ID: 1104668674

View in Genome Browser
Species Human (GRCh38)
Location 12:130666042-130666064
Sequence GACCCAAGGCTGGCAGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104668674 Original CRISPR GACCCAAGGCTGGCAGTGAG TGG Intronic
900269392 1:1779150-1779172 ATCCCAAGGCTGGCAGTGGAGGG + Intronic
900358808 1:2278151-2278173 GACCCAAGGCTGGGAGCAAGTGG - Intronic
902443777 1:16448555-16448577 GAACTCAGGCTGCCAGTGAGTGG + Intronic
903046295 1:20566546-20566568 GATCCAAGGAGGGGAGTGAGTGG + Intergenic
903583459 1:24390030-24390052 GAGCCAAGGCATGGAGTGAGGGG - Intronic
903667454 1:25016769-25016791 TAGCCAAGTCTGGCAGTGTGTGG - Intergenic
904281061 1:29418520-29418542 GACCAAAGGTGGGCAGTTAGGGG - Intergenic
904399982 1:30249823-30249845 GACACAAAGCTGGAAGTCAGGGG + Intergenic
904775180 1:32901705-32901727 GGCCCAAGGCTGGGACGGAGAGG + Intergenic
904826083 1:33274629-33274651 GCCCTCAGGCTGGGAGTGAGGGG + Intronic
907242593 1:53088985-53089007 GAGCCAAGGTTGGGGGTGAGTGG + Intronic
908107345 1:60858647-60858669 GACCACAGGCTGGCAGTGAGCGG - Intergenic
908541458 1:65126438-65126460 GAGCCAGAGCTTGCAGTGAGTGG + Intergenic
910684953 1:89906634-89906656 GACCCAAGGCTGGCATTCTTTGG + Intronic
911170333 1:94764726-94764748 GACCTAAGGGAGTCAGTGAGGGG - Intergenic
912668469 1:111604382-111604404 GATCAAAGCATGGCAGTGAGGGG - Intronic
915713081 1:157919956-157919978 CACCCAATGCTGTCAGTGTGTGG - Intergenic
916972404 1:170037698-170037720 GAGCCAAAGGTTGCAGTGAGCGG + Intronic
917054862 1:170969968-170969990 GACCCAAGGTAGGCTGAGAGAGG - Intronic
917245729 1:172998298-172998320 CACCCAAGACTGGAAATGAGGGG - Intergenic
918587441 1:186204064-186204086 GGCCCAAGGATGGCAGTGAATGG + Intergenic
918912296 1:190590559-190590581 AACCTAAGGCAGGCAGTAAGTGG + Intergenic
920174892 1:204094545-204094567 GGCCCAATGCGGGCAGAGAGAGG + Intronic
920211880 1:204334241-204334263 GAGCCAAGGGTGGCAGGGAGAGG + Intronic
921223112 1:212988366-212988388 GAGCTAAGGCTGGCAGGGTGGGG + Intronic
921925242 1:220705702-220705724 GACCAGGGGCTGGCAGGGAGAGG + Intergenic
923964297 1:239119536-239119558 TACCCAAGGTTGGTAGAGAGTGG + Intergenic
1063009989 10:2012330-2012352 GTCCCAAAGCTGGCAGGCAGAGG + Intergenic
1065566642 10:27018203-27018225 GAGGCAAAGCTTGCAGTGAGTGG - Intronic
1066049464 10:31620580-31620602 CACCCAAGGCTGGGGGTGACAGG - Intergenic
1067165627 10:43864423-43864445 CACCCAAGGCAGGCAGTGGTGGG - Intergenic
1067439624 10:46301302-46301324 GACCCCAGGCTTGCCCTGAGGGG + Intronic
1067581732 10:47450674-47450696 GACCCAATGCTTGCACTGAGGGG + Intergenic
1068361340 10:55977650-55977672 GACCTAAGGGTGGCAGTTTGAGG - Intergenic
1069550272 10:69359475-69359497 GACCCAGGGCAGGCACTGGGTGG + Intronic
1069552501 10:69374381-69374403 GACCACAGACAGGCAGTGAGAGG - Intronic
