ID: 1104669894

View in Genome Browser
Species Human (GRCh38)
Location 12:130673403-130673425
Sequence AGCTGTAGCGAAGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 347}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104669883_1104669894 16 Left 1104669883 12:130673364-130673386 CCCTAAACAAATGGTCGGTACCC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG 0: 1
1: 0
2: 6
3: 25
4: 347
1104669884_1104669894 15 Left 1104669884 12:130673365-130673387 CCTAAACAAATGGTCGGTACCCC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG 0: 1
1: 0
2: 6
3: 25
4: 347
1104669888_1104669894 -6 Left 1104669888 12:130673386-130673408 CCCAAAACCAAACCTGGAGCTGT 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG 0: 1
1: 0
2: 6
3: 25
4: 347
1104669886_1104669894 -4 Left 1104669886 12:130673384-130673406 CCCCCAAAACCAAACCTGGAGCT 0: 1
1: 1
2: 1
3: 24
4: 257
Right 1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG 0: 1
1: 0
2: 6
3: 25
4: 347
1104669880_1104669894 30 Left 1104669880 12:130673350-130673372 CCTATTTGGCAAAACCCTAAACA 0: 1
1: 0
2: 5
3: 22
4: 212
Right 1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG 0: 1
1: 0
2: 6
3: 25
4: 347
1104669889_1104669894 -7 Left 1104669889 12:130673387-130673409 CCAAAACCAAACCTGGAGCTGTA 0: 1
1: 0
2: 0
3: 5
4: 152
Right 1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG 0: 1
1: 0
2: 6
3: 25
4: 347
1104669887_1104669894 -5 Left 1104669887 12:130673385-130673407 CCCCAAAACCAAACCTGGAGCTG 0: 1
1: 0
2: 3
3: 32
4: 221
Right 1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG 0: 1
1: 0
2: 6
3: 25
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104669894 Original CRISPR AGCTGTAGCGAAGGAGGCTG AGG Intronic
900637347 1:3672456-3672478 AGCTCCAGCGAAGGCGGCTGCGG + Intronic
900715842 1:4142923-4142945 GCCTGCAGCTAAGGAGGCTGTGG - Intergenic
902509134 1:16956057-16956079 AGCTGTGGGCAAGGAGGCCGGGG + Exonic
902622098 1:17656548-17656570 TGCTGTAGAGGAGGATGCTGCGG - Exonic
905559503 1:38915373-38915395 AGATGTAGTCATGGAGGCTGAGG - Intronic
906090657 1:43176774-43176796 AGTTGTAGATAGGGAGGCTGGGG + Intronic
907893703 1:58663067-58663089 AGATGTAGCAAAGGAGAATGAGG + Intronic
908174274 1:61538758-61538780 AGGTGAAGCCAAGAAGGCTGTGG - Intergenic
910175576 1:84426916-84426938 AGCAGAATTGAAGGAGGCTGAGG + Intergenic
911930488 1:103896682-103896704 AGCTGAAGAGGAGGAGGCAGGGG - Intergenic
912716937 1:111989775-111989797 GGCTGGAGCGGCGGAGGCTGCGG - Intergenic
913349909 1:117845929-117845951 AGCTGAACTGAAGGAGACTGAGG + Intergenic
915221782 1:154380372-154380394 AGCTTGAGCTCAGGAGGCTGAGG - Intergenic
916166181 1:161969207-161969229 AGCAGCAGGGATGGAGGCTGTGG - Intergenic
917424396 1:174899090-174899112 AGCTGAAGAGAATGAGGCTATGG + Intronic
917453045 1:175163029-175163051 AGCTGAAGAGATGGAGGCTCAGG + Intronic
918052473 1:180986657-180986679 AGTACTAGGGAAGGAGGCTGAGG - Intronic
919913134 1:202124010-202124032 AGGAGCAGCGAAGGAAGCTGTGG - Intronic
920320357 1:205117165-205117187 AGCTGCTGCTCAGGAGGCTGGGG - Intronic
920322589 1:205135993-205136015 AGCTACAGGGAGGGAGGCTGAGG - Intergenic
922952731 1:229572850-229572872 ACCTGTAGCCCAGGAGGTTGAGG + Intergenic
923338684 1:232990564-232990586 AGCTGTAGTGTAAGTGGCTGAGG + Intronic
923668426 1:236019170-236019192 AGCTGGAGCTGGGGAGGCTGTGG + Intronic
923759999 1:236833462-236833484 AGGTGTAGAGATGGAGGCTTGGG + Intronic
923904636 1:238370243-238370265 TGCTGTAGCTAAGGTGGCAGAGG + Intergenic
1064371207 10:14752846-14752868 TGCTTTAGCCAAGGAGGTTGAGG + Intronic
