ID: 1104666380

View in Genome Browser
Species Human (GRCh38)
Location 12:130650094-130650116
Sequence TGGGGACTCGCAGGCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104666377_1104666380 -6 Left 1104666377 12:130650077-130650099 CCCTCGGGGAGACGCAGTGGGGA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1104666380 12:130650094-130650116 TGGGGACTCGCAGGCAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 228
1104666371_1104666380 9 Left 1104666371 12:130650062-130650084 CCAGTGTGGGGTGAACCCTCGGG 0: 1
1: 0
2: 1
3: 10
4: 67
Right 1104666380 12:130650094-130650116 TGGGGACTCGCAGGCAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 228
1104666369_1104666380 12 Left 1104666369 12:130650059-130650081 CCTCCAGTGTGGGGTGAACCCTC 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1104666380 12:130650094-130650116 TGGGGACTCGCAGGCAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 228
1104666378_1104666380 -7 Left 1104666378 12:130650078-130650100 CCTCGGGGAGACGCAGTGGGGAC 0: 1
1: 0
2: 3
3: 19
4: 141
Right 1104666380 12:130650094-130650116 TGGGGACTCGCAGGCAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 228
1104666364_1104666380 26 Left 1104666364 12:130650045-130650067 CCTGAGGACCTGCTCCTCCAGTG 0: 1
1: 0
2: 2
3: 26
4: 236
Right 1104666380 12:130650094-130650116 TGGGGACTCGCAGGCAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 228
1104666368_1104666380 18 Left 1104666368 12:130650053-130650075 CCTGCTCCTCCAGTGTGGGGTGA 0: 1
1: 0
2: 0
3: 19
4: 221
Right 1104666380 12:130650094-130650116 TGGGGACTCGCAGGCAACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104666380 Original CRISPR TGGGGACTCGCAGGCAACCA AGG Intronic
901064674 1:6489163-6489185 TTGGGACTAGCAGGCTCCCAGGG - Intronic
901451142 1:9337684-9337706 TGGGGACTCCCTGGCCACCGGGG + Intronic
904681904 1:32235046-32235068 TGGGGACTCGGAGCAAAGCATGG - Intergenic
904799473 1:33082333-33082355 GGGGGCCTCACAGGCCACCACGG + Exonic
907524339 1:55045491-55045513 TGGGGATACGAAGGCATCCAGGG + Intronic
910925050 1:92389235-92389257 TGGTGACACCCAGGCAAACAGGG + Exonic
911342155 1:96652110-96652132 TGGTGATACGCAGGCAAACAGGG + Intergenic
911399426 1:97356527-97356549 TGGTGACACCCAGGCAAACAGGG + Intronic
911399645 1:97358648-97358670 TGGTGACACCCAGGCAAACAGGG + Intronic
912675946 1:111680719-111680741 TGGTGACACCCAGGCAAACAGGG + Intronic
913058908 1:115186984-115187006 TGGGCACTTGAAGGCAGCCATGG - Intergenic
913607471 1:120479001-120479023 TGGTGACACCCAGGCAAACAGGG + Intergenic
913987876 1:143582574-143582596 TGGTGACGCCCAGGCAAACAGGG - Intergenic
914583721 1:149042833-149042855 TGGTGACACCCAGGCAAACAGGG - Intronic
