ID: 1104664343

View in Genome Browser
Species Human (GRCh38)
Location 12:130636796-130636818
Sequence TTCAGTTACAGCTTGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 3, 2: 7, 3: 68, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104664343_1104664347 -3 Left 1104664343 12:130636796-130636818 CCCTGGATCAAGCTGTAACTGAA 0: 1
1: 3
2: 7
3: 68
4: 342
Right 1104664347 12:130636816-130636838 GAAGCTGGATACCTACAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 149
1104664343_1104664346 -4 Left 1104664343 12:130636796-130636818 CCCTGGATCAAGCTGTAACTGAA 0: 1
1: 3
2: 7
3: 68
4: 342
Right 1104664346 12:130636815-130636837 TGAAGCTGGATACCTACAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104664343 Original CRISPR TTCAGTTACAGCTTGATCCA GGG (reversed) Intronic
900033330 1:386965-386987 TTCAGGCATGGCTTGATCCAGGG - Intergenic
900054168 1:616854-616876 TTCAGGCATGGCTTGATCCAGGG - Intergenic
901783848 1:11611758-11611780 TTCAGACACAGCTGAATCCAGGG + Intergenic
902200518 1:14830124-14830146 TTCAGGCACAGCTGGATCCAGGG + Intronic
902669887 1:17965880-17965902 TTCAGGCACAGCCTGATCCAGGG - Intergenic
902905570 1:19554268-19554290 TTCAGGTATGGCTGGATCCAGGG - Intergenic
902934441 1:19754619-19754641 TTCAGTCACAGCCTAATCCCAGG - Intronic
904265524 1:29316574-29316596 TTCAGTTGTAGCTGGATCCAGGG + Intronic
905744812 1:40406046-40406068 TTCAATTACAGGTTGAGCCATGG + Intronic
906638808 1:47428691-47428713 TTCAGGCAGAGCTGGATCCAGGG + Intergenic
906845032 1:49182391-49182413 TTCCGTTAAAGATTGATTCAAGG - Intronic
907033602 1:51196511-51196533 TTAAATTACTCCTTGATCCATGG + Intergenic
907875049 1:58477761-58477783 TTCAGGCACAGTTTAATCCAGGG - Intronic
908896559 1:68907493-68907515 TTCAGATACAGCTGGAACCAGGG - Intergenic
909139761 1:71848747-71848769 TGAACTTACACCTTGATCCATGG - Intronic
909825591 1:80122508-80122530 TTCACTTAAAGCTTGACTCATGG - Intergenic
913679506 1:121175395-121175417 TTAAATTACTTCTTGATCCATGG - Intronic
914031339 1:143963041-143963063 TTAAATTACTTCTTGATCCATGG - Intronic
914158107 1:145104922-145104944 TTAAATTACTTCTTGATCCATGG + Intronic
915433290 1:155883628-155883650 TTGCTTAACAGCTTGATCCAGGG + Exonic
918870471 1:189967059-189967081 TTCAGTTTCAGCTGGTCCCAAGG - Intergenic
920466811 1:206193940-206193962 TTAAATTACTTCTTGATCCATGG - Intronic
920910969 1:210216379-210216401 TTCAATTAAAGATTGGTCCAAGG + Intergenic
921259532 1:213373419-213373441 TTCAGGAACAGCTGGATCCAAGG - Intergenic
922255690 1:223891119-223891141 TTCAGGCATGGCTTGATCCAGGG - Intergenic
923014597 1:230116561-230116583 TGAAATTACTGCTTGATCCATGG + Intronic
923342980 1:233023141-233023163 TGCAGGAACAGCTAGATCCAGGG - Intronic
924336886 1:242993984-242994006 TTCAGGCATGGCTTGATCCAGGG - Intergenic
924556226 1:245121355-245121377 TTCAGATGCAGCTTGATCCAGGG + Intronic
924661918 1:246027761-246027783 TTGAATTACTCCTTGATCCATGG - Intronic
1064450921 10:15441368-15441390 TGAAGATACAGCTTGATCTAAGG + Intergenic
1068282721 10:54896480-54896502 TTCAGTTGCACCTTAATCTAGGG - Intronic
1068455712 10:57251107-57251129 TTCAGTAACTGGTTGATTCAGGG - Intergenic
1069127172 10:64650315-64650337 TTAATTTACAGGTTGATCCTAGG + Intergenic
1070545278 10:77447107-77447129 CTCAGCTACAGCTTCAGCCAAGG + Intronic
1071727668 10:88216334-88216356 TTCAGGCACAGCTGGATCTAGGG + Intergenic
1072150256 10:92677016-92677038 TTCAGTTAGAAATTTATCCAGGG - Intergenic
1074368392 10:112878609-112878631 TTCAGGTACAGCTGAATCCAGGG - Intergenic
1074372357 10:112910327-112910349 TTCAGGTGTAGCTGGATCCAGGG + Intergenic
1075453589 10:122570186-122570208 TTCTGCTACAGTTGGATCCAAGG - Exonic
1075683587 10:124349105-124349127 TCAAGTTCAAGCTTGATCCAAGG + Intergenic
1075870137 10:125766319-125766341 TTCCTTGACAGCTTGACCCAGGG + Intergenic
1076419978 10:130324436-130324458 TTCAGGCACAGCTGGATCCAGGG - Intergenic
