ID: 1104664284

View in Genome Browser
Species Human (GRCh38)
Location 12:130636285-130636307
Sequence TGGTGCTCAAGAGTGCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104664284_1104664288 12 Left 1104664284 12:130636285-130636307 CCTACTGGCACTCTTGAGCACCA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1104664288 12:130636320-130636342 ATTTCCTAACTACCTATTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 152
1104664284_1104664287 9 Left 1104664284 12:130636285-130636307 CCTACTGGCACTCTTGAGCACCA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1104664287 12:130636317-130636339 CTAATTTCCTAACTACCTATTGG 0: 1
1: 0
2: 0
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104664284 Original CRISPR TGGTGCTCAAGAGTGCCAGT AGG (reversed) Intronic
903911402 1:26728800-26728822 GTGTGCTCTGGAGTGCCAGTAGG + Intronic
904352869 1:29920345-29920367 TGGGGCTGAAAAGTGCCAGTTGG - Intergenic
912522089 1:110252487-110252509 CTGTGCTCAAGACAGCCAGTGGG - Intronic
913223828 1:116681105-116681127 TGGGGATCAAGAGTGTCAGTAGG + Intergenic
913962311 1:143349824-143349846 TGGTAGTTGAGAGTGCCAGTGGG + Intergenic
914056667 1:144175400-144175422 TGGTAGTTGAGAGTGCCAGTGGG + Intergenic
914122479 1:144790962-144790984 TGGTAGTTGAGAGTGCCAGTGGG - Intergenic
915163324 1:153934257-153934279 TGGCGCTGAAGAGGGCGAGTAGG + Exonic
915341009 1:155176789-155176811 TGGTGCTCCACAGTGCCACCTGG - Intronic
924743518 1:246812146-246812168 TGGAGATCAAGAGTGACAATGGG + Intergenic
1069566386 10:69466085-69466107 TGCAGCTCCAGAGAGCCAGTGGG - Intronic
1070466623 10:76730607-76730629 TGGTGCTGAAGAGGGCCACTTGG - Intergenic
1072705135 10:97675594-97675616 TGGTGCTCAAGAGAGCCTGGGGG + Exonic
1074277491 10:112018027-112018049 TGGTGCTTTAGAGTAACAGTTGG - Intergenic
1075020987 10:118952297-118952319 TAGTGCTCAAAAGTACCAGTCGG - Intergenic
1075791082 10:125084777-125084799 TGGTGGGAAAGAGTGCCGGTGGG - Intronic
1076564723 10:131390324-131390346 TGGTGCTCAGGAGTCCAGGTGGG - Intergenic
1080396323 11:31893543-31893565 TAGTGCTAAAGAAGGCCAGTAGG - Intronic
1083470276 11:62879754-62879776 TGTTCCTAAACAGTGCCAGTTGG - Intronic
1083636293 11:64122709-64122731 TGGTGCTCCAGAGGCCAAGTGGG + Intronic
1083680277 11:64348543-64348565 TGGTGGCCAAGAGTGTCAGGAGG + Intronic
1086433784 11:86761868-86761890 TGGTCCTCAGGAATGCCATTGGG - Intergenic
1089124292 11:116165451-116165473 AGGTCATCAAGAGTGGCAGTAGG - Intergenic
1091795896 12:3297425-3297447 TGATTCTCAGGAATGCCAGTGGG - Intergenic
1093117911 12:15234205-15234227 TGGTGCTCTAGGGTGAGAGTAGG - Intronic
1095992957 12:48050678-48050700 TGGTGCTAAAGACTGCCTCTAGG + Intronic
1099743375 12:86669620-86669642 TGGTGCTCATGTCTGCCACTGGG + Intronic
1103564882 12:121810568-121810590 TGGTGCCAAAGGGGGCCAGTGGG - Exonic
1104664284 12:130636285-130636307 TGGTGCTCAAGAGTGCCAGTAGG - Intronic
1106148623 13:27075723-27075745 GGGTGCTCAAGAGTGGTAGAGGG + Intronic