1070590054 10:77794980-77795002 GAGCCCTGGCGGGCAGTGAGGGG + Intronic
1072796735 10:98361723-98361745 GACCCCAGGCTGTCAGAGAAGGG - Intergenic
1073716536 10:106114608-106114630 CAGCCAAGGGAGGCAGTGAGAGG + Intergenic
1074612648 10:115036885-115036907 GAACCCAGGCTGATAGTGAGAGG + Intergenic
1077229308 11:1451454-1451476 GACACCAGGCTGGCCGGGAGAGG + Intronic
1077317131 11:1924665-1924687 GAAACAAGGCTGGCACTGAGGGG - Intronic
1077536755 11:3128277-3128299 GCCCCAAAGCAGGCAGTGGGAGG + Intronic
1078335955 11:10463369-10463391 AACACAAGGCTGGCACTCAGAGG - Intronic
1079085587 11:17442688-17442710 CACCCAGGGCTGGCTGTGTGGGG + Intronic
1081165992 11:39809885-39809907 TAGCCAAGGCAAGCAGTGAGGGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083296454 11:61718050-61718072 GGTCCAAGGGTGGGAGTGAGAGG + Intronic
1083754578 11:64784139-64784161 GAGGCAGGGGTGGCAGTGAGTGG + Intergenic
1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG + Intronic
1084514255 11:69627623-69627645 GAGCCCAGGATGGCAGTGGGAGG + Intergenic
1084742470 11:71148510-71148532 GACCCAGGGATGGCAGGGACTGG + Intronic
1085204068 11:74719855-74719877 GACCCAGGGCTGGAGGTGAGTGG - Intronic
1085582522 11:77667256-77667278 GACCCTAGGCTGGCTGTCACGGG + Exonic
1086633348 11:89051183-89051205 GAGGCAGGGCTTGCAGTGAGTGG + Intronic
1088570504 11:111219161-111219183 GGCCCAAAGCTGGTAGTGGGTGG - Intergenic
1089201785 11:116729019-116729041 GACATGAGGCTGGCAGAGAGGGG + Intergenic
1090425860 11:126606678-126606700 GGTTCAAGGTTGGCAGTGAGGGG + Intronic
1090617651 11:128530453-128530475 AGTCCAGGGCTGGCAGTGAGAGG + Intronic
1091113893 11:132996027-132996049 GACCCATGGATGGCAGGGGGAGG - Intronic
1091173620 11:133540521-133540543 GACCCAGGCCTGGGAATGAGAGG - Intergenic
1092371400 12:7919490-7919512 GACGCAGGGGTTGCAGTGAGCGG - Exonic
1094646412 12:32328847-32328869 GGCTGAAGCCTGGCAGTGAGTGG + Intronic
1095970820 12:47901058-47901080 ACCCCAAGGCTGGCTGGGAGAGG - Intronic
1096656518 12:53096048-53096070 GAACCAAGGCTGTCAGAGATGGG - Intergenic
1097186202 12:57197857-57197879 GACATGAGGCTGGCAGCGAGGGG - Intronic
1097232966 12:57523148-57523170 GGCAGAAGTCTGGCAGTGAGAGG - Intronic
1099854024 12:88141791-88141813 GACCCGAGGCTGGAAGGGCGGGG + Intronic
1100883739 12:99046507-99046529 GACCCAAGTCTGGCCGGGTGCGG + Intronic
1103561910 12:121797321-121797343 GCCCCAGGGCTTGCAGAGAGAGG - Intronic
1103944002 12:124516321-124516343 GGCCCAGGGCTGGCACGGAGGGG + Intronic
1104287821 12:127441218-127441240 GCCAAAAGGCTGGCAGGGAGTGG + Intergenic
1104668674 12:130666042-130666064 GACCCAAGGCTGGCAGTGAGTGG + Intronic
1106385132 13:29277105-29277127 GAGGCAAGGCTGGCAGTTAGTGG - Intronic
1106516032 13:30454914-30454936 AACCCAGGCCTGGAAGTGAGGGG + Intergenic