1076628658 10:131839444-131839466 TTCAGATACAGCTAGCTCCGTGG + Intergenic
1077745442 11:4899043-4899065 TTCAGTTACTGGTTAATGCAAGG - Intronic
1080039599 11:27745330-27745352 TTCAGGTATAGCTGAATCCAAGG - Intergenic
1080415908 11:32069996-32070018 TTCAGGTACAGCTTGATCCAGGG + Intronic
1081703449 11:45166162-45166184 TTCAGGTACAGTTGGATCCAGGG + Intronic
1083720001 11:64599338-64599360 TTCAGTGGCAGCTGGAGCCACGG + Intronic
1083770101 11:64862344-64862366 TCCAGTTTCAGCTGGATTCATGG + Intronic
1084409833 11:69000395-69000417 TTCAGACACAGCTGGATCCAGGG - Intergenic
1085174762 11:74476096-74476118 TTCAGGCACAGATTGATCCAGGG - Intergenic
1086503652 11:87479467-87479489 TTTAGGTACAGCTTGGGCCATGG + Intergenic
1088743787 11:112787553-112787575 TTCAGGCACAGTTTGATACAGGG + Intergenic
1093817000 12:23561038-23561060 TTGAGTTACATCTTGAACTATGG - Intronic
1094213112 12:27913279-27913301 TTCAGTGACTGCTTGATGCGTGG - Intergenic
1095605894 12:44067445-44067467 TGAAGTTACTCCTTGATCCATGG + Intronic
1097681287 12:62651783-62651805 TCCTCTTAAAGCTTGATCCAAGG + Intronic
1098003328 12:65968733-65968755 TTTAGGTATGGCTTGATCCAGGG + Intergenic
1099649885 12:85412384-85412406 TTCAGTTAAAGTAGGATCCAGGG + Intergenic
1100728484 12:97436343-97436365 TTCAGGTATGGTTTGATCCAGGG + Intergenic
1101050984 12:100863947-100863969 TTCAGGCACGGTTTGATCCAGGG + Intronic
1101517027 12:105446341-105446363 TTCAGGTATAGCTAGATCCAGGG + Intergenic
1102006827 12:109594551-109594573 TTCAGGTATAGCTCAATCCAGGG + Intronic
1102525178 12:113507523-113507545 TTCAGGCACAGTTGGATCCAGGG + Intergenic
1102542574 12:113633203-113633225 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1102558500 12:113745566-113745588 TTCAGGTGCAGCTGGACCCAGGG + Intergenic
1102626932 12:114242637-114242659 TTTAGTAATGGCTTGATCCAGGG - Intergenic
1102807197 12:115792496-115792518 TTCAGTCATGGCTTGATCCAGGG + Intergenic
1102891549 12:116562262-116562284 TTCAGGCACAGGTGGATCCAGGG - Intergenic
1103208088 12:119145851-119145873 TTCAGGTACAGCTGGATTCAGGG + Intronic
1103499953 12:121393963-121393985 TTCGGTAACAGCTTGAGCCCAGG - Intronic
1103806195 12:123575045-123575067 TTCAGGTATAGCTGAATCCAGGG - Intergenic
1103979267 12:124726022-124726044 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1103981608 12:124740407-124740429 TTCAGGTACAGCTTGATCCGGGG - Intergenic
1103982287 12:124744427-124744449 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1104086009 12:125474736-125474758 TTTAGGCACAGCTGGATCCAGGG + Intronic
1104377416 12:128277260-128277282 TTCAGGCACAGCTGGATCCAGGG + Intronic
1104430801 12:128714505-128714527 TTCTGTTACAGAATAATCCAGGG - Intergenic
1104517977 12:129445612-129445634 TTCAGGCACAGCTGGATCCAGGG - Intronic
1104523041 12:129493065-129493087 TTCAAGTACAGCTGGATACAGGG - Intronic
1104551603 12:129762113-129762135 ATCAGGAACAGATTGATCCAGGG - Intronic
1104564096 12:129864667-129864689 TTCAGGCGTAGCTTGATCCAGGG - Intronic
1104638387 12:130451783-130451805 TTCAGGGACATCTTGAACCAGGG - Intronic
1104664343 12:130636796-130636818 TTCAGTTACAGCTTGATCCAGGG - Intronic
1104785809 12:131447392-131447414 TTCAGGTGCGGCTGGATCCAGGG + Intergenic
1104814888 12:131639933-131639955 TGCAGGTACAGCTTGATGGATGG + Intergenic
1104899838 12:132182898-132182920 TTCAGGTGTGGCTTGATCCAGGG + Intergenic
1104958709 12:132478109-132478131 TTCAGGTCTAGCTGGATCCAGGG + Intergenic
1106016321 13:25872401-25872423 TTCAGGCAGAGCTGGATCCAGGG - Intronic
1107253859 13:38399085-38399107 TTCAGTTACACACTGCTCCATGG - Intergenic
1107463582 13:40628861-40628883 TACAGTTACTGTTTGATTCAGGG - Intronic
1108612832 13:52100980-52101002 TTCAGTTACAGCTAAATTCTGGG + Intronic
1110817772 13:79880611-79880633 GTCAGTTACTGCTTGATGGATGG - Intergenic
1111617557 13:90680296-90680318 TACAATTACTCCTTGATCCATGG + Intergenic
1112101689 13:96196849-96196871 TTCAGCTGCAGCTGCATCCATGG + Intronic