1107277217 13:38690180-38690202 TAGGACTCCAGAGTGCCAGTAGG - Exonic
1112687637 13:101849796-101849818 TGGTGCTCATGACTCCCAGGAGG - Intronic
1113973669 13:114210682-114210704 TGGTGCTCAGGAGTGACAACAGG - Intergenic
1117338529 14:54775045-54775067 TGGTGCCCAAGAGGCCCAGGCGG - Exonic
1119652469 14:76393313-76393335 TGGTGGGCAAGACTGCAAGTAGG - Intronic
1120835581 14:89035944-89035966 CGGTGCTCAACAGTCCCAGACGG - Intergenic
1122598072 14:102907292-102907314 TGGTGGTCAGGAGCGCCCGTTGG - Exonic
1125312016 15:38390097-38390119 TGGTGCACATGAGTGTAAGTGGG - Intergenic
1126908210 15:53389927-53389949 TGGTGCTCCACAGTGGGAGTGGG + Intergenic
1127360984 15:58245107-58245129 AGGTGCCCAAGAGTTCCAGCAGG + Intronic
1128271845 15:66317122-66317144 AGGTGATCAAGAGTGACAGAGGG - Intronic
1132089794 15:98938942-98938964 TGGTCCTAAAGAGTGCAAATTGG + Intronic
1138224906 16:55284809-55284831 TGGTACTCCAGAGTGCTGGTTGG - Intergenic
1139275866 16:65727134-65727156 TGGAGCTCAAAACTGCCAGTTGG - Intergenic
1140456415 16:75108177-75108199 TGGTGGTGGAGAGGGCCAGTTGG - Exonic
1141732068 16:85829566-85829588 TGGTGCCCAAGCGTGCCCGGAGG - Intergenic
1146000167 17:29126167-29126189 TGGTGCTCAAGATAGGCAGGTGG - Intronic
1157651118 18:49332400-49332422 TGGAGTTCAAGAGTTCAAGTGGG - Intronic
1157805454 18:50654660-50654682 TGGTCCACAAGTGTGCCAGGGGG - Intronic
1160261318 18:77296854-77296876 TGCTGCTTAAAAGTGCCCGTTGG + Intergenic
1161475054 19:4480125-4480147 TGGTCATCAAGATTACCAGTGGG - Intronic
1163887024 19:19975034-19975056 AGGTACTCAAGAGTGGCAGCAGG + Intergenic
1164757563 19:30701853-30701875 TGGTCCTCATGACTGTCAGTAGG - Intronic
1164892697 19:31838648-31838670 TGTTCCTCCAGAGTGCCTGTGGG + Intergenic
1166200417 19:41233920-41233942 TAGGGCTGAAGAGTTCCAGTGGG + Intronic
1166420155 19:42630413-42630435 TGCTGCTGCAGGGTGCCAGTGGG + Intronic
1202696148 1_KI270712v1_random:128083-128105 TGGTAGTTGAGAGTGCCAGTGGG + Intergenic
931965266 2:67526422-67526444 TGTAGCTCAAGTGTTCCAGTTGG - Intergenic
938927327 2:136055869-136055891 TGCTGCTGCTGAGTGCCAGTGGG + Intergenic
940542546 2:155039647-155039669 TGGTGTTCAATAATACCAGTCGG + Intergenic
941306876 2:163880591-163880613 AAGTGCTCAAGAGTACCACTTGG - Intergenic
947984434 2:234436748-234436770 TGGTGCCTAAGGGTTCCAGTGGG - Intergenic
948883660 2:240872675-240872697 TGGTGCTGAAGAGGGTCAGCCGG - Intronic
1169539041 20:6580299-6580321 TGGTGCTCCAGGGAGCCATTGGG - Intergenic
1170432562 20:16290005-16290027 TGATTCTCAAAAGTGCCATTTGG + Intronic
1175304073 20:57964073-57964095 TGGTTCTCGAGAGCGGCAGTGGG - Intergenic
1175360452 20:58406084-58406106 TGGGACTCAAGAGTGCCGTTTGG + Intronic
1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG + Intronic
1177227770 21:18279931-18279953 GGGTGCTTAAGGGTGCCAGTTGG - Intronic
1178549956 21:33528515-33528537 TGGTGATCCAGAGTGCCAAGTGG - Exonic
1184628274 22:45755027-45755049 TGGTGCTCAGGAAAGCCAGGTGG + Intronic