915088924 1:153407836-153407858 TGGTGACACCCAGGCAAACAGGG + Intergenic
915227297 1:154420394-154420416 TGATGACTCACAGGCAGCCATGG - Intronic
915758072 1:158282479-158282501 TGGTGACACCCAGGCAAACAGGG - Intergenic
917401277 1:174652599-174652621 TGGTGATACGCAGGCAAACAAGG - Intronic
917464269 1:175261537-175261559 TGGTGACACTCAGGCAAACAGGG - Intergenic
918150807 1:181796779-181796801 TGGGGACTCCCAGTCAGCCTGGG - Exonic
919465241 1:197917397-197917419 TGGGAACTTGCAAGCAGCCAGGG + Exonic
919761885 1:201103372-201103394 TGGGGAGTCGCAGGAAAGGACGG - Intronic
921819096 1:219596207-219596229 TGGGTACTCGGAGGCAGGCAGGG - Intergenic
921981377 1:221262789-221262811 TGGTGACACCCAGGCAAACAGGG - Intergenic
923043232 1:230334578-230334600 GGGGGATTCTCAGGCAGCCAAGG - Intronic
1063962113 10:11315204-11315226 TGGCTACTCTCAGGCAACCAGGG - Intronic
1064231142 10:13529591-13529613 TGGGGACTCTCAGGAGGCCATGG + Intergenic
1064650375 10:17503052-17503074 TGGGGACTTGCAGACAAGCAAGG + Intergenic
1066755133 10:38703809-38703831 TGGTGACACTCAGGCAAACAGGG + Intergenic
1069348886 10:67502271-67502293 TGGTGATTCCCAGGCAAACAGGG - Intronic
1071170379 10:82857221-82857243 TGGGGAGAAGCAGGCAGCCATGG - Intronic
1071503497 10:86219470-86219492 TGGGGGCTTGCTGGCAGCCAAGG - Intronic
1071884649 10:89936813-89936835 TGGTGATACGCAGGCAAACAGGG - Intergenic
1076571986 10:131439118-131439140 TGGGGCCTGGCAGGCACCCCTGG - Intergenic
1076624278 10:131811924-131811946 TGGGGTCTCACAGGGATCCAGGG + Intergenic
1077318048 11:1928016-1928038 AGGGGGCTCCCAGGCAACCGAGG + Intronic
1078482700 11:11692378-11692400 TGGTGACACCCAGGCAAACAGGG + Intergenic
1079898211 11:26148935-26148957 TGGGGCCTTGGAGGCAGCCAGGG + Intergenic
1081377582 11:42377673-42377695 TGGGGATACCCAGGCAAACAGGG + Intergenic
1083509386 11:63193500-63193522 TGGTGACACCCAGGCAAACAGGG + Intronic
1084529458 11:69718371-69718393 TGGGGACTCACAGCCGACCGCGG + Intergenic
1084541392 11:69789182-69789204 AGGGTCCTCGCAGGCAGCCAAGG + Intergenic
1084929021 11:72538955-72538977 TGGGAACTCACAGGCACTCATGG - Intergenic
1085518715 11:77126005-77126027 TGGGGACTCCCAGGCCCCCGCGG - Exonic
1086907227 11:92432564-92432586 TGGTGACACTCAGGCAAACAGGG - Intronic
1093677708 12:21963043-21963065 TGGTGACACCCAGGCAAACAAGG + Intergenic
1095089707 12:38092186-38092208 TGCTGACTCCCAGGCAAACAGGG + Intergenic
1096024226 12:48347310-48347332 TGGGGAATTGCAGGAACCCAGGG + Exonic
1097831165 12:64225354-64225376 TGGGGACTCGCAGGGAAGGTTGG - Intergenic
1098638429 12:72812844-72812866 TGGGGATACCCAGGCAAACAGGG - Intergenic
1098780261 12:74677223-74677245 TGGTGACACCCAGGCAAACAGGG + Intergenic
1099025543 12:77460123-77460145 TGGGGATACCCAGGCAAACAGGG + Intergenic