1064419068 10:15174717-15174739 AGCTGCTCCGGAGGAGGCTGAGG - Intergenic
1064654618 10:17544827-17544849 AGCTACAACGAGGGAGGCTGAGG + Intergenic
1065468960 10:26056601-26056623 AGCTTTAGTGTTGGAGGCTGAGG + Intronic
1066440974 10:35438230-35438252 AGCTTTAGCCTGGGAGGCTGAGG - Intronic
1067204613 10:44202120-44202142 ATCAGTAGGGAAGGAGGCTCTGG + Intergenic
1067927858 10:50528774-50528796 AGCTTGAGCCCAGGAGGCTGAGG + Intronic
1069013787 10:63404029-63404051 CGCTGTAGCTCAGGAGGCAGAGG + Intronic
1069029482 10:63580217-63580239 AGCTGAAGCCCAGGAGGTTGAGG - Intronic
1069772878 10:70910689-70910711 AGATGTGGCGCAGGAGGCTGAGG + Intergenic
1069775988 10:70927528-70927550 AGCAGGAGCCCAGGAGGCTGGGG - Intergenic
1070312042 10:75281002-75281024 AGCTGGAGGAGAGGAGGCTGGGG + Intergenic
1070446241 10:76506450-76506472 ATCTGTATCCCAGGAGGCTGGGG + Intronic
1070561805 10:77573486-77573508 TGCTGTAGAGGAGGATGCTGAGG - Intronic
1070981191 10:80649559-80649581 AGCTGAGGAGGAGGAGGCTGGGG + Intergenic
1071118687 10:82252934-82252956 TGCAGTAGCGAAGGTGGCTTTGG - Intronic
1071334500 10:84589870-84589892 GGGTGTAGGGAAGGTGGCTGAGG + Intergenic
1071561003 10:86646801-86646823 AGCTGGAGCGAATGAGGCGGAGG + Intergenic
1071987786 10:91070181-91070203 AGGTGTAGAGAAGGAAGATGGGG - Intergenic
1073328538 10:102656550-102656572 AGCTGAAGAAATGGAGGCTGGGG - Intronic
1074712575 10:116189471-116189493 AGCTGGAGTGAAGGTGGCGGGGG - Intronic
1074887455 10:117705265-117705287 ACCTGTGGGGAAGGAGGGTGAGG + Intergenic
1075085668 10:119412865-119412887 AGCTGCAGCGACGGGGTCTGGGG - Intronic
1077256254 11:1584777-1584799 AGCTGTGGCAAAGGGGGCTGTGG - Exonic
1077256326 11:1585041-1585063 AGCTGTGGCAAAGGGGGCTGTGG - Exonic
1077262464 11:1630087-1630109 AGCTGTGGCAAAGGGGGCTGTGG + Exonic
1077297974 11:1834911-1834933 AGCTGAAGGGAGGGAGGCTCTGG - Intronic
1077909229 11:6559420-6559442 AGCTGTAAAGGAGGAGGCAGCGG - Intronic
1078917868 11:15796977-15796999 TGCTGGAGAGAAGGAGGCAGTGG - Intergenic
1079275262 11:19029694-19029716 AGCTGTCGGGAAGCAGACTGAGG - Intergenic
1080485589 11:32704040-32704062 AGCTGCAGCAAGGGAGGTTGCGG + Intronic
1081607776 11:44537934-44537956 AGCCACAGCCAAGGAGGCTGAGG + Intergenic
1081695318 11:45105544-45105566 AGCTGTAGCAGTGGAGGCTGAGG - Intronic
1081702048 11:45158363-45158385 AGCTGCAGGGAGGGAGGCAGGGG - Intronic
1081709168 11:45205989-45206011 AGCTGTGTCCAAGGAGGTTGGGG - Intronic
1082032605 11:47616460-47616482 ACCTGTAGTTCAGGAGGCTGAGG - Intergenic
1083629630 11:64088943-64088965 AGCTGTCACCATGGAGGCTGGGG + Intronic
1083721696 11:64606710-64606732 AGAAGTAGGGAAGGAGGGTGGGG + Exonic
1084740468 11:71136017-71136039 AGCTGTAGAGATGGAAGCTCAGG + Intronic
1085866969 11:80305592-80305614 AGCTGTGGCTAAGGAGGGAGAGG - Intergenic
1086983830 11:93227163-93227185 AGCTACAGCTCAGGAGGCTGAGG - Intergenic
1087662694 11:101006192-101006214 AGCTTGAGCCAAGGAGGTTGAGG - Intergenic
1088602868 11:111498240-111498262 GGCTGAGGGGAAGGAGGCTGAGG - Intronic
1089285971 11:117408420-117408442 AGGTGTAGCGGGGGAGGCTTAGG + Intronic
1089367685 11:117931193-117931215 ACCTTCAGGGAAGGAGGCTGAGG - Intergenic
1089841938 11:121426109-121426131 GGCTGGAGCAAAGGAAGCTGGGG - Intergenic
1090330419 11:125926993-125927015 AGGGGCAGCGAAGGAGGGTGTGG - Intergenic
1090845695 11:130528160-130528182 TGCTGTAGCTCAGGTGGCTGCGG + Intergenic
1090849903 11:130562810-130562832 AGCTCTAGAGAAGGATGCTCTGG + Intergenic
1091842831 12:3633075-3633097 AGCTGTCGCCCAGCAGGCTGGGG + Intronic
1093020969 12:14203834-14203856 AGTTGTATCCAAGGAGGTTGAGG + Intergenic
1093277628 12:17149104-17149126 AGCTGTAGTGGAGGTGGCAGGGG - Intergenic