952180365 3:30910409-30910431 TTGTTCTCAAAGGTGCCAGTGGG - Intergenic
954035033 3:47846832-47846854 TGGTGCTCATGAGTGCCACAGGG + Exonic
959125134 3:102282136-102282158 TGGTGCTTAAGAGTGTTAGCTGG + Intronic
959936280 3:112032588-112032610 TTGTGCTCAAGAGGGCCACGTGG - Intergenic
963163868 3:142180859-142180881 TGCTGCTCAAGAGTGAGACTAGG - Intronic
974283878 4:59838440-59838462 TGGGGCTCAAGATGGCCAGGTGG - Intergenic
974681533 4:65170205-65170227 TGGTGGTCAATAGTAACAGTAGG + Intergenic
978322056 4:107507880-107507902 TGGTGATCAAGAGTGCCTAGAGG - Intergenic
979000697 4:115214589-115214611 TTCTTCTCAAGAGTACCAGTTGG - Intergenic
980845546 4:138319952-138319974 TGGTTGTCCAGAGTGCCTGTGGG + Intergenic
984710868 4:182883345-182883367 TGGTGGTGAAGAGTGCACGTGGG - Intergenic
988992365 5:36684043-36684065 TGGTGCCCTAGAGTGACAGAGGG - Intronic
990278519 5:54225510-54225532 GGGTGGTGAAGAGTGACAGTAGG + Intronic
999120280 5:149204398-149204420 TGGTGGTCAAGAGTGAAAGGAGG + Intronic
1006434265 6:34018103-34018125 TGGTGCTGGTGAGTGGCAGTGGG - Intergenic
1007239345 6:40413886-40413908 TGGTGGTTCTGAGTGCCAGTAGG + Intronic
1007782334 6:44261774-44261796 TGGTGCTGAAGGGGGCCAGCCGG - Exonic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1012319823 6:97829290-97829312 TGGTGCTCAGCAGTGTCAGAAGG - Intergenic
1013836898 6:114343570-114343592 TGTGGCTCCAGAGTGCCAGGCGG + Intergenic
1016376876 6:143430294-143430316 TGCTGCTCAGGAGAACCAGTTGG + Intronic
1021878735 7:25073172-25073194 TGGTTACCAAGAGTGACAGTAGG - Intergenic
1023783615 7:43683159-43683181 TTGTTCTCAAGAGTATCAGTTGG - Intronic
1028872736 7:95786925-95786947 TGATGCTCAAGAGTGTCACCGGG - Intronic
1030121933 7:106118666-106118688 AGCTGCTCAAGAGAGGCAGTTGG + Intergenic
1032106027 7:129030832-129030854 TGCTACTCAAGAGTGCCCCTTGG + Intronic
1041116943 8:54549032-54549054 TAGTGCTCAAGAGTGAGAGGAGG - Intergenic
1043327622 8:79071891-79071913 TGGGGCTCAAGGCAGCCAGTTGG - Intergenic
1043542440 8:81279659-81279681 TGGTGCTCCCGGGTGCCTGTTGG - Intergenic
1044427785 8:92073228-92073250 TGGTCCTCTAGAATGCCATTTGG - Intronic
1046664217 8:116981254-116981276 TGGTGCTCTAGAGAACCAGGTGG + Intronic
1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG + Intergenic
1055058031 9:72041459-72041481 TGGTTCTCAACAGTGGGAGTTGG - Intergenic
1057685814 9:97233291-97233313 TGATGCTCAGGACAGCCAGTGGG - Intergenic
1190928026 X:54926044-54926066 TGAAGCGCAAGAGTGTCAGTGGG + Intronic
1191171730 X:57454148-57454170 TGGCGCTTAAGAGTGCTAGCAGG - Intronic
1192312519 X:70028363-70028385 TGGTTCACAGGAGTTCCAGTGGG + Intronic
1196013938 X:110917573-110917595 TGGTACTCAAGTGTGGCTGTAGG + Intergenic
1197820405 X:130535840-130535862 AGCTGCTCAAGAGAGGCAGTTGG - Intergenic
1198632899 X:138661442-138661464 TGGTGCTTTGGAGTTCCAGTGGG + Intronic
1199897164 X:152136771-152136793 GGGTTCTCCAGAGTGACAGTAGG + Intronic