1100907710 12:99320977-99320999 TGGGGATACTCAGGCAAACAGGG - Intronic
1104666380 12:130650094-130650116 TGGGGACTCGCAGGCAACCAAGG + Intronic
1106042286 13:26104361-26104383 TGGAGACACCCAGGCAAACAGGG + Intergenic
1108040005 13:46331150-46331172 AGGGGACTGGCAGGCAACCCAGG - Intergenic
1110071629 13:71185123-71185145 TGGTGATTCTCAGGCAAACAGGG + Intergenic
1110699210 13:78526905-78526927 TGGTGACCCCCAGGCAAACAGGG + Intergenic
1113839363 13:113350034-113350056 CGGGGACTCACAGGCAGTCACGG + Intronic
1114035888 14:18626877-18626899 AGGGGACTCGCTGGCAAGCCAGG + Intergenic
1114122751 14:19688145-19688167 AGGGGACTCGCTGGCAAGCCAGG - Intergenic
1114675761 14:24439305-24439327 TGGGGCCACTCAGTCAACCAGGG - Exonic
1115833014 14:37363414-37363436 TGGTGATACGCAGGCAAACAGGG - Intronic
1117576646 14:57105762-57105784 TGGTGACACCCAGGCAAACAGGG - Intergenic
1117930448 14:60836539-60836561 TGGGGATACCCAGGCAAACAGGG - Intronic
1119164777 14:72483195-72483217 TGGGGAATCGCAGCCAAACATGG - Intronic
1119195399 14:72713776-72713798 AGGGGAGTCGCAGGGAGCCAGGG - Intronic
1119476108 14:74930194-74930216 CAGGGACTGGCAGGAAACCATGG + Intergenic
1120781825 14:88492504-88492526 TGGGGACTCGGATGCAAACATGG + Intronic
1121431053 14:93888768-93888790 TGGGAACTCACTGGGAACCAGGG + Intergenic
1122122566 14:99562226-99562248 TGGGGACCCCCAGGTAGCCAGGG - Intronic
1122999855 14:105287505-105287527 TCGGGACGCGCAGACAACCTTGG + Intronic
1123693155 15:22856085-22856107 TGAGGACACTCAGGCAGCCATGG + Intronic
1124580657 15:30951898-30951920 TGGGGACAAGCAGTAAACCAAGG + Intronic
1124972406 15:34501155-34501177 TGCTGACTTGCAGGCAACAATGG + Intergenic
1125329910 15:38572894-38572916 TGGTGATACGCAGGCAAACAGGG - Intergenic
1127193796 15:56562251-56562273 TGGGGATACCCAGGCAAACAGGG + Intergenic
1128852424 15:70973282-70973304 TGGTGACACCCAGGCAAACAGGG - Intronic
1131142899 15:89992130-89992152 AAGGGTCTCCCAGGCAACCAAGG - Intergenic
1133143688 16:3767586-3767608 TGGGGAATGGCAGGCAAGAAAGG + Intronic
1133814242 16:9184272-9184294 TGGGGCCACGCAGGAACCCACGG + Intergenic
1135301695 16:21334315-21334337 TGGTGACACGCAGGCAAACAGGG - Intergenic
1137456784 16:48623664-48623686 AGGGCACTTCCAGGCAACCAGGG + Intergenic
1137585211 16:49660153-49660175 TGGGGGCTCCCAGGGATCCAGGG - Intronic
1138887010 16:61091605-61091627 TGGTGATTCCCAGGCAAACAGGG + Intergenic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1144758237 17:17693203-17693225 TGGGGACTCCCAGGTATCCCAGG - Intronic
1149055315 17:52356532-52356554 TGGTGACACCCAGGCAAACAGGG - Intergenic
1149595397 17:57862040-57862062 TGGGGCCACGGAGGCCACCAGGG + Exonic
1150090869 17:62323448-62323470 TGGTGACACCCAGGCAAACAGGG + Intergenic
