ID: 1104674783

View in Genome Browser
Species Human (GRCh38)
Location 12:130705087-130705109
Sequence CCCCCAGAGGCAGCCGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104674783_1104674789 4 Left 1104674783 12:130705087-130705109 CCAGCACCGGCTGCCTCTGGGGG 0: 1
1: 0
2: 3
3: 36
4: 297
Right 1104674789 12:130705114-130705136 TCTCCGTGGCCACATTGCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 128
1104674783_1104674787 -10 Left 1104674783 12:130705087-130705109 CCAGCACCGGCTGCCTCTGGGGG 0: 1
1: 0
2: 3
3: 36
4: 297
Right 1104674787 12:130705100-130705122 CCTCTGGGGGCTCCTCTCCGTGG 0: 1
1: 0
2: 1
3: 37
4: 357
1104674783_1104674792 26 Left 1104674783 12:130705087-130705109 CCAGCACCGGCTGCCTCTGGGGG 0: 1
1: 0
2: 3
3: 36
4: 297
Right 1104674792 12:130705136-130705158 GTTCCGCCTTCAGAGTCACACGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104674783 Original CRISPR CCCCCAGAGGCAGCCGGTGC TGG (reversed) Intronic
900129552 1:1081593-1081615 TCCCCAGATGCAACCTGTGCAGG - Intergenic
900648020 1:3717790-3717812 CCCCCAGATGCTGCCAGGGCAGG + Intronic
900672737 1:3865906-3865928 CCCACAGAGGCAGAGGCTGCTGG + Exonic
900852849 1:5157569-5157591 CTCCCAGACTCAGGCGGTGCGGG + Intergenic
900990065 1:6094528-6094550 TCTCCATACGCAGCCGGTGCCGG - Intronic
901061895 1:6475430-6475452 CCCCCAGAGCCGGCAGATGCGGG - Intronic
902039836 1:13484535-13484557 TCCCCAGAGGCCGATGGTGCTGG + Intronic
903652366 1:24929914-24929936 CCCCCGGGGGCGGCCGGCGCGGG + Intronic
904011942 1:27394883-27394905 CCCCCAGACCCAGCTGGTTCTGG + Exonic
904324623 1:29720279-29720301 AGCCCAGAGGCAGCAGGTGCAGG - Intergenic
904374767 1:30073492-30073514 AACCCAGAGGCAGCAGGTGCGGG + Intergenic
904485932 1:30824590-30824612 CGGCCAATGGCAGCCGGTGCTGG - Intergenic
905309234 1:37037912-37037934 CCCCACGAGGCAGCCAGCGCCGG + Intergenic
905655283 1:39682777-39682799 CCCCGAGAAGCAGCGGGTGAAGG + Intronic
906700326 1:47852980-47853002 TCCCCAAAGGCAGCCAGGGCTGG + Intronic
907048219 1:51312984-51313006 GCCCCAGAGGCAGCTGGTCCTGG + Intronic
907055043 1:51358781-51358803 GCCCCAGAGGCAGAGGTTGCGGG - Intronic
909514310 1:76490072-76490094 CTCCCAGAGGCTGTCGGGGCAGG - Intronic
915119168 1:153617765-153617787 CCACCAGAGGGAGCAGGGGCGGG - Intergenic
915457449 1:156050344-156050366 CCCCCAGATGCAGCAGTTGATGG - Exonic
915924351 1:160004723-160004745 CCCCCAGAGTCAGCCAGTAAAGG + Intergenic
915929237 1:160048505-160048527 CTCCCAGGGGCAGCAGGTGCAGG + Intronic
916466259 1:165077170-165077192 TCCACAGAGGCAGCAGGTGCTGG - Intergenic
920135229 1:203764075-203764097 GGCTCAGAGGCAGCTGGTGCTGG - Intergenic
921189779 1:212699423-212699445 CCCCCAGAGGGCGCAGGAGCTGG + Intronic
922714525 1:227859981-227860003 CCCCTGGAGGCAGCCCCTGCAGG - Intergenic
924624852 1:245689172-245689194 CCCCCAGAGCGAGCAGGTGCGGG - Intronic
1065122760 10:22544572-22544594 CACCCAGAGGGAGCAGGTGTGGG - Intronic
1065588863 10:27245965-27245987 TCCACAGAGGCAGCCGGCGGAGG - Intergenic
1065825016 10:29562818-29562840 CCTCCAGAGGCAGCAGGAGTGGG + Intronic
1065952389 10:30664002-30664024 CCTCCAGAGGCAGCAGGAGTGGG - Intergenic
1068247369 10:54390367-54390389 ACCCCAGAGGCAGAGGTTGCAGG - Intronic
1069620969 10:69836986-69837008 CTCCCAGGGGCAGCAGGTACTGG + Intronic
1069987101 10:72291929-72291951 CTCCCAGAGGCCGTAGGTGCTGG + Intergenic
1070987670 10:80702233-80702255 GACCAAGCGGCAGCCGGTGCTGG - Intergenic