1115046999 14:29006893-29006915 TTCAGTTACAGTATTTTCCATGG - Intergenic
1116098918 14:40408510-40408532 GTCAATTACAGCTTGGGCCATGG - Intergenic
1117215383 14:53546321-53546343 TTCGGGCACAGCTAGATCCAGGG + Intergenic
1119140449 14:72262818-72262840 GTCAGCCACAGCTGGATCCAGGG + Intronic
1119531432 14:75364065-75364087 TTTAGGAACAGCTGGATCCAGGG + Intergenic
1119723948 14:76910550-76910572 TTCAGGCACAGTTTGATCTAGGG - Intergenic
1119751214 14:77078822-77078844 TTCAGGCCAAGCTTGATCCAGGG + Intergenic
1119793608 14:77376621-77376643 TTCAGTTTCAGCTTCAGCCGGGG - Intronic
1119845613 14:77827390-77827412 TTCAATTTCAGCTAGATCTAGGG - Intronic
1120507769 14:85374916-85374938 TACAGATACAGCTAGATCCAGGG + Intergenic
1120751545 14:88202983-88203005 TTCACTTCCATCTTGATCAAGGG - Intronic
1120897276 14:89544863-89544885 TTCAGTTGCACCTTGCTCTAAGG - Intronic
1121432428 14:93897296-93897318 TGCAGGTACAGCTGGCTCCAGGG - Intergenic
1121534406 14:94681409-94681431 TTCAGGTGAGGCTTGATCCAGGG + Intergenic
1122061921 14:99141620-99141642 TTCAGGTACGGCTGGATCCAGGG - Intergenic
1122652579 14:103233512-103233534 TTCAGGTAGGGCTGGATCCAGGG + Intergenic
1123101649 14:105806248-105806270 TTCAGTTACAGTTATTTCCATGG + Intergenic
1123627392 15:22237229-22237251 TTCAGGCACAACTGGATCCAGGG - Intergenic
1124206068 15:27722107-27722129 TTCAGTAACTACTTGATTCATGG - Intergenic
1125192192 15:37006464-37006486 CTCCATCACAGCTTGATCCATGG + Intronic
1125761642 15:42100241-42100263 TTCAGGCAAAGCTCGATCCAAGG - Intergenic
1125870533 15:43097089-43097111 TGCAATTACTCCTTGATCCATGG + Intronic
1127292980 15:57586690-57586712 TTCAAATTCAGCCTGATCCATGG - Intergenic
1128520850 15:68373894-68373916 TGCAGGTACAGTTTGATCCAGGG - Intronic
1129123088 15:73414932-73414954 TTCAGTTACAGCATTCTGCAGGG + Intergenic
1129152090 15:73695751-73695773 TTCAGGCATAGCTGGATCCAGGG + Intronic
1129331673 15:74831077-74831099 TTCAGTGCCAGCTTCATCCTTGG - Exonic
1130849839 15:87782173-87782195 TTCAGGCACAGCTGGAACCAGGG + Intergenic
1130914219 15:88291906-88291928 GTCAGGTACAGCTGGCTCCAGGG - Intergenic
1132007252 15:98239246-98239268 TTCAGGTATAGCGAGATCCAGGG - Intergenic
1132215317 15:100057877-100057899 TTCAGGCACTGCTGGATCCAGGG - Intronic
1133337597 16:5016096-5016118 TTCAGGTAAGGCTAGATCCAGGG + Exonic
1133661397 16:7921449-7921471 TTAAGGTACAGCTGGATCCAGGG - Intergenic
1134037385 16:11041421-11041443 TTCAGGCAAAGCTGGATCCAGGG + Intronic
1134235030 16:12458967-12458989 TTCTGTTGTAGCTTGATCTAGGG + Intronic
1134276454 16:12780660-12780682 TGCAGGTACAGCTGGATCTAGGG - Intronic
1134366133 16:13580965-13580987 TTCAGGCACGTCTTGATCCAGGG + Intergenic
1135293210 16:21257806-21257828 TTCAGCTACAGCTGTATTCAGGG - Intronic
1135502092 16:23005094-23005116 TTCAGGTATAGGTCGATCCAGGG - Intergenic
1135598066 16:23758370-23758392 TTTAGGCACAGCTGGATCCAAGG + Exonic
1135885801 16:26306322-26306344 TTCAGGTACAGCTTGATCCAGGG + Intergenic
1135958795 16:26978808-26978830 TTCAGGCACAGCTGGATCTAAGG + Intergenic
1135978753 16:27129846-27129868 TTCAGGCACAGTTGGATCCAGGG + Intergenic
1136050407 16:27646185-27646207 TTCAGGTGCAGCTGGATCCAGGG + Intronic
1136132488 16:28232459-28232481 TTCAGGCATAGCCTGATCCAGGG + Intergenic
1136132942 16:28235637-28235659 TTCAGGCATAGCCTGATCCAGGG + Intergenic
1136246801 16:28980943-28980965 GTCAGGTAAAGCTGGATCCAGGG + Intronic
1137265870 16:46868545-46868567 TTAAGGTACAGCTTGGGCCATGG - Intergenic
1137595009 16:49717609-49717631 TTCAGGTGCAGCTGAATCCAGGG - Intronic
1137946313 16:52736175-52736197 TTCAGTCAAAGCTAGATGCAGGG + Intergenic
1138157416 16:54719064-54719086 TTCAGGCATGGCTTGATCCAAGG + Intergenic
1138447286 16:57072100-57072122 TTCAGGCACAGCTGGATCCAGGG + Intronic
1138519954 16:57565430-57565452 TTCAGACATAGCTGGATCCAGGG + Intronic
1138520238 16:57566920-57566942 TTCAGGCATGGCTTGATCCACGG + Intronic
