ID: 1104665054

View in Genome Browser
Species Human (GRCh38)
Location 12:130641929-130641951
Sequence GCTTATCTATAGAGTCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104665054_1104665062 11 Left 1104665054 12:130641929-130641951 CCACCCTGACTCTATAGATAAGC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1104665062 12:130641963-130641985 TTGTACAGATGAGAAAACTGAGG 0: 19
1: 522
2: 3057
3: 8730
4: 16459
1104665054_1104665063 21 Left 1104665054 12:130641929-130641951 CCACCCTGACTCTATAGATAAGC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1104665063 12:130641973-130641995 GAGAAAACTGAGGCAACCAGAGG 0: 1
1: 1
2: 27
3: 338
4: 1959

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104665054 Original CRISPR GCTTATCTATAGAGTCAGGG TGG (reversed) Intronic
905247569 1:36625593-36625615 GCTTAGGCATAGAGTCTGGGGGG + Intergenic
906245435 1:44270208-44270230 ACTTATCTATTGAGTCTGAGAGG - Intronic
906537433 1:46559296-46559318 GCTGCTCTAGAGAGTCAGGTAGG + Intronic
907439707 1:54471667-54471689 GTTTAACTATCGACTCAGGGAGG + Intergenic
908061468 1:60354562-60354584 TCTCATCTATAGAGTGAGAGTGG + Intergenic
912274561 1:108242534-108242556 GATTTTCTATACAGTCAGGAAGG + Intronic
912286706 1:108377324-108377346 GATTTTCTATACAGTCAGGAAGG - Intronic
912293658 1:108451807-108451829 GATTTTCTATACAGTCAGGAAGG - Intronic
915224452 1:154402275-154402297 CCTTATCTAAAAAGTGAGGGAGG + Intergenic
923235517 1:232029435-232029457 GCTTATCTAGAGATTCAGAGAGG + Intronic
923638119 1:235721994-235722016 GCTACTTTATAGAGTCAGGGAGG + Intronic
1065041976 10:21706398-21706420 CCTCATCTATAAAGTGAGGGTGG - Intronic
1072029067 10:91499592-91499614 GTTTATCTCTAGAGTTATGGTGG + Intronic
1074654432 10:115568827-115568849 GTTTATCTATGAAGGCAGGGAGG - Intronic
1078583814 11:12562315-12562337 CCTTATTTATAAAGTCAAGGTGG + Intergenic
1080729326 11:34933067-34933089 GGTTATCTACAGAGTAATGGAGG + Intronic
1085474187 11:76779344-76779366 CCACATCTACAGAGTCAGGGTGG + Intergenic
1104665054 12:130641929-130641951 GCTTATCTATAGAGTCAGGGTGG - Intronic
1106369033 13:29113438-29113460 GCTGATCTAAAGAGACAGGAGGG - Intronic
1109459910 13:62643235-62643257 GGTTATGAATTGAGTCAGGGTGG - Intergenic
1114468274 14:22940395-22940417 GGTTATCTAAAGAGTAAGGTTGG - Intergenic
1121222450 14:92296763-92296785 GTTTATCTGCAGAGTCAAGGCGG - Intergenic
1121347219 14:93144943-93144965 GCTTATCTGGGGAGTCAGGCAGG + Intergenic
1125704805 15:41724593-41724615 GATGATCTCTTGAGTCAGGGAGG + Intronic
1133061426 16:3177293-3177315 GGTAATCGAAAGAGTCAGGGTGG - Intergenic
1138573310 16:57890009-57890031 CCTTATCTAGAGAAACAGGGTGG - Intronic
1145958609 17:28872355-28872377 GCTGATGAATAGAGTTAGGGAGG - Intergenic
1151098923 17:71533041-71533063 GCTTTTATAGAGAGTCTGGGAGG + Intergenic
1152201443 17:78949050-78949072 ACTTTTCTATAGAGACAGGTGGG + Intergenic
1153547264 18:6220492-6220514 TATTATATAGAGAGTCAGGGTGG - Intronic
1155663217 18:28276739-28276761 GCGTATGTAGGGAGTCAGGGTGG - Intergenic
1157679973 18:49597416-49597438 GGTTATCTATAGATTGGGGGTGG + Exonic
1161328518 19:3675044-3675066 GCTGATCCAGAGAGACAGGGAGG + Intronic
1162630479 19:11923687-11923709 GCTTATGTATAAAGTGGGGGAGG - Intergenic
1163047475 19:14654813-14654835 ACTTATCTAGAGTGACAGGGAGG - Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
1173076159 20:39821792-39821814 GTCTACCTATAGAGTCAGGTAGG - Intergenic