1072697057 10:97611640-97611662 CCCTCAGAGCCAGCCGTTGCTGG - Exonic
1072881352 10:99232684-99232706 CCCCCAGAGCCGGGCGGTGAGGG - Intronic
1073136835 10:101224874-101224896 CCCCCCGCGGCTCCCGGTGCGGG - Intergenic
1075104021 10:119525298-119525320 CCACCAGCTGCAGCCTGTGCAGG + Intronic
1075311839 10:121420885-121420907 CGCCCAGAGGTAGCCTGTGAGGG + Intergenic
1076519605 10:131073449-131073471 CTCCCAGAAGCAGCAGGGGCAGG - Intergenic
1076734525 10:132452757-132452779 CCCCCAGGGGCAGGAGGTGAGGG - Intergenic
1076887631 10:133269831-133269853 CGCTCTGAGGGAGCCGGTGCTGG - Intronic
1077034526 11:488328-488350 GCCCCCGGGGCAGTCGGTGCAGG + Intronic
1077111341 11:863531-863553 CCCCTGGAGGCAGTCGGTGGGGG + Intronic
1078259289 11:9689730-9689752 CCCCCAGAGGGATAGGGTGCTGG + Intronic
1079479599 11:20865518-20865540 CCCACAGATGCAGCCCATGCAGG - Intronic
1081777167 11:45683499-45683521 CCCTCAGCGGAAGCAGGTGCAGG - Intergenic
1083899783 11:65638092-65638114 CCCCCAGGCGGAGCCGGCGCCGG + Intronic
1084083890 11:66845939-66845961 CCCACAGAGGCGGCCCCTGCTGG + Exonic
1084662205 11:70552622-70552644 GCCCCAGAGGCAGCCCATGGTGG - Intronic
1086023865 11:82266421-82266443 CCCCAAAAGGCAGCCTGTGCAGG - Intergenic
1089671750 11:120061873-120061895 CCTCCAGACGCTGCGGGTGCTGG - Intergenic
1090359967 11:126165442-126165464 CCTCCAGGTGCAGCCCGTGCTGG - Intergenic
1091222427 11:133937182-133937204 CTCTCCCAGGCAGCCGGTGCAGG + Intronic
1091784675 12:3235961-3235983 GCCCCAGCGGCAGCAGGTCCAGG - Intronic
1092291412 12:7161560-7161582 GCCCCAGAGGCAGCTGATCCAGG - Intergenic
1095956464 12:47809164-47809186 CCCCTAGAGGCAGCCTGGGGCGG - Intronic
1096080119 12:48827578-48827600 CCCCCAGAACCAGCAGCTGCTGG + Exonic
1096491593 12:52015652-52015674 CCCCCAGGGGCATCAGGTGCTGG + Exonic
1101008434 12:100425738-100425760 CCTCCAGAGGTACCTGGTGCTGG - Intergenic
1102453317 12:113056970-113056992 CCCCCAGCGGGAGCCGGGGGTGG - Intronic
1102522433 12:113486921-113486943 GCCACAGAGGCAGCAGGTGTAGG - Intergenic
1102907616 12:116688843-116688865 CCCACAGAAGCAGGCGGTGGTGG + Intergenic
1103969406 12:124660661-124660683 CCCCCAGTGGCAGGAGGGGCGGG - Intergenic
1104429003 12:128701358-128701380 CCCTCAGAGCCAGCTGGTGTTGG + Intronic
1104674783 12:130705087-130705109 CCCCCAGAGGCAGCCGGTGCTGG - Intronic
1104690108 12:130819125-130819147 GCGCCAGAGGCAGCCGGTCCTGG - Intronic
1104842986 12:131833519-131833541 CCCCCAGAGGAGGCCGGTGCAGG + Intronic
1105450278 13:20493289-20493311 GGCCCATAGGCAGCCGGTGGTGG + Intronic
1106308932 13:28535669-28535691 GCCCCAGAGTCAGCCAGAGCAGG + Intergenic
1108904320 13:55450259-55450281 CCCCATGAGGCCACCGGTGCAGG - Intergenic
1111220859 13:85204875-85204897 CAAGCAGAGGGAGCCGGTGCCGG - Intergenic
1112265019 13:97915700-97915722 CCACCACAGCCAGCCTGTGCTGG - Intergenic
1112344426 13:98577470-98577492 TTCCCAGAGGCCGCCGGGGCGGG - Intronic
1114269573 14:21092546-21092568 CCCCCAGCCGGAGCCGGAGCCGG - Exonic
1117131914 14:52695550-52695572 CCCTCAGATGAAGCCCGTGCGGG + Exonic
1117293194 14:54353516-54353538 CCTCCAGAGCCAGCATGTGCTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1117954759 14:61113900-61113922 CACACCGAGGCAGCAGGTGCAGG - Intergenic
1118122402 14:62859881-62859903 CCCCATGAGGCCACCGGTGCAGG + Intronic
1121053728 14:90836553-90836575 CTCCCAGAGGCACCCTGGGCTGG + Intergenic
1121218451 14:92266464-92266486 CCCCCATAGGCATCCGCTCCGGG + Intergenic
1122418451 14:101561231-101561253 TCCCCAGCGGCAGCGGCTGCCGG + Intergenic