1139003020 16:62537499-62537521 TTCAGTTACTGCTTCAGACAGGG - Intergenic
1139466646 16:67157574-67157596 TTCAGGGACGGCTGGATCCAGGG - Intronic
1140848992 16:78916914-78916936 ATCAGGTAAAGCTTGACCCAGGG + Intronic
1140855072 16:78970849-78970871 TTCAGGCACGGCTGGATCCAGGG + Intronic
1141293942 16:82749235-82749257 TTTAGGTACAGCTGGATCCAGGG - Intronic
1141988235 16:87593919-87593941 TTCAGGTACTGCTGGATCCAGGG + Intergenic
1142149749 16:88507431-88507453 TTCAGGTGTGGCTTGATCCAGGG + Intronic
1142722545 17:1786331-1786353 TTAAGATACAGCTTGATCCAGGG - Intronic
1142879125 17:2870798-2870820 CTCAGAAACAGCTGGATCCAGGG + Intronic
1143831861 17:9658775-9658797 TTCAGGTAGGGCTGGATCCAGGG + Intronic
1143861625 17:9895476-9895498 TTCAGGTATGGCTTAATCCAGGG - Intergenic
1143933316 17:10454730-10454752 TTGAAATACAGCTTCATCCAGGG + Exonic
1143937740 17:10504985-10505007 TTGAAATACAGCTTCATCCAGGG + Exonic
1144051966 17:11504635-11504657 TTTATTTACAACTTAATCCAAGG + Intronic
1144943143 17:18955151-18955173 TTCAGGTGCAGTATGATCCAGGG + Intronic
1146301109 17:31690542-31690564 TTTAGTAACATCTTTATCCATGG - Intergenic
1146735645 17:35236549-35236571 TTCAGTTACATTTTGCTCCAGGG - Intergenic
1146817523 17:35954892-35954914 TAAAGTTACTCCTTGATCCATGG + Intergenic
1147048258 17:37770966-37770988 TTCAGAAACAGTTTGATCCTTGG - Intergenic
1148961107 17:51393649-51393671 TTAAGTTACAGCATGATAAAAGG + Intergenic
1149398892 17:56273889-56273911 TTCAGGTACAGTTTGATTCAGGG + Intronic
1150319739 17:64202519-64202541 TTCATTTGCAGCTTAATCCAGGG - Intronic
1150429274 17:65102278-65102300 ATCAGTTGCAGGCTGATCCAGGG - Intergenic
1153395303 18:4613410-4613432 TTAAATTACTCCTTGATCCATGG + Intergenic
1153501860 18:5757765-5757787 TTAAGTTTCACATTGATCCATGG + Intergenic
1155233395 18:23795688-23795710 TTCAGGAATAGCTTGATCTAGGG + Intronic
1156642136 18:39115195-39115217 TTCAGTCACAGCTTGATGTAGGG - Intergenic
1158235025 18:55302761-55302783 TCCAGATGCAGCTTTATCCAGGG - Intronic
1158310942 18:56157601-56157623 TTCAGGTACAGCAGGATCTAGGG + Intergenic
1158444900 18:57511041-57511063 TTCAGTCATAGCTGAATCCAGGG - Intergenic
1160620355 18:80166515-80166537 ATCAGTTACAGCCTCCTCCATGG + Intronic
1160737578 19:671019-671041 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1160926990 19:1551260-1551282 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1161212230 19:3073211-3073233 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1161316677 19:3620575-3620597 TTCAGGTAAGGCTGGATCCAGGG - Intronic
1161504058 19:4634560-4634582 TTCAGGCACAGTTTGATCAAGGG + Intergenic
1161616378 19:5273079-5273101 TTCAGGTTCAGCTGGATCCAGGG - Intronic
1162316465 19:9941612-9941634 TTCAGTCATGGCTGGATCCAGGG + Intergenic
1162928369 19:13942224-13942246 TTCAGGCACAGCTGGATCCAGGG + Intronic
1162999001 19:14354273-14354295 TTCAGGGACAGCTGGATTCACGG + Intergenic
1163257929 19:16168794-16168816 GTCAGGTACAGCTGGAACCAGGG - Intronic
1163266330 19:16224700-16224722 TTCAGTTACAGCTGGCTGCCAGG + Intronic
1163616014 19:18328812-18328834 TTCAACTATAGCTGGATCCAGGG - Intergenic
1163668894 19:18616238-18616260 TTCAGGCACAGCTGGATCCAGGG + Intronic
1163768517 19:19176964-19176986 GTCAGGTACAGTTGGATCCAGGG + Exonic
1164472107 19:28545008-28545030 TTAAGATATAGCTTGATCCATGG - Intergenic
1164589197 19:29496902-29496924 TTCAGGCATGGCTTGATCCAGGG - Intergenic
1164916250 19:32054468-32054490 TTCAGGTATAGCTGGATCCAGGG - Intergenic
1164994004 19:32706236-32706258 CTCAGGTACAGCTTTATCCCTGG + Intronic
1165038301 19:33050297-33050319 TTCAGGCCTAGCTTGATCCAGGG - Intronic
1165118344 19:33543132-33543154 TTCAGTTACGGCTGGATCCAGGG + Intergenic
1165766665 19:38355777-38355799 TTCAGGTATGGCTGGATCCAGGG + Intronic
1167215551 19:48162092-48162114 TGCAGGCACAGCTGGATCCAGGG - Intronic
1167745829 19:51351359-51351381 TTCAGGCACAGCTTGATCCAGGG - Intronic
