ID: 1104664290

View in Genome Browser
Species Human (GRCh38)
Location 12:130636332-130636354
Sequence GTTCTGTGAGGACCACCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104664290_1104664296 26 Left 1104664290 12:130636332-130636354 CCTATTGGTGGTCCTCACAGAAC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1104664296 12:130636381-130636403 TATGTATCTTATTTACCAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 141
1104664290_1104664294 0 Left 1104664290 12:130636332-130636354 CCTATTGGTGGTCCTCACAGAAC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1104664294 12:130636355-130636377 TAGAACCACGTGGAGATTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 103
1104664290_1104664293 -3 Left 1104664290 12:130636332-130636354 CCTATTGGTGGTCCTCACAGAAC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1104664293 12:130636352-130636374 AACTAGAACCACGTGGAGATTGG 0: 1
1: 0
2: 1
3: 6
4: 90
1104664290_1104664292 -10 Left 1104664290 12:130636332-130636354 CCTATTGGTGGTCCTCACAGAAC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1104664292 12:130636345-130636367 CTCACAGAACTAGAACCACGTGG 0: 1
1: 0
2: 1
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104664290 Original CRISPR GTTCTGTGAGGACCACCAAT AGG (reversed) Intronic
903288014 1:22289096-22289118 GTTCTGTGAATACCACCCACTGG + Intergenic
906685919 1:47763256-47763278 GATCTCTGAGGACCACCAGCTGG - Exonic
907045243 1:51296588-51296610 GATGTGTGTGGACTACCAATAGG + Intronic
909659817 1:78069329-78069351 GTCCTGTCAGGCCCACCCATAGG + Intronic
912276933 1:108268914-108268936 GTTCTCTGAGGGCCATTAATAGG + Intergenic
912291295 1:108425442-108425464 GTTCTCTGAGGGCCATTAATAGG - Intronic
913198395 1:116476367-116476389 GGTGTGTGAGAACTACCAATGGG - Intergenic
916060745 1:161097099-161097121 GTTCTCTGAGGACCAAGAGTTGG + Intergenic
918848277 1:189647339-189647361 TTTCAGTTAGGACCATCAATAGG - Intergenic
1063418864 10:5895156-5895178 GCTCTGTGAAGACCAGCAAGTGG - Exonic
1068723813 10:60278071-60278093 TTTCTAAGAGGAACACCAATAGG - Intronic
1070270370 10:74948252-74948274 GTTCTATGAGGACAAGCACTTGG + Intronic
1072849757 10:98876362-98876384 GTTCTGGTAGGGCCACCAAGAGG + Intronic
1074201504 10:111240140-111240162 GTTCTGACAGTCCCACCAATGGG - Intergenic
1086787019 11:90981409-90981431 ATTCTGTGAAGAACATCAATGGG + Intergenic
1087426170 11:97989635-97989657 ATTCTCTGGGGACTACCAATAGG + Intergenic
1089430303 11:118418107-118418129 GTACTGTGAGGAGCAGGAATAGG + Intronic
1089627482 11:119760835-119760857 GTTCTGTGAGGAACGTCAAGGGG + Intergenic
1092257579 12:6935946-6935968 GTTTTGTCTGGACCCCCAATGGG + Exonic
1098301300 12:69056618-69056640 GGACTGTGAGGTCCACCAGTAGG + Intergenic
1103565838 12:121814807-121814829 GTTCTTTGAGGACCACCAGCAGG - Exonic
1103897468 12:124282888-124282910 ATTCTGTGAAGACCATCAACAGG + Intronic
1104664290 12:130636332-130636354 GTTCTGTGAGGACCACCAATAGG - Intronic
1107771367 13:43790048-43790070 CTTCTCTGATGACCACCAAAGGG + Intergenic
1109423081 13:62138364-62138386 CTTCTGTGAGGCCCACAAAGGGG + Intergenic
1112426023 13:99302009-99302031 GTGCTGAGATGATCACCAATTGG + Intronic
1125520433 15:40345184-40345206 GTGCTCTGAGGACCACGAATAGG - Intergenic
1130927564 15:88396836-88396858 GTCCTTTGAAGACCTCCAATTGG - Intergenic
1132109043 15:99088752-99088774 GCTCTGTGTGGTCCAGCAATTGG + Intergenic
1132986902 16:2771976-2771998 GTGCAGTGAGGACCCCCAAGAGG - Exonic
1133829063 16:9305054-9305076 GGTCTGTGAGGGTCACCAAGTGG + Intergenic
1134207011 16:12246733-12246755 GTTCTAAGAATACCACCAATTGG - Intronic
1134371385 16:13628893-13628915 GATCTGTGAGGTCCATCCATGGG - Intergenic
1143058967 17:4184256-4184278 CTTCTGTGAGGACCAAAAAAAGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
930859647 2:56057351-56057373 GTTCTGATAGCTCCACCAATTGG - Intergenic
931020588 2:58040578-58040600 CTTCTGTGTGGACCACAACTTGG + Intronic
937598125 2:123695064-123695086 ATCCTATGTGGACCACCAATGGG + Intergenic
938606624 2:132900055-132900077 GTTCTGAGTGCACCACCAACTGG - Intronic
940153764 2:150631116-150631138 GTTCTGTGAGGCAGAACAATAGG - Intergenic