1093370871 12:18363645-18363667 AGCTGAGGGGAAGTAGGCTGGGG - Intronic
1094054029 12:26250366-26250388 AGCTTGAGCCAAGGAGGTTGAGG - Intronic
1094167047 12:27453642-27453664 ATCTGGAGGGATGGAGGCTGGGG - Intergenic
1096174144 12:49501033-49501055 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1096299818 12:50416850-50416872 AGCTGTAGCTTGGGAGCCTGAGG + Intronic
1097244552 12:57600148-57600170 AGCTGTAGTGACTGAGTCTGTGG + Intronic
1097590389 12:61567390-61567412 AGATGTACCCAAGGAGGTTGGGG - Intergenic
1100320421 12:93486426-93486448 CGCTGTAGCCCAGGAGGCAGAGG - Intronic
1101302490 12:103495936-103495958 AGCTCCCGCGGAGGAGGCTGCGG - Exonic
1101936465 12:109062016-109062038 AGCTTGAGCACAGGAGGCTGAGG - Intronic
1102957339 12:117067454-117067476 AGCTACAGCTCAGGAGGCTGAGG + Intronic
1103289275 12:119830947-119830969 CGCTGGAGCGAAGGAGGTTGAGG - Intronic
1103583424 12:121933565-121933587 GGCTGTGGCCAAGGAGGCTGAGG + Intronic
1103593060 12:122005971-122005993 AGCTGTATCCTGGGAGGCTGAGG - Intergenic
1103941831 12:124505422-124505444 AGCAGGAGCTATGGAGGCTGTGG + Intronic
1103941838 12:124505459-124505481 AGCAGGAGCTATGGAGGCTGTGG + Intronic
1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG + Intronic
1105565808 13:21546647-21546669 AGTTTTAGCAGAGGAGGCTGAGG + Intronic
1107077483 13:36338726-36338748 AGTTGTGGGGAAGAAGGCTGTGG - Intronic
1107508704 13:41060854-41060876 AGGTGCGGCGAAGGAGGCAGAGG - Intronic
1108001086 13:45906549-45906571 AGCTGTAGCCTAGGAGGCAAGGG - Intergenic
1108478513 13:50843687-50843709 AGCAGCAGCGAGGGAGGCGGGGG + Exonic
1109259343 13:60124756-60124778 AGCTGGAGCCCAGGAGGTTGGGG + Intronic
1111950051 13:94702964-94702986 AGCTGCTGCGAAGGAGGGTAAGG + Intergenic
1111968887 13:94890161-94890183 TGCTTGAGCCAAGGAGGCTGAGG - Intergenic
1112593199 13:100783314-100783336 ACCTGTATAGAAGCAGGCTGCGG + Intergenic
1113075782 13:106466740-106466762 AGCAGTAGCAGAGGAGGCTGAGG - Intergenic
1114385213 14:22247200-22247222 GGCTCTAGCACAGGAGGCTGTGG + Intergenic
1117086007 14:52201874-52201896 AGCTTTAGCCCAGGAGGTTGAGG + Intergenic
1118373023 14:65153731-65153753 ACCTGTAGGTAGGGAGGCTGAGG + Intergenic
1118819215 14:69334211-69334233 AGCAGCAGCGAAGGAGACAGAGG + Intronic
1120790835 14:88580141-88580163 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1120790853 14:88580219-88580241 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1121262441 14:92576145-92576167 AGCTGTGCCACAGGAGGCTGGGG + Intronic
1122112193 14:99510508-99510530 AGGTGGGGGGAAGGAGGCTGGGG - Exonic
1122293803 14:100693882-100693904 AGCTGCAGAGAAGGGGGCTGGGG - Intergenic
1122805394 14:104253846-104253868 AGATGTAGTGAGGGAGGCTATGG + Intergenic
1123040948 14:105490091-105490113 CGCCGGAGGGAAGGAGGCTGCGG + Intronic
1123399891 15:19973852-19973874 AGCAGGAGCGCAGGAGGCTGGGG - Intergenic
1125505416 15:40265155-40265177 AGCCAGGGCGAAGGAGGCTGGGG + Intronic
1125587136 15:40828874-40828896 AGCTGCAGAAAGGGAGGCTGGGG - Intergenic
1127845372 15:62866078-62866100 AGCTGTGGAGAAGGTGGATGAGG + Intergenic
1128167673 15:65480998-65481020 AGCTTTAGCCAGGGAGGTTGAGG + Intronic
1129378971 15:75153777-75153799 AGAAGTAGGGAGGGAGGCTGTGG + Intergenic
1131706356 15:95000306-95000328 GGCTGTGGTAAAGGAGGCTGAGG + Intergenic
1132808102 16:1784934-1784956 AGCTGAGGCGTGGGAGGCTGAGG + Intronic
1133079552 16:3307631-3307653 AGTTCTAGCTCAGGAGGCTGAGG - Intronic
1133263148 16:4565325-4565347 AGCTGTGGGGAAAGTGGCTGAGG - Intronic
1133965970 16:10531976-10531998 AGCTGTGGCGATGGAGGCCAAGG + Exonic