1150486541 17:65547576-65547598 TGGGGACTGACATGCAGCCAAGG + Intronic
1151583034 17:74990874-74990896 GGGCCACTCACAGGCAACCAGGG - Intronic
1152551617 17:81033213-81033235 TGGAGGCTGGCAGGCAAACACGG - Intergenic
1155350630 18:24901990-24902012 TGGTGACACCCAGGCAAACAGGG + Intergenic
1156443775 18:37219115-37219137 TGGTGACACCCAGGCAAACAGGG - Intronic
1160340195 18:78083007-78083029 TGGGGAAGGGCAGGCAGCCAAGG - Intergenic
1160797089 19:950566-950588 TGGGGACCGGCAGGCAGGCAGGG + Intronic
1161796018 19:6387278-6387300 TGGGGACTCAGGGGTAACCAGGG - Intronic
1162066133 19:8126432-8126454 TGAGGCCTCCCAGGCACCCATGG - Intronic
1165891054 19:39112449-39112471 TGGGAGCTCGCAGGCAGGCAGGG + Intergenic
1166744109 19:45131899-45131921 TGTGGGGTCGCAGGCAACAAGGG - Intronic
1167315954 19:48762780-48762802 TGCTGTCTCGCAGGGAACCACGG + Intergenic
1167655048 19:50758379-50758401 TGGGGTCTCGGAGGGGACCAGGG + Intergenic
1168123586 19:54270267-54270289 TGGGGACTCACAGGGAACAATGG - Intronic
927182887 2:20459446-20459468 TGGTGACACCCAGGCAAACAGGG + Intergenic
930893777 2:56421897-56421919 TGGTGATACGCAGGCAAACAGGG + Intergenic
930951433 2:57147435-57147457 TGGTGATTCCCAGGCAAACAGGG + Intergenic
931633607 2:64322684-64322706 CGGGGGCTGGCAGACAACCAGGG + Intergenic
932019152 2:68064610-68064632 TGGTGACACCCAGGCAAACAGGG + Intronic
932578957 2:72981048-72981070 GGGGCACTCGCACGCGACCAAGG - Intronic
934318425 2:91948042-91948064 TGGTGACACTCAGGCAAACAGGG + Intergenic
935232256 2:101109151-101109173 GGGGGAGTCGCATGAAACCAGGG + Intronic
938367103 2:130743477-130743499 TGGGGACCAGCAGGCGTCCAAGG - Intergenic
938803550 2:134785705-134785727 TGGGCACTCCCAGGCAAGCCGGG + Intergenic
940528174 2:154844247-154844269 TGGTGACACCCAGGCAAACAGGG - Intronic
941532462 2:166686651-166686673 TGGTGATTCCCAGGCAAACAGGG + Intergenic
942958641 2:181803850-181803872 TGGTGACACCCAGGCAAACAGGG - Intergenic
943352577 2:186812701-186812723 TGGTGACACCCAGGCAAACAGGG + Intergenic
943367229 2:186977771-186977793 TGGGGATCCACAGGCCACCAAGG - Intergenic
945210789 2:207380490-207380512 TGGGGATACCCAGGCAAACACGG - Intergenic
945397881 2:209343194-209343216 TGGGGAGTCACAGGCAATCTTGG + Intergenic
946770612 2:223085010-223085032 TGGTGACTCATAGGCAAGCAAGG - Intronic
947588058 2:231369222-231369244 TGGGGAAATGCAGGCACCCATGG - Intronic
948547628 2:238743929-238743951 TGGGGACGCTCATGCAACAACGG + Intergenic
948942343 2:241202806-241202828 AGGGGCCTTGCAGGCAGCCAGGG + Intronic
1171039838 20:21750976-21750998 TGGTGACACCCAGGCAAACAGGG - Intergenic
1171273711 20:23836292-23836314 TGGTGACACTCAGGCAAACAGGG + Intergenic