1168418030 19:56181852-56181874 TTCAGTTTGAGCTTCATTCAGGG + Intronic
924995690 2:358592-358614 TTCAATTACATCTTGATCTCTGG - Intergenic
925696724 2:6587966-6587988 TTCAATTATAGCTGGATCCAGGG + Intergenic
925816996 2:7763457-7763479 TTCACTGACAGCTTGCACCATGG - Intergenic
927081113 2:19631472-19631494 TTCAGGAACAGCTGGAACCAGGG - Intergenic
927790494 2:26005818-26005840 TTCAGGCACAGCTGGATCTAAGG + Intergenic
929237173 2:39617757-39617779 TTTAGGTACAGCTGGATCCAGGG - Intergenic
931233127 2:60390943-60390965 TACAGGAACAGCTGGATCCAGGG - Intergenic
931331601 2:61291526-61291548 TTCAGTCACAGCTGAATCCAGGG - Intronic
931991613 2:67796228-67796250 GTCTGTTACAGATTGATCAAAGG - Intergenic
932118800 2:69078912-69078934 TTGAGTTTCAGATGGATCCAAGG + Intronic
932417321 2:71581333-71581355 TTAATTTACAGCTGGAGCCAGGG - Intronic
933306945 2:80612796-80612818 TACTGTTACACTTTGATCCATGG - Intronic
937450642 2:121999746-121999768 TTCAGGTGAAGCTTGATCTAGGG + Intergenic
937584480 2:123529993-123530015 TTTAAGTACTGCTTGATCCAGGG + Intergenic
937840542 2:126520008-126520030 TGCAGTTACAGTTTGTTACAGGG - Intergenic
942305505 2:174603217-174603239 TTCAGTTATAGATAGATTCAGGG - Intronic
942801389 2:179880193-179880215 TTCAGTCTGAGCCTGATCCAAGG + Intergenic
943694987 2:190917649-190917671 TGAAGTTACTCCTTGATCCATGG + Intronic
944346663 2:198674139-198674161 AACAGGTACATCTTGATCCAAGG - Intergenic
945769784 2:214029119-214029141 TTAAGATACAGCTAGAACCAAGG + Intronic
945830121 2:214774383-214774405 TAAAGTTACTCCTTGATCCATGG + Intronic
946048271 2:216839181-216839203 TTCAGGTATAGCTTGACCAATGG - Intergenic
946302983 2:218835852-218835874 TTCAGGTACAGTTTGATCCAAGG - Intergenic
946309601 2:218875952-218875974 TTCAGGTACAGCTGAACCCAGGG + Intergenic
947923748 2:233902834-233902856 TTCAGCAGCAGCTTGATCAAGGG - Intergenic
1168977233 20:1976117-1976139 TTCAGGTAGAGTTTGATCAAAGG - Intergenic
1168977352 20:1977291-1977313 TTCAGGTAGAGTTTGATCAAGGG - Intergenic
1169202650 20:3720257-3720279 TTCAGGTAAGGCTTGATCCAGGG - Intergenic
1169860486 20:10146316-10146338 TTCAGGTATGGCTGGATCCAGGG - Intergenic
1170255796 20:14341814-14341836 TTCAGGTAAAGCTTGATACATGG + Intronic
1170896910 20:20423146-20423168 GTCACTTACACCTTGATCCCAGG - Intronic
1173172703 20:40740643-40740665 TTCAGTCACAGCTTGCTCATAGG + Intergenic
1173460730 20:43241264-43241286 TTCAGGCATGGCTTGATCCAGGG - Intergenic
1173699268 20:45053390-45053412 TTCGGAGACTGCTTGATCCATGG + Intronic
1173917741 20:46721621-46721643 TTCAGGCACTGCTAGATCCATGG + Intronic
1173944446 20:46939463-46939485 TTCAGACATAGCTTGATCAAGGG - Intronic
1174104266 20:48151034-48151056 CTCAGATGCAGCTGGATCCAGGG - Intergenic
1174107765 20:48175003-48175025 TTCAGGTATAGGTAGATCCAGGG - Intergenic
1174113668 20:48212990-48213012 TTCAGGCACAGCTGCATCCAGGG + Intergenic
1174115029 20:48220985-48221007 GTCAGGTAGAGCTTGATCTAGGG + Intergenic
1174168187 20:48599551-48599573 TTCAGGCACAGCTGCATCCAGGG - Intergenic
1174198251 20:48788561-48788583 TTCAGGTAGAGTTTGATCTAGGG - Intronic
1174267756 20:49344329-49344351 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1174327250 20:49789255-49789277 TTCAGGTACAGCTGGATTCAGGG - Intergenic
1174501731 20:50989871-50989893 TCCAGTAACAGCTTGAGCCCAGG - Intergenic
1174515071 20:51085737-51085759 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1175033410 20:55976952-55976974 TTCAGGTAAGGCTAGATCCAGGG - Intergenic
1175122323 20:56725277-56725299 TTCAGGCACGGCTGGATCCAGGG + Intergenic
1175228461 20:57459164-57459186 TTCAGGCACAGATGGATCCAGGG + Intergenic
1178089141 21:29143259-29143281 TGCAGTTACAGCTGGCTTCATGG - Intronic
1181464357 22:23102744-23102766 TTCAGTGACAGCTTGTGCCCTGG - Intronic
1181822064 22:25484126-25484148 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1181822204 22:25485105-25485127 TTCAGGTATGGCTTGATCCAGGG - Intergenic