1134054993 16:11164468-11164490 AGGTGAAAGGAAGGAGGCTGAGG + Intronic
1134539282 16:15051814-15051836 AGCTACTGCAAAGGAGGCTGAGG - Intronic
1135048094 16:19170357-19170379 GGCTGTAGCAAAACAGGCTGCGG + Intronic
1136125688 16:28178663-28178685 AGCTTTAGCCCAGGAGGCCGAGG + Intronic
1136542784 16:30937608-30937630 AGCTGTAGCCAAGGAAGGTGTGG + Intronic
1136692841 16:32048276-32048298 AGCTGGTGCAAAGGAGTCTGAGG + Intergenic
1136712799 16:32253780-32253802 AGGAGGAGCGAAGGAGGGTGGGG - Intronic
1136755117 16:32675649-32675671 AGGAGGAGCGAAGGAGGGTGGGG + Intronic
1136812996 16:33194720-33194742 AGGAGGAGCGAAGGAGGGTGGGG - Intronic
1136819472 16:33304800-33304822 AGGAGGAGCGAAGGAGGGTGGGG - Intronic
1136826035 16:33361335-33361357 AGGAGGAGCGAAGGAGGGTGGGG - Intronic
1136831101 16:33460106-33460128 AGGAGGAGCGAAGGAGGGTGGGG - Intronic
1136876517 16:33862554-33862576 AGCTGGTGCAAAGGAGTCTGAGG - Intergenic
1137266226 16:46871223-46871245 ACTTGTAGGGAAGGAGCCTGTGG + Intergenic
1138517398 16:57543752-57543774 AGCTGTAGGGAGGAAGGCAGGGG + Intronic
1139790849 16:69433530-69433552 AGCTGTGGTGAAGGAGGAGGAGG - Intronic
1139970264 16:70769955-70769977 AGCTTTTGCGCTGGAGGCTGTGG - Intronic
1140519550 16:75569367-75569389 AGCTGTAGCTCTGGAAGCTGTGG + Intronic
1141691733 16:85600501-85600523 GGCTGTGGCTAAGAAGGCTGTGG + Intergenic
1141974506 16:87506432-87506454 ACCTGCAGCAGAGGAGGCTGAGG - Intergenic
1142248972 16:88982556-88982578 GGCTGTGGGGGAGGAGGCTGTGG - Intergenic
1142248978 16:88982571-88982593 GGCTGTGGGGGAGGAGGCTGTGG - Intergenic
1202991573 16_KI270728v1_random:17690-17712 AGGAGGAGCGAAGGAGGGTGGGG - Intergenic
1203057259 16_KI270728v1_random:935988-936010 AGGAGGAGCGAAGGAGGGTGGGG + Intergenic
1203095596 16_KI270728v1_random:1253192-1253214 AGCTGGTGCAAAGGAGTCTGAGG + Intergenic
1144726090 17:17503539-17503561 AGATGGAGGGAAGGAGGCCGCGG + Intergenic
1144883508 17:18442756-18442778 AGCTGGTGGGCAGGAGGCTGTGG - Intergenic
1145148720 17:20501630-20501652 AGCTGGTGGGCAGGAGGCTGTGG + Intergenic
1145911814 17:28547516-28547538 ATCCGTAGAGAAAGAGGCTGGGG - Intronic
1146184329 17:30715237-30715259 AGCTGTACAAAAGCAGGCTGGGG + Intergenic
1147395664 17:40140657-40140679 AGCGGTAGCGCCGGAGGCGGCGG + Exonic
1147416902 17:40298530-40298552 AGCTGGAGCTGGGGAGGCTGAGG - Intronic
1147577248 17:41609896-41609918 AGCTGGTGGGCAGGAGGCTGTGG + Exonic
1147582788 17:41636496-41636518 AGCAGTAGCAAAGGGGCCTGGGG - Intergenic
1148661892 17:49340823-49340845 AGCTTGAGCCCAGGAGGCTGGGG + Intronic
1150501520 17:65655294-65655316 AGCTGTAGTGTCTGAGGCTGCGG - Intronic
1152498861 17:80694938-80694960 AGCTATATCCAAGGAGGGTGAGG + Intronic
1152750324 17:82059594-82059616 AGCTGCTGAGAGGGAGGCTGGGG - Intronic
1152862933 17:82706148-82706170 AGCTCCAGCGAGGGAGGCCGAGG - Intergenic
1152886129 17:82851401-82851423 AGCTGTACAGAAACAGGCTGAGG - Intronic
1156012462 18:32511125-32511147 AGCTGTAGCCATGGGAGCTGTGG - Intergenic
1156362451 18:36395199-36395221 ATCTGTATCTAGGGAGGCTGAGG + Intronic
1157416478 18:47507658-47507680 AGCTCTATAGAAGGAGGGTGGGG + Intergenic
1157496834 18:48162213-48162235 GGCTGCAGGGAAGGAGGCTGGGG - Intronic
1161235187 19:3194127-3194149 AGCTATAGTAAAGGAGGCTGAGG + Intronic
1162734318 19:12737659-12737681 ACCTGCAGGTAAGGAGGCTGCGG + Exonic
1164468258 19:28506416-28506438 AGCTGTGGGGCAGGGGGCTGGGG - Intergenic
1164521839 19:28985577-28985599 AGCTGCAGAGAAGGAGAATGAGG - Intergenic
1165572814 19:36790036-36790058 AGCTGGAGCCCAGGAGGTTGAGG - Intergenic
1166069866 19:40380784-40380806 GGCTGAGGAGAAGGAGGCTGCGG - Exonic