1107055084 13:36094514-36094536 TACCCATGACTGGCAGTTAGTGG - Intronic
1107634696 13:42380557-42380579 AAACCAGGGCTGGCAGTGAGTGG - Intergenic
1109217788 13:59609824-59609846 GACCCAAGACTGGTTGTGGGAGG + Intergenic
1109894584 13:68667929-68667951 CACACAAGGCTGAGAGTGAGGGG - Intergenic
1113065749 13:106372909-106372931 GACCGAATGCTGGGAATGAGTGG + Intergenic
1113521504 13:110945415-110945437 GCCCCAAGGGTGGGAGTGAGTGG + Intergenic
1116858937 14:49978532-49978554 GAGTCAAGGGAGGCAGTGAGGGG + Intergenic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1117679084 14:58184871-58184893 GACGCGAAGCTTGCAGTGAGAGG - Intronic
1119704563 14:76775785-76775807 ACCCCAAGGCTGGCGGTGCGTGG + Intronic
1120626455 14:86832232-86832254 GACCCAATGGTGGCAGTAAAAGG - Intergenic
1128548263 15:68581542-68581564 GGCCCAAGGATGGAAGTGACTGG - Intronic
1129328185 15:74812975-74812997 GGCCCAAGGCTGGCATTGCCTGG + Exonic
1129350830 15:74955210-74955232 GACGCAAGGCTGGAGGGGAGGGG + Exonic
1130518664 15:84645617-84645639 GAGCCAAGGCTGGCAATGCTGGG + Exonic
1130949389 15:88573529-88573551 GAGCCAAGGCTGGCCGGGTGTGG - Intergenic
1131553196 15:93375341-93375363 GCCCCAAGGCTGGGGATGAGGGG + Intergenic
1131838793 15:96415531-96415553 GGCCCAAGGCTGGAGGTGGGTGG + Intergenic
1132780683 16:1623221-1623243 AGCCCAAGGCTGGGTGTGAGGGG - Intronic
1132894381 16:2221246-2221268 TACCCAGGGCTGGCAGGGAGGGG + Intergenic
1133003120 16:2861051-2861073 GAGGCCAGGCTGGCAGGGAGTGG - Intergenic
1134509570 16:14835020-14835042 GTTCCAGGGCTGGCAGTGAAGGG + Intronic
1134697275 16:16233836-16233858 GTTCCAGGGCTGGCAGTGAAGGG + Intronic
1134974571 16:18560838-18560860 GTTCCAGGGCTGGCAGTGAAGGG - Intronic
1136283641 16:29229065-29229087 TACCCATGGCTAGCAGTGACAGG + Intergenic
1136375408 16:29862553-29862575 ACCCCAAGGCTGGCTGAGAGGGG + Intronic
1138453489 16:57107319-57107341 GAACAAAGGCTGGGAGGGAGGGG + Intronic
1138591581 16:58001968-58001990 GACCCCAGCCTGGCAGGGAGTGG - Intronic
1139303516 16:65964381-65964403 GACCGAGGTCTGACAGTGAGAGG - Intergenic
1139409537 16:66748192-66748214 GACCCGAGGCTGGGAGGCAGAGG + Intronic
1139922271 16:70467759-70467781 GACGCAAGGCTGGCAGTTGCTGG - Intronic
1140287605 16:73619415-73619437 GAGGCAGAGCTGGCAGTGAGCGG + Intergenic
1141651362 16:85394820-85394842 GAGCCAGGGCTGGCATGGAGGGG - Intergenic
1141711854 16:85704370-85704392 GAGGCAAAGCTTGCAGTGAGCGG - Intronic
1141733010 16:85834857-85834879 GACCCAAGCAAGCCAGTGAGGGG + Intergenic
1142088673 16:88198576-88198598 TACCCATGGCTAGCAGTGACAGG + Intergenic
1143618246 17:8066144-8066166 GAGGCAAAGCTAGCAGTGAGCGG + Intergenic
1145265700 17:21378672-21378694 GACCCAGAGCTGGCAGGTAGGGG + Intronic
1145961078 17:28886853-28886875 GCCCCAGGGCTGGCACTGTGGGG - Intronic