946640286 2:221776449-221776471 GTTCTGAGAGATACACCAATGGG - Intergenic
1170931437 20:20772552-20772574 GTTCTGTGAGAATAACCACTTGG - Intergenic
1173572321 20:44085408-44085430 GCTCCCTGAGGGCCACCAATGGG + Intergenic
1176911544 21:14571090-14571112 GTTCTGTGAAGGCCAATAATAGG - Intronic
949356751 3:3189135-3189157 CTTCTGTGAAGACCAAGAATTGG - Intergenic
953932734 3:47013869-47013891 GTTCTATGAGCAGCACCAAGGGG + Intergenic
956844803 3:73172639-73172661 GTTTTGTGAAAACAACCAATTGG + Intergenic
957809156 3:85195025-85195047 GTTTCGTCAGGACCACTAATTGG - Intronic
962535992 3:136329173-136329195 GTTCTGTGGGGTCCACAATTTGG + Intronic
971132129 4:23823499-23823521 GACCAGTGAGGACCAGCAATTGG - Intronic
971481190 4:27116443-27116465 GTTCTGGGAAGACGACCATTAGG + Intergenic
972823985 4:42735279-42735301 GTTCTGAGAGGAAAAACAATAGG - Intergenic
973801548 4:54483362-54483384 GTCCTGTGAGGATCCACAATAGG - Intergenic
974410854 4:61539423-61539445 GCTCAGTGAGGGCCACCCATAGG - Intronic
975683045 4:76895983-76896005 GTTCTGGGAGGACCCTCAACTGG - Exonic
979697681 4:123632397-123632419 GTTATGGGAGGCCCACAAATAGG - Intergenic
982725148 4:158898364-158898386 GTTCTGTGAAGAACATCCATGGG + Intronic
987315770 5:16721922-16721944 ATACTGTGAGGACCTCGAATGGG - Intronic
987892190 5:23893458-23893480 ATTCTGTGAAGAACATCAATGGG + Intergenic
987919945 5:24266780-24266802 GTTCTGACAGCACCACCAACAGG + Intergenic
988468715 5:31515828-31515850 TATCTGTGAGGACCAACATTAGG - Intronic
988987707 5:36636949-36636971 CTTCTGTGAGGTCCACCTATTGG + Intronic
997635481 5:135400909-135400931 GTTCTGTAGGGACCACCAGGTGG + Intergenic
1000234099 5:159341611-159341633 GTTGTGTGGGGGACACCAATGGG + Intergenic
1000462646 5:161542082-161542104 GTTCTGACAGTTCCACCAATGGG - Intronic
1003848272 6:10196396-10196418 GTTCTGTCAGCAGCACCAGTAGG - Intronic
1005909394 6:30294769-30294791 GTTCTGTGAGCAGCATCTATTGG + Intergenic
1006125415 6:31834791-31834813 TTTCTGTGTGGACAAACAATGGG + Exonic
1008938833 6:57022702-57022724 GTTCTTTGAGGTACACCATTAGG + Intronic
1009976057 6:70672284-70672306 GAACTGTAAAGACCACCAATGGG - Intronic
1014294204 6:119598430-119598452 GTTCTGACTGGCCCACCAATGGG - Intergenic
1016912003 6:149208458-149208480 GTATTGAAAGGACCACCAATGGG + Intergenic
1018298171 6:162371758-162371780 GTTCTGTGATGCCAACAAATTGG + Intronic
1029333385 7:99878946-99878968 GTTCTATGAGGAGCCCCAAGTGG - Intronic
1033634174 7:143193710-143193732 GTCCAGTGAGGACCCCCAACAGG - Intergenic
1033686733 7:143647160-143647182 GTTCTGGGAGGCCCACCACCAGG + Intronic
1033689001 7:143720147-143720169 GTTCTGGGAGGCCCACCACCAGG - Exonic
1033697876 7:143810454-143810476 GTTCTGGGAGGCCCACCACCAGG - Intergenic
1034504545 7:151477138-151477160 GTTCTGTTAGTTACACCAATAGG - Intronic
1036260895 8:7239270-7239292 GTTCTGAGAGGAAGACTAATCGG - Intergenic
1036305710 8:7600261-7600283 GTTCTGAGAGGAAGACTAATCGG + Intergenic
1036312931 8:7697814-7697836 GTTCTGAGAGGAAGACTAATCGG - Intergenic
1036356558 8:8048258-8048280 GTTCTGAGAGGAAGACTAATCGG + Intergenic
1037576210 8:20206240-20206262 GTTCTTTGGGGAACACCTATTGG + Intronic
1038238309 8:25783890-25783912 GTTCTGTTTTAACCACCAATAGG - Intergenic
1039657571 8:39426636-39426658 CATCTGTGTGGACCACCAAAGGG + Intergenic
1044964483 8:97561998-97562020 GTTCTGTGAGCAGCCCCATTAGG - Intergenic
1045390280 8:101708338-101708360 CTTCTGTGATTTCCACCAATTGG + Intronic
1045832012 8:106473315-106473337 GTTGTGTGATGACTACCATTAGG - Intronic
1045910948 8:107409385-107409407 ATTCTGTCAGGTTCACCAATGGG + Intronic
1047698238 8:127425134-127425156 GTTCTATGACTACAACCAATGGG - Intergenic
1048153020 8:131912144-131912166 GTTTTCTGAGGCCCAACAATAGG + Intronic
1052971866 9:34381495-34381517 GTTCTGGGAGGACCCCTAAAAGG - Intronic
1057941943 9:99292787-99292809 GTTCAGGGAGGACCCCCAAGAGG + Intergenic
1060609285 9:124947535-124947557 GTTCTGTGAGGACATCCTAGTGG - Intronic
1062203700 9:135322903-135322925 GGTCTGTGAGGACCACCCTTGGG + Intergenic
1192619700 X:72666174-72666196 GTTTTGTGAGCTCCACCAACTGG + Exonic
1197936726 X:131747243-131747265 GTTCTCTGAGGACTACCTGTTGG - Intergenic