1166109703 19:40614457-40614479 AGCGCTAGCGAAGGCGGGTGGGG - Intronic
1166790158 19:45394565-45394587 AGCTTGAGCCAAGGAGGCGGAGG - Intronic
1167332427 19:48864642-48864664 TGCTGAAGCCCAGGAGGCTGAGG - Intronic
926008583 2:9391352-9391374 AGCTGTGACGAAGGAGGCTGGGG - Intronic
927444744 2:23149333-23149355 AGCTGCAGGGAGGGAGGGTGGGG - Intergenic
927930002 2:27037962-27037984 GGCTGTAAAGCAGGAGGCTGGGG - Intronic
927993773 2:27467526-27467548 AGCTTGAGCCCAGGAGGCTGAGG + Intronic
928516215 2:32047111-32047133 ACCAGTTGCTAAGGAGGCTGAGG + Intergenic
930342378 2:50133228-50133250 AGATGTAGGGAAAGTGGCTGAGG + Intronic
930870370 2:56164518-56164540 AGCTTGAGCCCAGGAGGCTGAGG + Intergenic
931811929 2:65862634-65862656 TGCTGTAACCAAGGAGACTGGGG - Intergenic
932225583 2:70037437-70037459 AGCAGTAGCTCAGGAGGCTGAGG - Intergenic
932356426 2:71071795-71071817 AGCTGTGGCGATGGAGCCGGCGG - Exonic
932751356 2:74373621-74373643 AGCTGTAGGAAAGGAGGTGGGGG + Intronic
933717222 2:85370314-85370336 AGCTCTTTCGGAGGAGGCTGAGG + Intronic
933726368 2:85429840-85429862 GGCAGCAGAGAAGGAGGCTGGGG - Intronic
933729481 2:85446196-85446218 AGCTGGACCCTAGGAGGCTGAGG - Intergenic
934705508 2:96475195-96475217 AGCAGCAGCGAAGGAGGAGGAGG + Intergenic
934741593 2:96727517-96727539 AGCTACTGGGAAGGAGGCTGAGG + Intronic
934747724 2:96770549-96770571 AGCTGCTGCGAAGGACGGTGAGG - Intronic
935088264 2:99869411-99869433 AGCTGTAGAGCTGGAGGGTGGGG + Intronic
936847626 2:116855669-116855691 AGCTGAACTGAAGGAGGTTGAGG + Intergenic
938388383 2:130883866-130883888 GGCTGAAGCTCAGGAGGCTGAGG - Intronic
940316397 2:152331989-152332011 AGCTGCTGCTAGGGAGGCTGAGG - Intergenic
941120191 2:161520991-161521013 TGCTGCAGCCCAGGAGGCTGAGG - Intronic
941575596 2:167226359-167226381 AGCTATAGGGAAGGTGGATGTGG - Intronic
944523485 2:200595295-200595317 GGCTGTGGAGGAGGAGGCTGTGG + Exonic
946020495 2:216636774-216636796 CACGGTAGGGAAGGAGGCTGGGG - Intronic
946352897 2:219167173-219167195 AGCTTGAGCCAAGGAGGTTGAGG + Intronic
947714526 2:232333012-232333034 AGCAGAAGCCAAGGAGCCTGTGG - Intronic
947733722 2:232444390-232444412 AGCAGAAGCTGAGGAGGCTGTGG - Intergenic
948207975 2:236172950-236172972 AGCCGTAACGATTGAGGCTGGGG + Intergenic
948820403 2:240540658-240540680 TGCTGCAGCGGAGGAGACTGGGG - Intronic
949053170 2:241908669-241908691 TGCTGTAGGGGAGAAGGCTGAGG + Intergenic
1169656935 20:7934608-7934630 AGCTGTATCCAAGGATGCTCCGG - Exonic
1171779571 20:29407168-29407190 AGATGTAGAGAAAGAGGCAGGGG + Intergenic
1171820730 20:29835739-29835761 AGATGTAGAGAAAGAGGCAGGGG + Intergenic
1171823026 20:29872970-29872992 AGATGTAGAGAAAGAGGCAGGGG + Intergenic
1171897089 20:30817420-30817442 AGATGTAGAGAAAGAGGCAGGGG - Intergenic
1171989056 20:31681555-31681577 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1172790504 20:37502089-37502111 AGCTGGAGAGAAGGAGGAAGAGG - Intronic
1174063983 20:47851706-47851728 GGCTGAAGCCAGGGAGGCTGGGG + Intergenic
1174433145 20:50485581-50485603 AGCTGTACTGTAGGAGGCTGAGG - Intergenic
1174608120 20:51776118-51776140 TGCTTGAGCCAAGGAGGCTGAGG + Intergenic
1174718636 20:52786871-52786893 CTCTGGAGCAAAGGAGGCTGAGG + Intergenic
1175004010 20:55663077-55663099 AGCTGTGGTGATGGAGGCAGCGG + Intergenic
1177193031 21:17872725-17872747 AGGTGTTGTCAAGGAGGCTGGGG + Intergenic
1177213950 21:18105298-18105320 AGCTGTAGCAGAGCAAGCTGTGG + Intronic
1178693163 21:34766869-34766891 TGCTGTTGGGAATGAGGCTGGGG - Intergenic
1179007609 21:37529176-37529198 AGCTGGAGTGCAGGAGGCTGAGG - Intergenic
1179841543 21:44078828-44078850 AGCTACAGTGGAGGAGGCTGAGG + Intronic