1183261736 22:36799808-36799830 TTCAGGAACAGCTGGATCAAGGG - Intergenic
949354559 3:3164796-3164818 TTAAATTACTCCTTGATCCATGG - Intronic
949763701 3:7501761-7501783 TGCAATTACAGATTGATACAAGG + Intronic
949843857 3:8351015-8351037 TTCAGGTATGGCTGGATCCAGGG - Intergenic
949922344 3:9013016-9013038 TTCAGGTATAGCTTGATCCAGGG - Intronic
950047813 3:9960878-9960900 TTCAGGCACAGCTGGGTCCAGGG - Intergenic
950132760 3:10558577-10558599 TTCAGGCACAGCTGGATCCAGGG - Intronic
950192902 3:10990634-10990656 TTCAGGTATGGCTGGATCCAGGG + Intergenic
950221095 3:11196756-11196778 TTCAGCTAAAGTGTGATCCATGG + Intronic
950575256 3:13828376-13828398 TTCAGGTCTGGCTTGATCCAGGG - Intronic
950686832 3:14624548-14624570 TTCAGGTATAGCTAGATCTAGGG - Intergenic
951257937 3:20472245-20472267 ATCAGTCACAGCTTGTGCCAGGG + Intergenic
952532050 3:34272931-34272953 TTCAGGTTCATCTTGATTCAGGG + Intergenic
952722934 3:36552172-36552194 TTCCTTTACAGTTTGCTCCAGGG - Intergenic
952814368 3:37434470-37434492 TTCAGGCACAGCTCAATCCAGGG - Intronic
953743043 3:45553425-45553447 TTCAGTTCCAGCTTGACGGAGGG + Intergenic
954030717 3:47818137-47818159 TCCAGCAACAGCTTGGTCCAGGG + Intronic
954855713 3:53642107-53642129 TTCAGGCTCAACTTGATCCAGGG + Intronic
954874902 3:53795749-53795771 TTCAGTTCCACCTTGATTCTTGG - Intronic
955046745 3:55368095-55368117 TTCAGTTATGACTGGATCCAGGG - Intergenic
955352002 3:58200493-58200515 TTCAGGCATAGCTGGATCCAGGG - Intronic
955527155 3:59832910-59832932 TTCAGGCACAGCTGGATTCAGGG - Intronic
955542436 3:59991880-59991902 TTCAGGTATGGCTTGATCCAGGG - Intronic
955556495 3:60143286-60143308 TTCAGTCAAAGCTTGGTCCTAGG + Intronic
956098115 3:65738620-65738642 TTAAGTGACTCCTTGATCCATGG + Intronic
956399263 3:68859666-68859688 TTCAGTTCAAGGTTGATGCATGG - Intronic
956722886 3:72133819-72133841 TTCAGGTATAGCTGGATCCAGGG + Intergenic
958110560 3:89138082-89138104 TTCAGCTGCTGCTTGATTCAGGG + Intronic
958718211 3:97813063-97813085 TGAAGTTACTACTTGATCCATGG + Intergenic
961368073 3:126413940-126413962 TTTAGGCACAGCTGGATCCAGGG + Intronic
961741286 3:129034581-129034603 TTCAGGCACAGCTGGGTCCAGGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963055676 3:141184653-141184675 TTTAGGTACAGCTAGATCCCAGG + Intergenic
963369559 3:144381264-144381286 TTGTGGTACAGTTTGATCCAAGG - Intergenic
965116217 3:164492441-164492463 TTCAGTGCCTGATTGATCCAAGG - Intergenic
966788078 3:183637995-183638017 TTCAATTCCTGCTTCATCCAGGG - Intronic
969298501 4:6283453-6283475 TTCAGGCACGGCTGGATCCAGGG + Intronic
971217251 4:24672887-24672909 TTCAGGTACAACCTGACCCATGG - Intergenic
971370112 4:26012152-26012174 TTCAGGCACAGCTCAATCCAGGG - Intergenic
973845217 4:54904891-54904913 TTCAGATCCAGCTTGGTTCAGGG + Intergenic
975476756 4:74832486-74832508 CTCAGTTCCAGCTTTATTCACGG - Intergenic
975880012 4:78893880-78893902 CACAATTACTGCTTGATCCATGG + Intronic
975971761 4:80047817-80047839 CTCAGGTACAGCTGGATCCAAGG - Intronic
976258499 4:83123697-83123719 TTCAGCTCCAGATTGCTCCATGG + Intronic
976832223 4:89328408-89328430 TTCAGGCACAGGTTGATCCAGGG + Intergenic
977808340 4:101329957-101329979 TTAAATTACTCCTTGATCCATGG - Intronic
978183806 4:105834777-105834799 TTCAGTAAAAACTGGATCCAGGG - Intronic
978962498 4:114699994-114700016 ATCAGGTGCAGCTGGATCCAGGG - Intergenic
979240238 4:118441320-118441342 TTCAGGCATGGCTTGATCCAGGG + Intergenic
981595970 4:146422530-146422552 TTTAGTTACAGTTTTATACACGG - Intronic
982561865 4:156937839-156937861 TTCAGTAGCAACTTGATTCATGG + Intronic
983720359 4:170843762-170843784 TTCATTTACAGCTTTTTCTATGG - Intergenic
985334667 4:188878852-188878874 TTCAGTTACAGCTACATCCTAGG + Intergenic
986757589 5:10852659-10852681 TTCAGGTACAGCTTGATCCAGGG - Intergenic
988711163 5:33776475-33776497 TTTAATTTCATCTTGATCCATGG - Intronic
989001004 5:36760451-36760473 TGAAATTACTGCTTGATCCATGG + Intergenic