1146723108 17:35137142-35137164 GCTCCAAGGATGGCAGTGTGCGG - Exonic
1147138443 17:38448206-38448228 AACCTGAGGCTGGCAGTGGGAGG + Intronic
1148232429 17:45944761-45944783 GACCCAAGGGTGCCTCTGAGAGG + Intronic
1151448456 17:74182327-74182349 GTCCCATGGCCGGCAGTGATAGG + Intergenic
1152580092 17:81162043-81162065 GACCCATGCCTGGGAGTGTGGGG + Intronic
1153051886 18:908010-908032 GCCCAAAGAGTGGCAGTGAGTGG + Intronic
1155073268 18:22334576-22334598 TAGCCAAGGCTGGAGGTGAGTGG + Intergenic
1156271755 18:35541329-35541351 GACCTAACTCTGGCAGTAAGAGG - Intergenic
1156295322 18:35784163-35784185 GCTCCAAGGCAGGCAGGGAGTGG - Intergenic
1157113498 18:44842690-44842712 GACCCAAGGGTGGCAGAGGCAGG + Intronic
1157313563 18:46570410-46570432 GACCCTACGGTGTCAGTGAGTGG - Intronic
1157535203 18:48452655-48452677 GTCCCCAGGCTGGCAGTGTGGGG - Intergenic
1158836399 18:61334745-61334767 GAGACCAGGCTGGAAGTGAGAGG + Intronic
1159887667 18:73924448-73924470 GACCACTGGCTGGCAGGGAGCGG + Intergenic
1160027584 18:75231173-75231195 GCCCCAAGCCTGGCACAGAGTGG + Intronic
1160379330 18:78439619-78439641 GCCCTAAGGGTGGCAGTAAGTGG - Intergenic
1160731940 19:645156-645178 GTCCCCAGGTTGGCAGTGTGAGG + Intergenic
1160904500 19:1446034-1446056 GATCCAAGGATGGGAGAGAGGGG - Intergenic
1162129553 19:8517639-8517661 GACCCAAGGAAGGAAGGGAGAGG + Intergenic
1162737296 19:12753706-12753728 GCCCCCAGGCTGGAATTGAGAGG - Intronic
1162813391 19:13178512-13178534 GACGCAGAGCTTGCAGTGAGTGG - Intergenic
1163827908 19:19533871-19533893 GACCCAAGACTGGGACTGAGGGG - Intronic
1165353445 19:35290102-35290124 GAGGCGGGGCTGGCAGTGAGCGG - Intergenic
1165410447 19:35657431-35657453 GCCCCACAGCTGGAAGTGAGTGG - Intronic
1165422539 19:35729394-35729416 GACCTCAGCCTGGCAGTGAAAGG - Intronic
1165797660 19:38528240-38528262 CATCCAGGGCTGGGAGTGAGAGG + Intronic
1165906146 19:39196149-39196171 GGCACAAAGATGGCAGTGAGAGG - Intergenic
1166257120 19:41614756-41614778 CACGCAAGGCTGACAGTGAGTGG + Intronic
1166335742 19:42105851-42105873 GCCCCCAGGCAGGCAGAGAGGGG + Intronic
1166409378 19:42546685-42546707 CACTGAAGGCTGACAGTGAGTGG + Intronic
1166698054 19:44865466-44865488 GCCCGAAGCCTGGCAGCGAGCGG + Exonic
1166873037 19:45882430-45882452 GAGCCCAGGCTGGCAGTGCCAGG + Intergenic
1168283702 19:55320220-55320242 GACCCAGGGAGGGAAGTGAGGGG + Intronic
926091398 2:10052411-10052433 GATCCCAGGCTGGCAGGCAGAGG + Exonic
927978220 2:27356518-27356540 GACCCGAGGCTTGCAGAGATGGG + Intronic
927990402 2:27443060-27443082 GACCCAGTGCTGGCAGGGACAGG - Exonic
928005854 2:27560970-27560992 TACCCAAGGTTAGGAGTGAGTGG + Intronic
931732072 2:65162099-65162121 GAAGCAAGGGTTGCAGTGAGCGG - Intergenic
932432647 2:71685142-71685164 GACCACAGGCTGGAAGTGACTGG - Intronic
933966989 2:87438083-87438105 GAACTAAGGCTGGCATGGAGGGG - Intergenic