1180025742 21:45161151-45161173 AGCTGCAGCGGGGGAGGCTAGGG + Intronic
1180181261 21:46119632-46119654 GGCTGTTGGGAAGGAGCCTGGGG + Intronic
1180324769 22:11360684-11360706 AGATGTAGAGAAAGAGGCAGGGG + Intergenic
1181533008 22:23527742-23527764 ACCTGAAGCCAAGGAGGGTGAGG + Intergenic
1181667186 22:24406436-24406458 AGCAGTCTGGAAGGAGGCTGAGG + Intronic
1182784623 22:32897129-32897151 AGCGGTAGGGCAGGTGGCTGGGG - Intronic
1182809619 22:33104788-33104810 AACTGTAGGGAAGGAGCCTTGGG - Intergenic
1183109129 22:35635976-35635998 TGCTGAAGCCCAGGAGGCTGAGG - Intronic
1183161560 22:36117079-36117101 AGCTCTACAGATGGAGGCTGAGG - Intergenic
1183253974 22:36748725-36748747 AGATGTCGAGAAGGAGCCTGAGG + Intergenic
1183400665 22:37602011-37602033 AGCTGGGGCAGAGGAGGCTGGGG + Intergenic
1184088283 22:42279099-42279121 AGCCCTAGGGGAGGAGGCTGGGG - Intronic
1184094548 22:42309474-42309496 AGCAGTAAAGGAGGAGGCTGGGG - Intronic
1184176017 22:42789231-42789253 CGCTTTAGCCCAGGAGGCTGAGG + Intergenic
1184558615 22:45247993-45248015 AGCTGGGGAGATGGAGGCTGTGG - Intergenic
1184721658 22:46318066-46318088 GGCTGGAGCTCAGGAGGCTGAGG - Intronic
1185394472 22:50579631-50579653 AGCTGCAGGGAAGGTGGCTGTGG - Intronic
949349179 3:3107797-3107819 ACCTATAGGGAAGGAGACTGTGG - Intronic
949759568 3:7454476-7454498 AACTGAAGTGAAGGAGGGTGAGG + Intronic
950013747 3:9742069-9742091 AGGTTTTGCGAAGGAGGATGAGG - Exonic
952197822 3:31094535-31094557 AGGTGTAGGGAAGGAGGAGGAGG + Intergenic
952931476 3:38364337-38364359 GGCTGGAGGCAAGGAGGCTGCGG - Intronic
954334025 3:49905740-49905762 GGCTGTAGATAAGGAGGCTGGGG + Intronic
954639295 3:52088589-52088611 AGCTGTGATGAAGTAGGCTGTGG + Intronic
955785419 3:62532905-62532927 AGCTGTAGTGAAGAAGGGTGGGG + Exonic
957041669 3:75340735-75340757 AGCTGAAGGGGAGGGGGCTGTGG + Intergenic
957895638 3:86418320-86418342 AGATGTAGCAAAGGAGGTGGGGG - Intergenic
958930618 3:100204074-100204096 AGCTCTCGAGAGGGAGGCTGAGG + Intergenic
959357692 3:105353701-105353723 AGCTTTCCCGGAGGAGGCTGAGG - Intergenic
960914356 3:122681176-122681198 TGCTGTAGCGGAGGTGGCCGGGG + Intronic
961516198 3:127438847-127438869 ATCTGTAGAGAGGGAGTCTGTGG - Intergenic
963206658 3:142643152-142643174 AGCTGTTGAGATGGAGGTTGAGG + Intronic
967072587 3:185974467-185974489 GGCTGTAGGGAAGCAGGTTGTGG + Intergenic
967980105 3:195060591-195060613 ACCTGTCTCGAAGGTGGCTGAGG + Intergenic
968439237 4:613193-613215 AGCTGCAGGGCTGGAGGCTGTGG + Intergenic
968496359 4:919448-919470 GGCTGGAGAGGAGGAGGCTGGGG - Intronic
968658439 4:1788576-1788598 AGCTGTAGAGATGGGGGCGGGGG - Intergenic
968772018 4:2513476-2513498 AGCTGGAGAGCAGGAGGCAGGGG - Intronic
968817657 4:2830053-2830075 AGCTTCAGCGCAGGAGGCCGGGG - Exonic
969316170 4:6382533-6382555 AGCTGCAGAGGATGAGGCTGAGG - Intronic
969348395 4:6583341-6583363 ACCAGTTGCAAAGGAGGCTGGGG + Intronic
973348332 4:49081135-49081157 AGCTTTGGGGAAGGAGGCTAAGG + Intergenic
974656860 4:64836295-64836317 AGATGTAGTGATGGAGGTTGGGG - Intergenic
975842461 4:78489471-78489493 AGCTGAAGAGAAGGAGGGAGAGG + Intronic
977774165 4:100897521-100897543 AGTATTAGGGAAGGAGGCTGGGG + Intergenic
977808595 4:101333218-101333240 AGCTGCTGCTCAGGAGGCTGAGG - Intronic
978930382 4:114303540-114303562 AGTTCCAGCTAAGGAGGCTGAGG + Intergenic
978979896 4:114930594-114930616 AGCTATAGCTAAGTTGGCTGTGG - Intronic
982218770 4:153107083-153107105 AGCTGTAGGGGATGAGGGTGAGG + Intergenic
982667299 4:158281056-158281078 AGCTGTATGGGATGAGGCTGGGG + Intergenic
985032879 4:185809328-185809350 AGATGTAGCCAAGCAGGGTGGGG + Intronic