989275907 5:39588009-39588031 TTTATTTACAGCTGGATCAAAGG + Intergenic
989414614 5:41159277-41159299 TTCAGCTGCACCATGATCCATGG - Intronic
991036110 5:62129483-62129505 TTGAGTTCCTGTTTGATCCAAGG + Intergenic
992174141 5:74133261-74133283 TTCAGGTAAAGCTGGATTCAAGG + Intergenic
992358027 5:76005804-76005826 TTCAGGTTCAGCTGGATCCAGGG - Intergenic
993225908 5:85167129-85167151 CTAAGGTACAGCTTGAGCCATGG + Intergenic
993542675 5:89171996-89172018 TTCAGGTGTAGCTTGATTCAGGG + Intergenic
995133614 5:108657385-108657407 TTCACTCATAGCTGGATCCAGGG + Intergenic
995445823 5:112242732-112242754 TGAAGTTACCTCTTGATCCATGG + Intronic
997178472 5:131803357-131803379 TTCAGGCACAGCTTTATCCAAGG + Intergenic
997516682 5:134495013-134495035 TTCAGGCACAGTTTGATCCAGGG - Intergenic
997875702 5:137544853-137544875 TTCAGTGACACCTAGAGCCATGG + Intronic
998650047 5:144108403-144108425 TTCAGTTACAGCTCCATCCTAGG - Intergenic
998865177 5:146491875-146491897 TTCAGTTAAAGCTTTATTTATGG + Intronic
999038006 5:148375128-148375150 TTTAGTAACAGCTGGATTCAGGG + Intergenic
999038121 5:148376244-148376266 TTCAGGCACAGCTTTATCCATGG + Intergenic
1000145299 5:158447865-158447887 ATCAGGTACTGCTTGATCCGGGG - Intergenic
1000269135 5:159666598-159666620 TTCAGACACGGCTGGATCCAAGG - Intergenic
1000810410 5:165854498-165854520 TTCAGGCACAGCTAGATCCAGGG - Intergenic
1001050662 5:168411525-168411547 TTCAGGCACAGCTGGATCCAGGG + Intronic
1001146624 5:169190373-169190395 TTCAGGAACAGCTGGATCCAGGG - Intronic
1001182578 5:169534304-169534326 ATCAGGTACAGTGTGATCCAGGG - Intergenic
1001253416 5:170165841-170165863 TTCAGGTTCGGCTAGATCCAGGG + Intergenic
1001416730 5:171550228-171550250 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1001438893 5:171723047-171723069 TTCAGGCACGGCTGGATCCAAGG + Intergenic
1001442768 5:171757933-171757955 TTCAGGAATAGCTTGATCTAGGG + Intergenic
1001524766 5:172420930-172420952 TTCAGGCACATCTTAATCCAGGG - Intronic
1002080630 5:176735199-176735221 TTCAGGCCCAGCTGGATCCAGGG - Intergenic
1002740490 5:181431903-181431925 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1005890515 6:30134195-30134217 TTCAGTAAAAGCTTGATAAATGG - Intergenic
1005976530 6:30804370-30804392 TTCAGTGGAAGCTTGAACCATGG - Intergenic
1007124181 6:39411129-39411151 TTCAGGTACAGCTGGGACCAGGG + Intronic
1007241662 6:40431022-40431044 TTCAGGTTCAGCTGGATCAAAGG - Intronic
1008045322 6:46845767-46845789 TTCAGGTACAGCTAGATTCAAGG - Intergenic
1008557156 6:52684073-52684095 TTCAGTTACAGCTTTCTTCCTGG + Exonic
1008916963 6:56798619-56798641 TGAAGTTACACCTTGTTCCATGG - Intronic
1010648160 6:78419268-78419290 TTCAGTAAGAACTTGATCAAAGG - Intergenic
1010963284 6:82172475-82172497 TTCAGTGACTGCTCCATCCATGG - Exonic
1011963845 6:93127416-93127438 TGCAATTACTTCTTGATCCATGG + Intergenic
1012589100 6:100957807-100957829 TTAAGGTTCAGATTGATCCAAGG + Intergenic
1013636736 6:112036178-112036200 TTTAATAACAGCTTCATCCATGG + Intergenic
1013859985 6:114624141-114624163 TTCAGTCACAGTATGATTCATGG + Intergenic
1014580397 6:123129720-123129742 TTCGTTTCCAGCTTCATCCATGG - Intergenic
1014705118 6:124736871-124736893 TTGAATTACTCCTTGATCCATGG - Intronic
1016572316 6:145528723-145528745 TAAAGTTACTCCTTGATCCATGG - Intronic
1016823578 6:148367868-148367890 TTCAGTCACAGCTTTTCCCATGG + Intronic
1017192366 6:151668186-151668208 TTCAGTTTCTGCTTCATGCATGG + Intronic
1019245600 6:170707504-170707526 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1019356903 7:585006-585028 TTCAGGCACGGCTGGATCCAGGG - Intronic
1019495746 7:1339788-1339810 TTCAGGCATGGCTTGATCCAGGG - Intergenic
1020254390 7:6494551-6494573 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1028102684 7:86840309-86840331 TTAATTTACAGATTGATCCATGG - Intronic
1029292942 7:99516556-99516578 TCCGGTTACAGCTTAATCCCAGG + Intronic