1171368882 20:24647525-24647547 TGGGGGCTCACAGGCATCCATGG + Intronic
1171419751 20:25010112-25010134 TGGGGACGGGCAGGCTATCAGGG - Intronic
1173750499 20:45471560-45471582 GGGGGACTGGCAGCCCACCAAGG + Intronic
1173771719 20:45665720-45665742 TGGTGACACCCAGGCAAACAGGG - Intronic
1177042597 21:16132500-16132522 TGGTGATACGCAGGCAAACAGGG - Intergenic
1177297522 21:19196043-19196065 TGGGGACACTTAGCCAACCAAGG + Intergenic
1179912986 21:44460078-44460100 TGAGGACTTGCAAGCACCCACGG - Exonic
1179989875 21:44942243-44942265 TGAGGCCTCACAGGCAAACAGGG - Intronic
1180306609 22:11131724-11131746 TGGTGACACTCAGGCAAACAGGG + Intergenic
1180460009 22:15553931-15553953 AGGGGACTCGCTGGCAAGCCAGG + Intergenic
1180545127 22:16493907-16493929 TGGTGACACTCAGGCAAACAGGG + Intergenic
1180847867 22:18994271-18994293 TGGGGACTCCCAGGCCATCCTGG - Intergenic
1180953155 22:19729867-19729889 TGGGGGCTCCCAGGCAGCCAAGG - Intergenic
1182197114 22:28529772-28529794 TGGTGACACTCAGGCAAACAGGG + Intronic
949640345 3:6029605-6029627 TGGCGATTCCCAGGCAAACAGGG - Intergenic
950549586 3:13658079-13658101 TGGGGACTCCCAGGTAGCCGGGG + Intergenic
954218487 3:49137889-49137911 GGGGGAGTCACAGGAAACCATGG - Intergenic
955453875 3:59099814-59099836 TGGTGACACCCAGGCAAACAGGG - Intergenic
959249781 3:103927062-103927084 TGGAGTCTCGCTGGCTACCACGG - Intergenic
960653999 3:119982055-119982077 TGGTGATACACAGGCAACCAGGG + Intronic
961820866 3:129575048-129575070 TGGGGAGTCTCAGGCATCCCTGG - Intronic
962156956 3:132957551-132957573 TGGTGACACTCAGGCAAACAGGG + Intergenic
962191098 3:133312014-133312036 TGGTGATACGCAGGCAAACAGGG - Intronic
962366682 3:134791235-134791257 TGAGGGCTCTCAGGCACCCAAGG - Intronic
964910193 3:161771709-161771731 TACGGACTAGCAGGCAAGCAGGG + Intergenic
966536958 3:181046049-181046071 TGGTGACACCCAGGCAAACAGGG - Intergenic
966595851 3:181724244-181724266 AGGGAACTTGCAGGGAACCAGGG + Intergenic
967977413 3:195043252-195043274 TGGGGACTCGGAGGCATCTTGGG + Intergenic
969304214 4:6316508-6316530 TGGAGACTCTAAGGAAACCATGG - Intergenic
971673516 4:29594999-29595021 TGGTGATACCCAGGCAACCAGGG - Intergenic
971697978 4:29930478-29930500 TGGTGACACCCAGGCAAACAGGG + Intergenic
972500564 4:39674332-39674354 TGGTGACACCCAGGCAAACAGGG - Intergenic
974127597 4:57714938-57714960 TGGTGACACCCAGGCAAACAGGG + Intergenic
974184706 4:58430953-58430975 TGGAGAGTCTAAGGCAACCAAGG - Intergenic
975219380 4:71796969-71796991 TGGTGACACCCAGGCAAACAGGG - Intronic
976655829 4:87488394-87488416 TGGTGACACCCAGGCAAACAAGG - Intronic
976669596 4:87637010-87637032 TGGTGACACCCAGGCAAACAGGG + Intergenic
977906059 4:102478728-102478750 TGGTGACACCCAGGCAAACAGGG + Intergenic
