ID: 1104669200

View in Genome Browser
Species Human (GRCh38)
Location 12:130668797-130668819
Sequence TGCCATGCCAAGCTATGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104669197_1104669200 -10 Left 1104669197 12:130668784-130668806 CCATGCCATGCCGTGCCATGCCA 0: 2
1: 8
2: 41
3: 145
4: 1820
Right 1104669200 12:130668797-130668819 TGCCATGCCAAGCTATGCCCTGG 0: 1
1: 1
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104669200 Original CRISPR TGCCATGCCAAGCTATGCCC TGG Intronic
900462108 1:2806481-2806503 TGCCCTGCCCAGCTAAGTCCGGG - Intergenic
900787349 1:4656938-4656960 TGCCATCCCCTGCTCTGCCCCGG + Intronic
901673377 1:10868622-10868644 TGCCTTGCCAGTCTAGGCCCAGG - Intergenic
906531064 1:46524313-46524335 TGCCATGCCAGCTTCTGCCCAGG - Intergenic
908586249 1:65573006-65573028 TGCCATGCTGAGCCATGCCCTGG + Intronic
912193979 1:107376577-107376599 TGCCGTGCCACCTTATGCCCAGG + Intronic
915108036 1:153546519-153546541 TGCCATGCCAAGTAAGGCTCAGG + Intronic
915543897 1:156585086-156585108 CGCTCTGCCAAGCTGTGCCCTGG + Intronic
915553983 1:156651249-156651271 TGTCATGCCAAGCATTCCCCTGG - Intronic
1065788567 10:29239149-29239171 TGCCCTGCCATGCTAACCCCTGG + Intergenic
1066641384 10:37557648-37557670 GGCCATGCCAAGCGATTTCCAGG - Intergenic
1066961470 10:42231081-42231103 TGCCCTGCCCATCCATGCCCTGG - Intergenic
1067325899 10:45266120-45266142 TGCCCTGCCAAGCCAGGCACAGG - Intergenic
1070251669 10:74778785-74778807 TGCCATGCCAAGCTGTGCCCTGG - Intergenic
1073965185 10:108980667-108980689 TGCCATACCCAGCTATGTCTTGG - Intergenic
1075094406 10:119461381-119461403 TGCCAAGCCAAACATTGCCCAGG + Intergenic
1075535116 10:123264541-123264563 TCCCATGCCAAGATATTTCCCGG + Intergenic
1078431093 11:11289489-11289511 TGCCTTTTCAAGCCATGCCCTGG + Intronic
1078451085 11:11441444-11441466 TGCCCTGCCCAGCCCTGCCCAGG - Intronic
1080404172 11:31964302-31964324 GGATATGCCAAGCCATGCCCTGG + Intronic
1086417683 11:86605566-86605588 AGCCATGACAATCTATGACCTGG + Intronic
1088185193 11:107159142-107159164 TTCAATGCCCAGCAATGCCCAGG + Intergenic
1090619846 11:128550624-128550646 TGCCCTGACAAGCTACTCCCAGG - Intronic
1095503156 12:42862695-42862717 TTTAATGCCAAGCTATGGCCAGG + Intergenic
1101881768 12:108630549-108630571 TGCCCTGCCCTGCTGTGCCCTGG + Intronic
1104105525 12:125655313-125655335 TGCCATGCCATGTTATTTCCTGG + Exonic
1104669200 12:130668797-130668819 TGCCATGCCAAGCTATGCCCTGG + Intronic
1107738891 13:43427998-43428020 TGCCATGACAGGCTATCTCCTGG - Intronic
1116754120 14:48924553-48924575 TGCCATGGCCAGCCATGCCAGGG + Intergenic
1117813734 14:59576499-59576521 TGCCCTGCCCAGTGATGCCCTGG + Intronic
1121787561 14:96673849-96673871 TGCCATGTCACGCGGTGCCCTGG - Intergenic
1121815465 14:96925127-96925149 TGCTGTGCCAAGCTCAGCCCTGG - Intronic
1121908928 14:97771368-97771390 TTCCAGGCCAAGCTGTGCCCTGG - Intergenic
1122338490 14:101009013-101009035 TTCCATGCCAATCTTGGCCCAGG - Intergenic
1124517296 15:30377281-30377303 GGCCCTTCCAAGCTGTGCCCGGG - Intronic