1030171220 7:106604787-106604809 TTCAGTTAAAGCATGTTCCAGGG - Intergenic
1031860129 7:126969857-126969879 TTAAGTTACTCCTTGATCCATGG + Intronic
1031925639 7:127635855-127635877 TTCAGTGACAGCATGATTGATGG - Intergenic
1033042068 7:137927930-137927952 TTCAGTTATAGCAAGTTCCAAGG + Intronic
1033275153 7:139966427-139966449 TTCAGGTATGGCTTGATTCAGGG + Intronic
1035958865 8:4114515-4114537 TTGAGTTATTCCTTGATCCATGG - Intronic
1037465844 8:19159578-19159600 TTAAGTTATAGTTTCATCCATGG + Intergenic
1041395720 8:57389136-57389158 GTTAGTTACAGCTGGATCCTGGG + Intergenic
1042385475 8:68169055-68169077 TTCAGGCACAGCTCTATCCAGGG + Intronic
1042854684 8:73254562-73254584 TCCAGATGCAGCTTTATCCAGGG + Intronic
1043375434 8:79644245-79644267 ATCAGGAACAGCTGGATCCAGGG + Intronic
1044307960 8:90659357-90659379 TAGAGTTAAAGCTGGATCCATGG + Intronic
1044932351 8:97261995-97262017 TTCAGATACGACTTGATCCAGGG - Intergenic
1046005393 8:108475548-108475570 TTTATATACAGCTTGATCCAAGG + Intronic
1046587603 8:116167114-116167136 TTCTTTTACAGCTTGCTTCAGGG - Intergenic
1047728955 8:127709994-127710016 TTCAGGTACAGTTGGATCAAGGG - Intergenic
1048066847 8:130978966-130978988 TTCAGGCACAGCTTGGTCCAGGG - Intronic
1048491715 8:134900468-134900490 TTCAGGCACAGCTAGATCCAGGG + Intergenic
1048892794 8:138962881-138962903 TTCAGTTATAGATTTCTCCAGGG + Intergenic
1049155369 8:141062952-141062974 TCCAGTTCCAGCTGGTTCCAAGG + Intergenic
1050365138 9:4867171-4867193 TTCAGGTAAAGCTGGATCTAGGG + Intronic
1051437349 9:17047232-17047254 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1054839496 9:69721002-69721024 TGAAGTTTCTGCTTGATCCATGG - Intronic
1054883716 9:70173028-70173050 TTCAGGCACAGCTTGATGCAGGG + Intronic
1056774769 9:89503211-89503233 TCCAGGTACAGTTAGATCCAGGG + Intergenic
1058168929 9:101655626-101655648 TTAAGTAGCAGCTTGATCCTTGG + Intronic
1059092908 9:111380154-111380176 TGAAATTACACCTTGATCCATGG + Intronic
1060101542 9:120844626-120844648 TTCAGTTATACCCTGACCCAAGG - Intergenic
1061362091 9:130150057-130150079 TTCAGGCAAGGCTTGATCCAGGG - Intergenic
1061744935 9:132732732-132732754 TACAGGCACAGCTTGAACCAGGG - Intronic
1203605799 Un_KI270748v1:56711-56733 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1188368766 X:29343189-29343211 TTCATTTACAGGTTTTTCCAAGG - Intronic
1189167198 X:38871857-38871879 TTTAGGTAAGGCTTGATCCAGGG + Intergenic
1189308020 X:40001923-40001945 TTCAGGTTCAACTGGATCCAGGG + Intergenic
1189373224 X:40446325-40446347 TTGAATGACAGCTTGAACCAGGG + Intergenic
1192049507 X:67711123-67711145 TTCAGGCAGAGCTGGATCCAAGG + Intronic
1193092188 X:77506374-77506396 TTAAGTTATAGTTTCATCCATGG + Exonic
1193321139 X:80122837-80122859 ATGAATTACAGCTTCATCCAAGG - Intergenic
1194535521 X:95102006-95102028 TTCAGTTCCTGATTGATCCCAGG - Intergenic
1194707987 X:97199469-97199491 TTTATGTAAAGCTTGATCCAGGG + Intronic
1195211801 X:102657062-102657084 TTCAGTTCAAGCCTGGTCCATGG + Exonic
1195451964 X:105024799-105024821 GTCAGTTACAGATTTGTCCAGGG + Intronic
1196668473 X:118341559-118341581 TTCAGGTATGGCTGGATCCAGGG - Intergenic
1197023483 X:121718208-121718230 TCAAGATACAGCTTGAGCCACGG - Intergenic
1197330884 X:125152967-125152989 TTCAGTTACCGCTTGTTTCAAGG + Intergenic
1197368317 X:125594718-125594740 TTCAGTGACTGATTGATGCAAGG + Intergenic
1200351935 X:155506211-155506233 ATCAGTTACAACTTTAGCCATGG + Intronic
1202019809 Y:20452629-20452651 AAAAGGTACAGCTTGATCCATGG + Intergenic
1202162707 Y:21952233-21952255 TTCAGTTTCAGGTTGGTCCCAGG + Intergenic
1202228649 Y:22634135-22634157 TTCAGTTTCAGGTTGGTCCCAGG - Intergenic
1202314508 Y:23562032-23562054 TTCAGTTTCAGGTTGGTCCCAGG + Intergenic
1202387973 Y:24343149-24343171 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1202482814 Y:25326979-25327001 TTCAGGCATGGCTTGATCCAGGG - Intergenic
1202556294 Y:26108563-26108585 TTCAGTTTCAGGTTGGTCCCAGG - Intergenic