985392614 4:189506049-189506071 AGCAGTAACGAAGTGGGCTGAGG - Intergenic
985444442 4:190014054-190014076 AGATGTAGAGAAAGAGGCAGGGG + Intergenic
986067764 5:4252195-4252217 AGCTGTCCTGGAGGAGGCTGTGG - Intergenic
987018636 5:13847041-13847063 ACCAGTATGGAAGGAGGCTGTGG + Intronic
989681507 5:44034986-44035008 TGCTGTAACGCAGGAGGCAGAGG - Intergenic
991054434 5:62306296-62306318 AGCTGTGGGGAAGCAGGCGGAGG - Intronic
991216977 5:64166260-64166282 AGGTGTGGCGGAGGAGGCCGGGG + Intronic
991534553 5:67652852-67652874 AGCTGGAGCCCAGGAGGTTGAGG + Intergenic
991687160 5:69191967-69191989 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
992106227 5:73451248-73451270 CGCTGTAGAGAAGGAGGCCCGGG - Intergenic
992458686 5:76940330-76940352 ATCTGGAGCAAAGGAGGCTGAGG + Intergenic
992814098 5:80419159-80419181 AGCTGAAACCAGGGAGGCTGAGG - Intronic
992942843 5:81779788-81779810 AGGGGTAGAAAAGGAGGCTGTGG + Intergenic
994596660 5:101846646-101846668 TGCTGTAGCCAAGGAGCCTTGGG - Intergenic
995928411 5:117405157-117405179 AAATGAAGAGAAGGAGGCTGTGG + Intergenic
998447204 5:142207382-142207404 AGCTGTAACCCAGGAGGCGGAGG + Intergenic
999448939 5:151664234-151664256 ACCTGCAGGGAAGGAGGCAGGGG + Exonic
1000352625 5:160363868-160363890 AGGGGTAGAGAAGGCGGCTGAGG + Intronic
1001530792 5:172460080-172460102 AGATGGAATGAAGGAGGCTGAGG - Intergenic
1002172077 5:177380802-177380824 ATCTGTAGCTGGGGAGGCTGAGG - Intronic
1003542754 6:7032540-7032562 AGCTGGAGCCCAGGAGGTTGAGG + Intergenic
1004166917 6:13265069-13265091 AGTAGAAGTGAAGGAGGCTGTGG - Intronic
1005582746 6:27249900-27249922 AGATGCACTGAAGGAGGCTGGGG - Intronic
1006556340 6:34870377-34870399 AGGTGTAGCCAAGGATCCTGTGG - Intronic
1006624702 6:35389092-35389114 AGCTTGAGCCTAGGAGGCTGAGG + Intronic
1006817496 6:36862348-36862370 GGCTGTGGAGGAGGAGGCTGGGG - Intronic
1007617190 6:43187055-43187077 AGCTGTGGAGAAGGGGGCAGGGG + Exonic
1012040069 6:94192899-94192921 AGCTTGAGCCAAGGAGGCAGAGG - Intergenic
1013355350 6:109341480-109341502 AGCTGCAGCCATGGAGGCTTGGG - Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1018387152 6:163315075-163315097 AGCTGTAGAAAAGAAAGCTGTGG - Exonic
1019612823 7:1945586-1945608 AGATGAAGGGAAGGAGGGTGAGG + Intronic
1019776214 7:2913413-2913435 GGCTGTAGGGGATGAGGCTGAGG + Exonic
1020132793 7:5569062-5569084 AGCAGTGGCACAGGAGGCTGAGG + Intergenic
1020963726 7:14839483-14839505 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1022312355 7:29209046-29209068 AGCTGTAGCCAATGAGGCAAGGG - Intronic
1023831178 7:44039758-44039780 AGCTGTAGCGATGGAGGCAGAGG + Intergenic
1024356905 7:48422885-48422907 AGCTTTAAAGATGGAGGCTGGGG + Intronic
1026045696 7:66904176-66904198 AGCTGGACCGGAGGAGGCTTCGG - Intergenic
1026120464 7:67532382-67532404 AGCTGTTGAGAAGGATCCTGAGG + Intergenic
1026355607 7:69554367-69554389 ACCTGTAGTCCAGGAGGCTGAGG + Intergenic
1029286624 7:99470211-99470233 AGCTGCTGCTTAGGAGGCTGAGG + Intergenic
1029514139 7:101015569-101015591 AGCTGTAGGCAAGGAGGCTGAGG - Intronic
1029522618 7:101073257-101073279 GGCTTGAGCCAAGGAGGCTGAGG + Intergenic
1029610590 7:101624593-101624615 AGCTGTAGTGGAGGATGCCGGGG - Intronic
1029741506 7:102494064-102494086 AGCTGTAGCGATGGAGGCAGAGG + Intronic
1029759498 7:102593233-102593255 AGCTGTAGCGATGGAGGCAGAGG + Intronic
1029776865 7:102689143-102689165 AGCTGTAGCGATGGAGGCAGAGG + Intergenic
1030929396 7:115503598-115503620 TGCTTGAGCGCAGGAGGCTGAGG + Intergenic
1032308185 7:130756225-130756247 AGTGGTAGCAGAGGAGGCTGGGG + Intergenic
1034354659 7:150443081-150443103 AGCTGAAGCGAATGAAGCCGTGG - Intergenic