934317722 2:91940719-91940741 GAGCCAGGGCGGGCACTGAGTGG - Intergenic
934498338 2:94831738-94831760 GAGGCAAAGCTTGCAGTGAGCGG - Intergenic
934561898 2:95317837-95317859 GGCCCAAGGATGGCAGGGTGCGG + Intronic
935181919 2:100699337-100699359 GAAACAAGCCTGGCACTGAGGGG + Intergenic
935581424 2:104758915-104758937 AAACCAAGGCTGGCTGTCAGAGG - Intergenic
935729851 2:106056281-106056303 GACCCATGGGTGGCTGTCAGCGG + Intergenic
936326808 2:111512414-111512436 GAACTAAGGCTGGCATGGAGGGG + Intergenic
937320098 2:120955929-120955951 GAGCCAGTGCTGGCAGTGAGGGG + Intronic
937825537 2:126364971-126364993 GACACAAAGCTGGCAATGAATGG + Intergenic
939611354 2:144314640-144314662 GAGGCAAAGCTTGCAGTGAGTGG + Intronic
940696992 2:156991937-156991959 GCCCCCAGGCTGGAAGTCAGTGG - Intergenic
942360992 2:175171312-175171334 GACCCTGAGCTGGCAGAGAGAGG - Intergenic
945219194 2:207466896-207466918 GAGCCATGGCTGCCAGAGAGAGG + Intergenic
946173767 2:217910465-217910487 GCCCCAAGGCTGGAAGTGTTGGG - Intronic
947105547 2:226664354-226664376 AACCCAAGGCAGGAAGAGAGAGG - Intergenic
947622230 2:231598041-231598063 GAACTCAGGCTGGCAGGGAGGGG + Intergenic
947842381 2:233216325-233216347 GACCTAAGGGTGGCAGTTTGAGG + Intronic
948125972 2:235564925-235564947 GACCCACAGCTGGCCGTGAGTGG - Intronic
1168932038 20:1631687-1631709 ACCTCAGGGCTGGCAGTGAGTGG + Intronic
1170711801 20:18797971-18797993 AACATAAGGCTGGTAGTGAGGGG - Intergenic
1170801741 20:19596049-19596071 GACCCAAGGCTGGACATGATCGG - Intronic
1171399086 20:24860068-24860090 GAGCCAAGGCAGGCAGTCACTGG - Intergenic
1173950772 20:46991677-46991699 GACTGAAGGCTGGCTGGGAGCGG + Intronic
1173981474 20:47227349-47227371 CAACCACGGCTGGCTGTGAGGGG + Intronic
1175379851 20:58555317-58555339 GTACCAAGGCTGGCAGTGGGAGG - Intergenic
1176109162 20:63403364-63403386 GCTCCAAGGCTGGAAGTGCGAGG + Intergenic
1176377247 21:6092729-6092751 GGGCCCAGGCTGGAAGTGAGAGG - Intergenic
1179722959 21:43325748-43325770 ACCCCAAGGCATGCAGTGAGTGG + Intergenic
1179746228 21:43445515-43445537 GGGCCCAGGCTGGAAGTGAGAGG + Intergenic
1180833724 22:18919412-18919434 GCCCCAGGGCAGGCAGGGAGGGG + Intronic
1181066106 22:20306842-20306864 GCCCCAAGGCAGGCAGGGAGGGG - Intergenic
1181086083 22:20440024-20440046 GCCCCAAGGCTGACAGTGGCAGG + Intronic
1182624501 22:31635935-31635957 GGCCCCATGCTGGCAGGGAGTGG - Intronic
1183091744 22:35526972-35526994 GACCCAAGGCCAGCAAAGAGTGG - Intergenic
1183806190 22:40213288-40213310 GACACAAAGCCTGCAGTGAGAGG + Intronic
1184067093 22:42127193-42127215 GACCCAACGCCTGCAGGGAGAGG - Intronic
1184689004 22:46109004-46109026 GACCCAAGCCTGTCCTTGAGTGG - Intronic
1184986622 22:48140364-48140386 GAGCCAGGGGTGGGAGTGAGAGG + Intergenic
1185143375 22:49116404-49116426 GTCCCGCGGCAGGCAGTGAGAGG - Intergenic