977950928 4:102969330-102969352 TGGTGACACCCAGGCAAACAGGG + Intronic
979215661 4:118161142-118161164 TGTGGATACGCAGGCAAACAGGG - Intronic
979934138 4:126670576-126670598 TGGGGATACCCAGGCAAACAGGG + Intergenic
980774538 4:137421311-137421333 TGGGGACGCGCAGGAGCCCAGGG - Intergenic
980848655 4:138354488-138354510 TGGTGACACCCAGGCAAACAGGG - Intergenic
981002455 4:139840794-139840816 TGAGGGCTCGCTGGCCACCATGG - Intronic
981445891 4:144837561-144837583 TGGTGACACCCAGGCAAACAGGG + Intergenic
982825831 4:160002499-160002521 TGGTGATACGCAGGCAAACAGGG + Intergenic
985193919 4:187407731-187407753 TGGTGACACCCAGGCAAACAGGG - Intergenic
986583861 5:9294312-9294334 TGTGGACTTGCACACAACCATGG + Intronic
986656296 5:10016320-10016342 TGGTGACACCCAGGCAAACAGGG - Intergenic
987228850 5:15871150-15871172 TGGTGACACCCAGGCAAACAGGG + Intronic
988370716 5:30364515-30364537 TGGTGACACCCAGGCAAACAGGG - Intergenic
990660824 5:58013482-58013504 TGGGGGGTCTAAGGCAACCATGG - Intergenic
990849538 5:60187068-60187090 TGGGGACTCAAAGGGAAACAAGG + Intronic
991150354 5:63360664-63360686 TGGTGATACGCAGGCAAACAGGG - Intergenic
998780051 5:145646819-145646841 TGGTGATACGCAGGCAAACAGGG - Intronic
998934285 5:147217204-147217226 TGGTGATACGCAGGCAAACAGGG + Intergenic
1003165799 6:3677459-3677481 TGGTGACACCCAGGCAAACAGGG - Intergenic
1003987629 6:11452644-11452666 TGGTGATACCCAGGCAACCAGGG + Intergenic
1005341246 6:24845656-24845678 AGGGGACTTGCAGTCTACCAAGG + Intronic
1009566570 6:65318458-65318480 TGGGTACTCGGAGGCAGGCAGGG + Intronic
1010707240 6:79129301-79129323 TGGGGACTCGGGGGAAAGCATGG - Intergenic
1012498003 6:99855972-99855994 TGGTGACACCCAGGCAAACAGGG + Intergenic
1015046211 6:128779525-128779547 TGGTGACACCCAGGCAAACAGGG - Intergenic
1015109007 6:129569804-129569826 TGGTGACACCCAGGCAAACAGGG + Intergenic
1016241958 6:141940936-141940958 TGGTGATACGCAGGCAAACAGGG + Intergenic
1016436800 6:144046488-144046510 TGGTGACACCCAGGCAAACAGGG - Intronic
1016987403 6:149905573-149905595 TTGGGACTCGCTGGCTACCCGGG + Intergenic
1018805894 6:167259129-167259151 TGGTGACACCCAGGCAAACAGGG + Intergenic
1023763316 7:43487479-43487501 TGGGGAAAGGCAGGCCACCAAGG + Intronic
1024703269 7:51927802-51927824 TGGTGATTCCCAGGCAAACAGGG - Intergenic
1025637840 7:63339421-63339443 TGGTGACACCCAGGCAAACAGGG - Intergenic
1025644857 7:63408678-63408700 TGGTGACACCCAGGCAAACAGGG + Intergenic
1027637174 7:80689845-80689867 TGGTGACACCCAGGCAAACAGGG + Intergenic
1029116299 7:98239196-98239218 CGGGGCCTCCCAGGCCACCATGG - Intronic
1031574916 7:123403872-123403894 TGGTGACACCCAGGCAAACAGGG - Intergenic
1032957014 7:136983736-136983758 TGGTGACACCCAGGCAAACAGGG - Intronic