1124725648 15:32153713-32153735 GGCCCTTCCAAGCTGTGCCCGGG + Intronic
1127063697 15:55214841-55214863 TGGCATCACAAGCTATCCCCAGG - Intronic
1127282102 15:57501526-57501548 TCCCATGCCAGGCTATGCCTGGG - Intronic
1131650331 15:94391448-94391470 TGCCAACCAAATCTATGCCCTGG - Intronic
1132385032 15:101394261-101394283 CGCCATGCCCAGCTGTGCACCGG + Intronic
1132866646 16:2096350-2096372 TGCCATGCCCTCCTATGCTCAGG - Intronic
1135494444 16:22939302-22939324 TGCCATGCCAAGTTATCTCAAGG + Intergenic
1135508050 16:23056127-23056149 TGCTATGCCAAGCACTGGCCTGG - Intergenic
1135856016 16:26011106-26011128 AACCATGCCAAGCTGTGTCCTGG - Intronic
1135933349 16:26758124-26758146 TGTCCTGCCCAGCTATGACCAGG + Intergenic
1138449505 16:57084929-57084951 TCCCCTGCCAAGCTATTTCCAGG - Intergenic
1140426796 16:74867855-74867877 TGACATGCCAAGACACGCCCGGG + Intergenic
1141610820 16:85180249-85180271 TGCCCTGCCAAGCCAGGGCCCGG + Intronic
1146086077 17:29830959-29830981 TACTATGCAAAGTTATGCCCAGG - Intronic
1146171027 17:30633478-30633500 GGCCAAGACAAGCTATGGCCTGG - Intergenic
1146344482 17:32049482-32049504 GGCCAAGACAAGCTATGGCCTGG - Intronic
1150133603 17:62682181-62682203 TGCCCTGCCCTGCTCTGCCCTGG + Intronic
1151620366 17:75241258-75241280 TGCCATTCCAAGCAATCCTCCGG - Intronic
1152659083 17:81534228-81534250 TCCCATCCCACGCTGTGCCCAGG - Intronic
1155119825 18:22806970-22806992 TACCATGCCAAGCATTGCTCTGG - Intronic
1157560576 18:48642798-48642820 TGCCCCACCAAGCTGTGCCCTGG - Intronic
1162733384 19:12732292-12732314 GGCCATGCCAGGCTAGGCACAGG - Intronic
1164674951 19:30094786-30094808 TGCCTTGCTATGCTGTGCCCAGG - Intergenic
1165128850 19:33620095-33620117 TGCCCAGCCAAGCTATGGTCAGG + Intergenic
1167718257 19:51158392-51158414 TGCCAGGCAAAACTTTGCCCTGG - Intergenic
1167884899 19:52492662-52492684 TGCCAGGCCAAGTGATGCACAGG + Intronic
925712775 2:6757882-6757904 TTCCAGGCCAAGCCATGCCCTGG + Intergenic
925747243 2:7053993-7054015 TGCCATGCTGAGCTGTGCACTGG - Intronic
927914971 2:26929781-26929803 TGCCATGCAAAACTGTGCACAGG - Intronic
933678054 2:85075605-85075627 TGGTACCCCAAGCTATGCCCTGG + Intergenic
936525985 2:113242032-113242054 TGCCAGGCTGAGCGATGCCCAGG + Exonic
940316376 2:152331779-152331801 TGCATTTCCAAGCTATGCCAGGG - Intergenic
941090825 2:161173222-161173244 TGCCATGATAAGCTATGGTCAGG - Intronic
944200224 2:197098968-197098990 TGTCAGGCCAAGCTCTTCCCTGG + Intronic
948279753 2:236738007-236738029 TGCCCAGCAAAGCTATGCCTTGG + Intergenic
1168876255 20:1174254-1174276 TTCCATGCCAACCTCTTCCCGGG - Intronic
1173067485 20:39727154-39727176 TGCCATACCCAGCCATGACCAGG - Intergenic
1176857600 21:13984948-13984970 TGCCCTGCCCAGCCTTGCCCTGG + Intergenic
1178728693 21:35079005-35079027 TGCCATGCCAAGACATGGGCTGG - Intronic
1178921539 21:36742111-36742133 TGGGATCCGAAGCTATGCCCAGG - Intronic
1181639099 22:24187533-24187555 AGCCATGCCCAGCCAGGCCCCGG + Intronic
954109480 3:48426191-48426213 TGCCATGCCTGGCTGTTCCCAGG + Intronic
954870499 3:53764054-53764076 CGTCATGCCACGCTATGACCAGG + Intronic