1203283810 22_KI270734v1_random:144710-144732 GCCCCAGGGCAGGCAGGGAGGGG + Intergenic
951491006 3:23270449-23270471 GAACCAAGGCTTGGAGTTAGGGG + Intronic
952254355 3:31682539-31682561 GACCCAAAGCGGGCAAAGAGGGG - Intronic
952834001 3:37588915-37588937 GACCCAAGGCTGGGTCTGAGTGG + Intronic
952996677 3:38889727-38889749 GAGCCAGAGCTTGCAGTGAGCGG + Intronic
956662078 3:71608869-71608891 TACCAAAGGCTGGGGGTGAGGGG + Intergenic
957369975 3:79280906-79280928 GTCGCATAGCTGGCAGTGAGTGG - Intronic
960015906 3:112887529-112887551 GTCTCAAGGCTGGCAGAGACAGG + Intergenic
960735302 3:120772868-120772890 CATCCAAGGCCTGCAGTGAGTGG - Intronic
961173881 3:124818322-124818344 GTCCCAAGGCAGGCAGAGGGTGG - Intronic
961225353 3:125239909-125239931 GACCCAGGGCTGGAAGGGAGTGG + Intronic
961516250 3:127439189-127439211 GTGCCAGAGCTGGCAGTGAGAGG + Intergenic
961862988 3:129932552-129932574 ACCCCAAGGCAAGCAGTGAGGGG + Intergenic
961920345 3:130418762-130418784 GACTCAAGGTTCTCAGTGAGGGG - Intronic
962866818 3:139453954-139453976 GAAGCAAGGCTGGCTGTGAAGGG + Intronic
967795449 3:193593754-193593776 GAGCCAAACCTGGCAGGGAGAGG - Intronic
971171055 4:24233059-24233081 GGCCCAAGGCAGGCAGTGCTGGG - Intergenic
972347414 4:38204346-38204368 GACCCCAAGCTATCAGTGAGGGG - Intergenic
972599595 4:40560516-40560538 GACCAAAGGCTGGCACTGCCGGG - Intronic
976342246 4:83958415-83958437 GAGGCAGAGCTGGCAGTGAGCGG - Intergenic
976480909 4:85544058-85544080 GGCAAAAGGCTGGCAGTGGGAGG - Intronic
977418140 4:96762169-96762191 GACCTATGCCTGGAAGTGAGAGG - Intergenic
978536624 4:109769872-109769894 GACCCAAGGCTGGAGGTGCCTGG - Intronic
979872256 4:125838448-125838470 GAGGCAAAGCTTGCAGTGAGCGG - Intergenic
982066328 4:151657762-151657784 GAAACAAGACTGGCAGTGAGCGG + Intronic
985675045 5:1226630-1226652 GCCCCGAGGGTGGCAGTGACGGG - Intronic
986861360 5:11929947-11929969 TACCCAAGGCTAATAGTGAGGGG + Intergenic
987225598 5:15837701-15837723 GAGCCAAGGATGGCAGCCAGAGG + Intronic
991130912 5:63121390-63121412 GAGGCAAGGAAGGCAGTGAGGGG + Intergenic
994834786 5:104835507-104835529 GAGGCAGAGCTGGCAGTGAGCGG + Intergenic
997487550 5:134244143-134244165 GAGCCAAGGCTGGCAATATGTGG - Intergenic
997883495 5:137611359-137611381 TCCCCCAGGCTGGCAGTGGGAGG + Intergenic
998382717 5:141737198-141737220 GACCCCAAGGGGGCAGTGAGAGG + Intergenic
998513852 5:142735577-142735599 GCCGCAAGGCAGGCAGAGAGAGG + Intergenic
998854258 5:146379164-146379186 GGCAGAAGGCTGGCAGTGAATGG + Intergenic
999153832 5:149443977-149443999 GTCCCAAGGCGGGCTGTGAGAGG + Intergenic
999971225 5:156865556-156865578 GTCCCCAGGCTGGCAGGCAGTGG + Intergenic
1001614506 5:173031746-173031768 GAGGCAGGGCTTGCAGTGAGTGG + Intronic
1001685678 5:173593179-173593201 TACCCAAGGCTCACAGTGAGTGG - Intergenic