1036001658 8:4612039-4612061 TAGGGACACGCCGGGAACCATGG - Intronic
1036397443 8:8381339-8381361 TGGTGACTGGCTGGCAGCCAGGG - Intronic
1038221659 8:25614631-25614653 TGGTGACACTCAGGCAAACAGGG - Intergenic
1040284198 8:46091709-46091731 TAGGGACACACAGGCAACCGGGG - Intergenic
1041727570 8:61032213-61032235 TGGGGACAGGCAGGGCACCAGGG + Intergenic
1041909933 8:63078023-63078045 TGGTGACACCCAGGCAAACAGGG + Intronic
1043048697 8:75359132-75359154 TGGTGACTCCCAGGCAAACAGGG - Intergenic
1045619003 8:103952449-103952471 TGGTGACACCCAGGCAAACAGGG + Intronic
1047402548 8:124558719-124558741 TGTGGACACCCAGGCACCCATGG + Intronic
1049646223 8:143736995-143737017 TGGGAGCTCTCTGGCAACCAGGG - Intergenic
1051105351 9:13572961-13572983 TGGGGACTCGGTGGAAAGCATGG - Intergenic
1051734909 9:20188249-20188271 TGGGAACTCCAAGGAAACCAGGG - Intergenic
1058535108 9:105950625-105950647 TGGGGAATCCGAGGCAACCAAGG - Intergenic
1059405231 9:114095110-114095132 GGGGGACACGCAGGCCACCTGGG + Exonic
1059455855 9:114399733-114399755 TAGGGAGTAGCAGGCAACCTGGG - Intergenic
1060554183 9:124499952-124499974 TGGGGACCCGGAGGCCACCCTGG - Intronic
1061950814 9:133934978-133935000 TGGGGACTCCAGGGCTACCAGGG - Intronic
1062708324 9:137957423-137957445 TGGGGACTGGGAGGGACCCAAGG + Intronic
1186773217 X:12838657-12838679 TGGGGATACCCAGGCAAACAGGG - Intergenic
1187117488 X:16367459-16367481 TGGGGGCTCACAGTCTACCAAGG - Intergenic
1190647902 X:52540234-52540256 TGGGAACTCACAGGCAAAAAGGG + Intergenic
1191003720 X:55688409-55688431 TGGTGACACCCAGGCAAACAGGG - Intergenic
1191793873 X:65000282-65000304 TGGTGACACCCAGGCAAACAGGG + Intronic
1191808650 X:65163039-65163061 TGCTGACTCCCAGGCAAACAGGG - Intergenic
1191872852 X:65764692-65764714 TGGTGACACCCAGGCAAACAGGG - Intergenic
1192023780 X:67426662-67426684 TGGTGACACCCAGGCAAACAGGG - Intergenic
1192631020 X:72777796-72777818 TGGGGCCTGACAGGCGACCAGGG + Intronic
1192650689 X:72943005-72943027 TGGGGCCTGACAGGCGACCAGGG - Intronic
1193500607 X:82269601-82269623 TGGGGACTGTCAGGGTACCAGGG - Intergenic
1193733775 X:85132955-85132977 TGGTGACACCCAGGCAAACAGGG - Intergenic
1195098098 X:101525160-101525182 TGGGGATACCCAGGCAAACAGGG + Intronic
1195706680 X:107742657-107742679 AGGGGACTTGAAGGCATCCAAGG + Intronic
1196094593 X:111785250-111785272 TGGGGACACGCAGGTAAACAGGG + Intronic
1196152894 X:112393634-112393656 TGGGGAGTCCAAGCCAACCAGGG - Intergenic
1200407701 Y:2830126-2830148 TGGTGACACCCAGGCAAACAGGG + Intergenic
1201185978 Y:11403124-11403146 TGGTGACACTCAGGCAAACAGGG + Intergenic
1201393040 Y:13519578-13519600 TGGTGATACGCAGGCAAACAGGG - Intergenic
1202096205 Y:21250583-21250605 TGGTGACACCCAGGCAAACAGGG - Intergenic