1034356534 7:150454561-150454583 AGCTGTAGCTAAGGTGTCAGTGG + Intronic
1034405342 7:150899109-150899131 AGCCTTAGCCATGGAGGCTGGGG + Intergenic
1034762729 7:153688627-153688649 AGTTGTAGAGCAGGAAGCTGGGG - Intergenic
1035866237 8:3085554-3085576 AGCTGTGGCCAAGGAATCTGTGG - Intronic
1038449346 8:27629590-27629612 AGCTTTTGAGCAGGAGGCTGGGG + Intergenic
1039112105 8:34051712-34051734 AGCTGTACCGGAGGTGGCAGGGG - Intergenic
1041855811 8:62453532-62453554 AGCTGAAGTGAAGGAAGTTGAGG + Intronic
1042891160 8:73611792-73611814 AGCTACAGCTCAGGAGGCTGAGG - Intronic
1045886238 8:107100643-107100665 AGCTTTAGCGCAGGAGTCTGAGG + Intergenic
1047715788 8:127593967-127593989 AGCTGCAGTTAAGGAGGCTCAGG - Intergenic
1048213906 8:132479368-132479390 AGCAGCAGCGACTGAGGCTGAGG + Intronic
1048275948 8:133066071-133066093 AGCTGTTACTTAGGAGGCTGAGG + Intronic
1048405555 8:134116586-134116608 AATTGTAGAGAAGGAGGCTAAGG - Intergenic
1048436816 8:134425987-134426009 AGCTGGAGGGACGGCGGCTGGGG - Intergenic
1048795337 8:138144293-138144315 ACCTGTAGTTCAGGAGGCTGAGG + Intronic
1048985564 8:139732959-139732981 AGCAGCAAGGAAGGAGGCTGAGG + Intronic
1049203716 8:141353759-141353781 AGCTGGAGGGCAGGGGGCTGGGG - Intergenic
1049206759 8:141367157-141367179 AGCTGGGGAGAGGGAGGCTGGGG + Intronic
1049687767 8:143945815-143945837 GGCTGGAGAGCAGGAGGCTGGGG - Intronic
1049712104 8:144069602-144069624 AGATGCAGTTAAGGAGGCTGAGG - Intergenic
1049753102 8:144294938-144294960 AGCTGTTGAGAAGCTGGCTGAGG - Intronic
1053203282 9:36166745-36166767 CGCGGTAGCTGAGGAGGCTGTGG - Intergenic
1053749654 9:41239166-41239188 AGATGTAGAGAAAGAGGCAGTGG - Intergenic
1054255156 9:62803503-62803525 AGATGTAGAGAAAGAGGCAGGGG - Intergenic
1054336154 9:63812103-63812125 AGATGTAGAGAAAGAGGCAGGGG + Intergenic
1055372193 9:75611964-75611986 AGCTCTAAAGAAGGAGGATGTGG - Intergenic
1056464840 9:86843435-86843457 GGCTGTAGAGAAGGAGGCAGTGG - Intergenic
1056949619 9:91031737-91031759 AGGTGTAGGGTGGGAGGCTGCGG - Intergenic
1057468932 9:95340479-95340501 TGCTGGAGCCCAGGAGGCTGAGG + Intergenic
1058696361 9:107562510-107562532 TGCTGGAGCCCAGGAGGCTGAGG - Intergenic
1060412202 9:123407187-123407209 AGCTGGAGCCTCGGAGGCTGGGG + Intronic
1060960272 9:127675908-127675930 AGATGTAGAGAAGGATGATGCGG - Exonic
1061138909 9:128752644-128752666 ACCAGTAGCCATGGAGGCTGGGG + Intronic
1061493086 9:130956986-130957008 AGCAGCAGGGAAGGGGGCTGAGG - Intergenic
1062174187 9:135151792-135151814 AGCTGGTGCTGAGGAGGCTGAGG - Intergenic
1203372420 Un_KI270442v1:321247-321269 AGATGTAGAGAAAGAGGCAGGGG + Intergenic
1187019279 X:15363200-15363222 AGCTGTGGAGATGCAGGCTGAGG - Exonic
1187996812 X:24935531-24935553 AGGTGCAGCTCAGGAGGCTGGGG - Intronic
1190445009 X:50515205-50515227 TTCTGTAGAGCAGGAGGCTGGGG + Intergenic
1190741629 X:53292534-53292556 AGATGAAGAGAACGAGGCTGAGG + Intronic
1195023799 X:100855519-100855541 AGCTGTAACAAGGGAGGCAGAGG - Intronic
1195330702 X:103796941-103796963 AGCTGTAGCCCCAGAGGCTGCGG + Intergenic
1196819651 X:119692781-119692803 AGCTGCAGCGAGGGAGGCGGTGG + Intronic
1197765201 X:130055677-130055699 AGCTATACCCAAGGAGCCTGTGG + Intronic
1199809657 X:151336512-151336534 AGCTGTAGCGATGGCTGGTGAGG + Intergenic
1201065945 Y:10094058-10094080 AGATGTAGAGAAAGAGGCAGGGG - Intergenic
1201065952 Y:10094136-10094158 AGATGTAGGGAAAGAGGCAGGGG - Intergenic
1201312516 Y:12609683-12609705 AGCTGCTACTAAGGAGGCTGAGG + Intergenic
1202302627 Y:23433863-23433885 AGCTATTGCACAGGAGGCTGAGG - Intergenic
1202568184 Y:26236731-26236753 AGCTATTGCACAGGAGGCTGAGG + Intergenic