1001698569 5:173690480-173690502 GACTCAAGGGTGGTAGGGAGTGG + Intergenic
1005198972 6:23321753-23321775 TACCCAAGACTGGCAGTCAATGG + Intergenic
1006548629 6:34801790-34801812 GAGCCAGAGCTTGCAGTGAGCGG - Intronic
1007104395 6:39273559-39273581 GAACCAGGGCTGGCAGGGTGGGG - Intergenic
1007250297 6:40490668-40490690 AACCCAGGCCTGGCTGTGAGGGG - Intronic
1007254671 6:40520485-40520507 GACCCAAGTCTGCAAGGGAGGGG - Intronic
1007679048 6:43621835-43621857 GAGCCACGGCTGGCAGAGAATGG - Intronic
1008537741 6:52519978-52520000 TACCAAGGGCTGGGAGTGAGAGG + Intronic
1009774060 6:68181805-68181827 GAGCCAAGGCAAGCGGTGAGAGG + Intergenic
1010033059 6:71289367-71289389 GGCCCCAGGCCGGCAGTGGGAGG - Intronic
1010512569 6:76738722-76738744 GACCTAACTCTGGCAGTAAGAGG + Intergenic
1014157702 6:118130398-118130420 GAGGCAAAGCTTGCAGTGAGCGG + Intronic
1014563335 6:122917542-122917564 GACCCAATGCAAGCAGTTAGAGG + Intergenic
1017010927 6:150063576-150063598 GACCTGAGGCTGGTAATGAGGGG + Intronic
1017235234 6:152111678-152111700 GACCACAGGCTGGAAGGGAGGGG + Intronic
1017717396 6:157222408-157222430 GCCACAGGGCTGGGAGTGAGGGG - Intergenic
1017908328 6:158771968-158771990 GCTCCCAGGCTGGCAGTGATGGG - Intronic
1018112615 6:160549839-160549861 GACCCAAGGCATAAAGTGAGAGG + Intronic
1019156276 6:170041018-170041040 AACGCAAAGCTGGCAGGGAGGGG - Intergenic
1019165699 6:170096295-170096317 GGCCCAGGGCTGGGAGGGAGAGG - Intergenic
1019285834 7:222492-222514 GGCCCAGGGCTGGCACTGAGAGG + Intronic
1019971875 7:4548069-4548091 GAGCCAAAGGTTGCAGTGAGTGG - Intergenic
1020789065 7:12603213-12603235 GAGGCAAAGCTTGCAGTGAGCGG - Intronic
1021260096 7:18444972-18444994 GACCCAGGGCTGGAAATGGGAGG + Intronic
1021851159 7:24809765-24809787 GACCCCAGGCTGTGAGTGGGTGG - Intronic
1022492165 7:30829375-30829397 GACCAAGGACTGGCCGTGAGAGG + Intronic
1023293085 7:38687538-38687560 GACCATAGGCAGGCAGTGGGTGG + Intergenic
1024666219 7:51549867-51549889 GACCCGAGGCTGGAAGAGATGGG + Intergenic
1028104952 7:86866152-86866174 GACACAAGGAAGACAGTGAGAGG + Intergenic
1029419595 7:100466031-100466053 GAGCCCAGGCTGCCAGGGAGGGG + Intronic
1029557241 7:101278906-101278928 GACCCAAGGGGGGCTGTCAGGGG + Intergenic
1032186000 7:129727151-129727173 GACCCAAGGAAGGCATTGAAAGG + Intronic
1034116127 7:148585567-148585589 GACCCAAGCCTGGCTCTGATTGG + Intergenic
1034873691 7:154706192-154706214 GGGCCAAGGCAGGCGGTGAGAGG - Intronic
1035288255 7:157819754-157819776 TGCCCATGGCTGGCAGTGGGTGG - Intronic
1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG + Intronic
1035693279 8:1573512-1573534 AACCCACGGATGGCAGTCAGGGG - Intronic
1037886236 8:22597876-22597898 GACCCATGGCTAGCAGGGAAGGG + Intronic
1038524028 8:28257940-28257962 GACCCTTTGCTGGCAGTGAAGGG - Intergenic
