 9:24245180-24245202 CTTGGTGCCTGGAACACACAAGG - Intergenic
1052866303 9:33466505-33466527 CTGGGTGACTGGAGCAGAGGTGG + Intronic
1053265971 9:36713914-36713936 CTGCGTGTCTGCAGGACGGATGG + Intergenic
1053924678 9:43040602-43040624 CTGGCTCTCAGGAGCACAAAAGG - Intergenic
1055024338 9:71703318-71703340 CTGTGTGGGTGGGGCACAGAGGG + Intronic
1056404227 9:86258810-86258832 CTGTGTGTATGGTGCAGAGAAGG - Intronic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057837159 9:98454712-98454734 CTGAGTTTCAGCAGCACAGAGGG + Intronic
1057872815 9:98731027-98731049 CTGCGTGTCGTCAGCACAGAGGG - Intergenic
1059512422 9:114861903-114861925 CTGGGGGTATGGAGAACATAGGG - Intergenic
1059550984 9:115228587-115228609 CTGCATGTCTAGAGCAGAGAAGG - Intronic
1060629188 9:125140767-125140789 CTGGGTGGCTTGAGCCCAGGAGG + Intronic
1061204711 9:129156271-129156293 CTGGGTGTCTGGAGCTGGGGCGG + Intergenic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061826356 9:133260716-133260738 CACGTTGGCTGGAGCACAGAGGG + Intronic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1203638550 Un_KI270750v1:136582-136604 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1187225240 X:17369742-17369764 CTGGGTGTTTTCATCACAGAAGG + Intergenic
1192565667 X:72161328-72161350 GTGGGTGACTGGAGCAGAAAGGG - Intergenic
1192876084 X:75230824-75230846 CTGGGTGGCTAGACCAAAGAAGG + Intergenic
1194243526 X:91480675-91480697 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1198018591 X:132636005-132636027 CAGGGCGTCTGGAGCAGAGAAGG - Intronic
1198531310 X:137551295-137551317 TGGGGTGTGTGGAGCAGAGAGGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198657188 X:138927293-138927315 ATGGGTCTATGGAGCACAGTTGG - Intronic
1199828797 X:151528253-151528275 CAGTGTGTCTGGGGCAGAGAGGG + Intergenic
1199912991 X:152307909-152307931 CTGCCTTTGTGGAGCACAGAGGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200562507 Y:4722050-4722072 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1200688588 Y:6281128-6281150 CAGGGTGACTGGAGCATAGCTGG + Intergenic
1201046685 Y:9893560-9893582 CAGGGTGACTGGAGCATAGCTGG - Intergenic
1201966909 Y:19747720-19747742 GTGGGTGAGTGGAGCACAGGAGG - Intergenic