961006100 3:123406349-123406371 TGCCATGCCATGCCATGCGGGGG - Intronic
967006831 3:185392052-185392074 TTACATGCTATGCTATGCCCTGG + Intronic
969439456 4:7208632-7208654 AGCCAAGCCAAGCCAAGCCCTGG - Intronic
969685849 4:8673699-8673721 TGCCATGTACAGCTGTGCCCCGG + Intergenic
971173395 4:24257465-24257487 TGCCAGGACAACCAATGCCCTGG - Intergenic
973926412 4:55743029-55743051 AGCCAAGCCATGCTGTGCCCTGG - Intergenic
983930603 4:173449476-173449498 TGACAAGGCCAGCTATGCCCTGG - Intergenic
985766595 5:1783173-1783195 TGCCATGACCAGCATTGCCCAGG + Intergenic
985876782 5:2605954-2605976 TGCCCTGCCAGTCCATGCCCAGG + Intergenic
986082727 5:4410831-4410853 TGCCCTCCCAAGCTAAGCACTGG + Intergenic
992225564 5:74616856-74616878 AGCCATGTCAAGCTGAGCCCAGG + Intergenic
998523113 5:142818293-142818315 TGGCCAGCCAAGCCATGCCCCGG + Intronic
1003036014 6:2640907-2640929 TTCCATGCCCAGCCATGCCCAGG + Intergenic
1003409239 6:5848851-5848873 TGCCATCCAAAGCTCTGACCTGG + Intergenic
1003524945 6:6889767-6889789 GGCCATACCATGCTATGCCTTGG - Intergenic
1003700910 6:8463901-8463923 TGCCGTGCCATGCCATGCCATGG - Intergenic
1006846941 6:37068938-37068960 TGTCAGGCCAAACTTTGCCCTGG - Intergenic
1008625897 6:53316303-53316325 TGCCATGACAAGGTATGTACAGG + Intronic
1010037733 6:71345489-71345511 TGCCATGCCCAGCTCTGGGCAGG - Intergenic
1011859387 6:91736408-91736430 TACCATGCCCAACCATGCCCAGG - Intergenic
1013277391 6:108598789-108598811 TGCCATACAAAGCAATGCCCTGG - Intronic
1013759342 6:113498642-113498664 TGCCATGCCATGCCATACCATGG - Intergenic
1015972082 6:138752416-138752438 TACCATTCCAGGCTATGCCTGGG - Intronic
1017050686 6:150390824-150390846 TGCACTGCGAAGCTTTGCCCTGG + Intronic
1019406758 7:888058-888080 TGCCATCCCAGGGAATGCCCTGG - Intronic
1020747231 7:12092769-12092791 TGCCATGTCAAGCCATGCCCAGG - Intergenic
1023244381 7:38185429-38185451 TGCCATTCACATCTATGCCCAGG - Intronic
1024096259 7:45985198-45985220 TGCCCTGCCCAGCTATGGGCTGG + Intergenic
1031970675 7:128062824-128062846 TGGCATCCCAATCTAAGCCCCGG + Intronic
1032091077 7:128911859-128911881 TGCAATGCCACGCTAAGACCTGG + Intergenic
1032872448 7:136000883-136000905 TGCCCAGCTAAGCCATGCCCAGG + Intergenic
1039376526 8:37040092-37040114 TGTCAAGCCAAGGTTTGCCCTGG + Intergenic
1039612467 8:38930643-38930665 TGCCATGCCATGCCATGCCGTGG - Intronic
1039955732 8:42206022-42206044 TGCTATTCCCAGCTATTCCCTGG + Intronic
1041420832 8:57665865-57665887 TGCCCTACCAAGCAATGCCCTGG - Intergenic
1041421027 8:57667065-57667087 TGCTTTGCTAAGCTTTGCCCTGG - Intergenic
1042228814 8:66536728-66536750 TGGAATGCCATGCTAAGCCCAGG + Intergenic
1046978458 8:120310576-120310598 AGCCATGCCAAGCCATGTCAAGG + Intronic
1047698739 8:127429418-127429440 TGCCATGCCAAGAAATGGCCTGG - Intergenic
1049743664 8:144253461-144253483 AGCCAAGCCAACCTGTGCCCAGG - Intronic
1055350454 9:75381227-75381249 TGAAATGCCAAGTTATGCCTGGG - Intergenic
1059117012 9:111608903-111608925 GGCCAAGACAAGCTATGCTCTGG + Intergenic
1192200957 X:69066446-69066468 TGCCTTGCCAAGCAAAGCCTAGG - Intergenic