1038801578 8:30754167-30754189 GAGCCAGAGATGGCAGTGAGTGG + Intronic
1039269072 8:35861007-35861029 AATCCAAGGCTGGCAATTAGTGG - Intergenic
1039484202 8:37898871-37898893 GACCCAAAGCTGGCAGAGCTGGG + Intronic
1041366740 8:57114298-57114320 GAGGCAATGCTGACAGTGAGGGG + Intergenic
1042031462 8:64480374-64480396 GACCCTAGGCTGGCAGGCAGTGG - Intergenic
1044810958 8:96061364-96061386 GCCCCAAGGCTGGATGTGACTGG - Intergenic
1044942157 8:97354295-97354317 GAGCTAAGGCTGGCAGAGAAAGG - Intergenic
1045240759 8:100399135-100399157 GAACCAAGTCTGACAGTTAGTGG - Intronic
1047255405 8:123209966-123209988 GACCCCAGGCTGGCAGAGGAGGG - Intronic
1048026013 8:130587287-130587309 GACTCAAGGCTGGGAGGAAGAGG + Intergenic
1048167867 8:132079715-132079737 TACCCAAGGCTGGGAGAGTGTGG + Exonic
1049790446 8:144469920-144469942 GCCCCAAGGCAGGCGGTGGGTGG + Intronic
1049843154 8:144787070-144787092 ACCCCAGGGCTGGCAGAGAGCGG + Intronic
1051426763 9:16940134-16940156 GAGCCAGAGCTTGCAGTGAGCGG - Intergenic
1053064908 9:35061257-35061279 GACCCAGGGATAGCAGTCAGGGG - Intronic
1053267531 9:36726079-36726101 CATCCCAGTCTGGCAGTGAGTGG - Intergenic
1054870934 9:70046530-70046552 GACCAGAGGCAGGCTGTGAGGGG - Intronic
1057304960 9:93906681-93906703 GAGCCAAGATTGGCTGTGAGCGG + Intergenic
1057551311 9:96052841-96052863 AAACCATGGTTGGCAGTGAGAGG + Intergenic
1059588287 9:115629714-115629736 GACCCACGGGTGGAAGTGATTGG + Intergenic
1061368966 9:130187285-130187307 GACCCAGGGATGGCAGCGACGGG - Intronic
1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG + Intergenic
1185648883 X:1634347-1634369 CTCTCCAGGCTGGCAGTGAGTGG - Intronic
1186221677 X:7355775-7355797 GACACAAAGCAGGAAGTGAGCGG + Intergenic
1187378322 X:18777588-18777610 GAGCCGGAGCTGGCAGTGAGCGG - Intronic
1187820403 X:23281731-23281753 GACCAAATTCTGGCAGGGAGGGG + Intergenic
1188850264 X:35123592-35123614 TTCCCAATGCTGGCAGTAAGTGG - Intergenic
1189334055 X:40159415-40159437 GAGCCAGAGCTTGCAGTGAGCGG - Intronic
1190302522 X:49064987-49065009 CACCCAGGCCTGGGAGTGAGAGG + Intronic
1191791866 X:64979546-64979568 GAATCCAGGCTAGCAGTGAGAGG + Intronic
1194128108 X:90045308-90045330 GAGGCAGAGCTGGCAGTGAGCGG - Intergenic
1194326793 X:92528582-92528604 GACTCAAGGCTGGGTGGGAGTGG - Intronic
1195092585 X:101475448-101475470 AACACAAAGCTGGCAGTGGGCGG + Intronic
1196616063 X:117768870-117768892 GTCCCAAGGCAGGTTGTGAGAGG + Intergenic
1196874847 X:120147785-120147807 GACCCAAGGGTGAAAGTGAAAGG + Intergenic
1197485746 X:127049371-127049393 GAGCCAGGGGTTGCAGTGAGTGG - Intergenic
1199664878 X:150088668-150088690 GCCTTAAGCCTGGCAGTGAGAGG + Intergenic
1200074827 X:153545798-153545820 CACACATGGCTGGCAGTGGGAGG - Intronic
1201078512 Y:10208432-10208454 GACCAAAGGCCTCCAGTGAGTGG + Intergenic