1177281246 21:18985555-18985577 GCTTATCAACACAGTCAGAGGGG - Intergenic
1177904296 21:26956741-26956763 GCTTATTTATAGAGTAAGAAGGG - Intronic
1185141885 22:49107084-49107106 GCCTTTCCATGGAGTCAGGGTGG + Intergenic
952097922 3:29977297-29977319 AATTATTTATAGAGCCAGGGAGG - Intronic
952638317 3:35558097-35558119 TCTTATCTAGAGATTCTGGGTGG - Intergenic
955523882 3:59801722-59801744 GCTTGTCTGTACAGTGAGGGTGG - Intronic
960428612 3:117540835-117540857 GCTAACCTATAAAGTCAAGGTGG + Intergenic
961148537 3:124616247-124616269 GCTTAATTATAGAGGCTGGGGGG - Intronic
962324186 3:134419625-134419647 ACCTCACTATAGAGTCAGGGAGG - Intergenic
964780887 3:160336521-160336543 TGTTATCTATAGAGAGAGGGAGG - Intronic
964938661 3:162126906-162126928 GTGTGTCTACAGAGTCAGGGTGG - Intergenic
973158514 4:46988288-46988310 GCTTAGCTATAAAGTCTGTGAGG + Intronic
981609114 4:146573412-146573434 GCTTATCTATATACTGAGTGAGG + Intergenic
985977593 5:3433238-3433260 GCTGAGCTATAGAGTGAGGCTGG + Intergenic
987287412 5:16470744-16470766 ACTTAACTGTAGAGTCAGGAGGG + Intergenic
990244264 5:53848355-53848377 GCTTATCTATATACTGAGTGAGG + Intergenic
993306751 5:86283971-86283993 GATTTTCTATACAGTCAGGAAGG - Intergenic
993538290 5:89115952-89115974 GATTATCTATAGAGTGAGTGGGG + Intergenic
994812193 5:104534319-104534341 TCATATCTATAGAGACAGAGAGG - Intergenic
996347781 5:122505936-122505958 GCTTATCTGAATAGTCAGGAAGG - Intergenic
1001385896 5:171338420-171338442 GGTTATCCAGTGAGTCAGGGTGG + Intergenic
1001465672 5:171963434-171963456 GCTTAATTAGAGAGACAGGGAGG + Intronic
1001532637 5:172474934-172474956 GCTTATTTACATTGTCAGGGAGG + Intergenic
1003589099 6:7422068-7422090 ACTTTTCTTTAGAGACAGGGTGG - Intergenic
1010340198 6:74741351-74741373 AATTATCTATAAAGTCAAGGAGG + Intergenic
1011701772 6:89961920-89961942 GCTTATCAATAGATACTGGGAGG - Intronic
1013246399 6:108291265-108291287 TCTTATCTATAAAATTAGGGTGG - Intergenic
1013944205 6:115703524-115703546 GCTTATCCAGAGATTCTGGGCGG + Intergenic
1016866633 6:148773961-148773983 GCTTCTTTATAAAGTCGGGGAGG - Intronic
1018916115 6:168133475-168133497 GCTTATCCAGGGGGTCAGGGGGG - Intergenic
1019564100 7:1671060-1671082 GCTTGTCTTTAGAGGCAGGTTGG - Intergenic
1026439588 7:70432474-70432496 GCTGTTTTATAGAGTCAGTGTGG - Intronic
1027417210 7:77985878-77985900 GCTTATCTCTTAAGTCAGTGAGG + Intergenic
1035016261 7:155769066-155769088 ATTTATCTATAGACTCAGTGAGG + Intronic
1036286085 8:7445184-7445206 GCTTCTCTGCAGAGTGAGGGAGG + Intronic
1036335389 8:7866345-7866367 GCTTCTCTGCAGAGTGAGGGAGG - Intronic
1041946771 8:63452939-63452961 GCTTATCCAGAGAGTCATGGGGG + Intergenic
1046721760 8:117628106-117628128 GTATATGTATAAAGTCAGGGTGG + Intergenic
1047071897 8:121354453-121354475 GGTCATCTACAGAGTCAGAGAGG + Intergenic
1049305179 8:141899092-141899114 GCTTTTCCCTGGAGTCAGGGTGG + Intergenic
1055275478 9:74611200-74611222 GCTTAGCTTTAGAGGCAAGGGGG - Intronic
1059828105 9:118056588-118056610 GCTTAAGCATAGGGTCAGGGAGG - Intergenic
1060262655 9:122090221-122090243 GCTTATCTGTAAAGTAGGGGTGG - Intronic
1187260520 X:17681480-17681502 GCTTAACTACAGAGTCTGGGTGG + Intronic
1189144432 X:38641381-38641403 GCTTATCTTTACCTTCAGGGTGG + Intronic
1190816672 X:53935690-53935712 GCTCACCCACAGAGTCAGGGTGG + Intergenic
1193679824 X:84504542-84504564 GCTTAGCTACAGAGTGAGAGGGG - Intergenic
1198392005 X:136185558-136185580 GTTTATCTGTAAAGACAGGGAGG + Intronic