1122606917 14:102952928-102952950 CCCCAAGAGCCAGTTGGTGCTGG - Intronic
1122786481 14:104166514-104166536 CCCCCACCTGCAGCCGCTGCCGG - Intronic
1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG + Intronic
1127356949 15:58209477-58209499 CCCCATGAGGCCGTCGGTGCAGG - Intronic
1127998781 15:64171774-64171796 CCCCCAGAAGGGGCCAGTGCGGG - Exonic
1128579211 15:68797167-68797189 CCCCCAGAGGCCCCGGGTGCTGG + Intronic
1128789482 15:70422683-70422705 CCCCCAGAGGAAGGCAATGCTGG - Intergenic
1129179798 15:73866923-73866945 CACCCAGAGGCAGGAGGTCCAGG - Intergenic
1129331662 15:74831015-74831037 CCCACAGTGGCAGCCGCTGGAGG - Exonic
1129856853 15:78830902-78830924 CTCCCAGCGGCTGCCGGTGTTGG + Intronic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1130928343 15:88401823-88401845 CCCAGAGAGGCAGCAGCTGCCGG - Intergenic
1131067406 15:89443034-89443056 CTCTCAGAGGCAGGCGGAGCCGG + Intergenic
1132605525 16:792269-792291 CACCCAGATGGAGTCGGTGCTGG + Exonic
1132671945 16:1105687-1105709 CCCCCAGAGGCAGGGGGTATGGG + Intergenic
1132829213 16:1919288-1919310 CCCTCAGAGGCAGCCCCTGGGGG - Intergenic
1133198919 16:4190436-4190458 CCCCTCGAGGCAGCCCGGGCTGG + Exonic
1134567111 16:15261286-15261308 CTCCCAGTGGCAGCTGGTGCTGG - Intergenic
1134690063 16:16185122-16185144 CCCCCAGGGGCAGAGGCTGCAGG + Intronic
1134735382 16:16495414-16495436 CTCCCAGTGGCAGCTGGTGCTGG + Intergenic
1134932144 16:18216803-18216825 CTCCCAGTGGCAGCTGGTGCTGG - Intergenic
1135657734 16:24266275-24266297 CCACCACAGGCAGCTGGTGTTGG + Intronic
1136096439 16:27960468-27960490 GTCCCAGAGGGAGCCAGTGCGGG + Intronic
1136110603 16:28062256-28062278 CCTCCAGAGGCAGCCTGGGCTGG - Intronic
1137604207 16:49776401-49776423 CCCCCAGAGGCCGCCCAGGCAGG + Intronic
1138272203 16:55703345-55703367 TCCCCAGAGGGAGGCTGTGCAGG - Intronic
1139090450 16:63640066-63640088 CCTCCAGAGGCATCTGGTGAGGG + Intergenic
1139391551 16:66608969-66608991 CCTCCTGAGGCAGCAGATGCTGG - Intronic
1139558248 16:67726344-67726366 CCTCCATAGGCAACTGGTGCAGG - Exonic
1140223753 16:73063160-73063182 CGCGCAGAGGCCGCCGGTGGCGG - Intergenic
1140850727 16:78932637-78932659 ACCCCAGAGGCCGCAGCTGCAGG - Intronic
1141002681 16:80323276-80323298 CCCTCAGAGGCCGCCGGTTCGGG - Intergenic
1142361842 16:89631083-89631105 CTCCCAAAAGCAGCAGGTGCGGG + Intronic
1142428469 16:90013078-90013100 CCCTCAGAGGCAGGTGGGGCAGG + Intronic
1143670517 17:8392981-8393003 CCCCCAGGGGCATCCCGTGGCGG + Exonic
1144663163 17:17084642-17084664 CCGCACGAGGCAGCAGGTGCTGG - Intronic
1145193555 17:20867864-20867886 CCCCCAGAGGCACACAGGGCAGG + Intronic
1145246745 17:21274666-21274688 ACCCCTGCGGCAGTCGGTGCAGG - Intergenic
1147320683 17:39644067-39644089 CCCCCATGGGCAGGGGGTGCTGG + Intronic
1148838250 17:50478020-50478042 GCTTCAGAGGCAGGCGGTGCAGG - Intergenic
1149597538 17:57873184-57873206 CACCCTGAGGCTGCTGGTGCAGG - Intronic
1150840379 17:68601010-68601032 CCCGCGGTGGCAGCCGGCGCCGG - Exonic
1151491142 17:74432771-74432793 CACCGAGAGGCAGGCGGTGGAGG - Intronic
1151554326 17:74839015-74839037 GCCCCAGATGCCCCCGGTGCAGG + Exonic
1151633758 17:75329352-75329374 TCCCCAGAGGCAGCACGTGTTGG + Intronic
1151729927 17:75905027-75905049 GCGCCCGAGGCAGACGGTGCAGG - Exonic
1151747343 17:76018585-76018607 CCCCCAGGTGCAGCTGCTGCAGG - Exonic
1152227911 17:79101297-79101319 CCCCCAGAGGCCACACGTGCAGG - Intronic
1152323381 17:79621817-79621839 CCCACAAAGGCAGCAGCTGCTGG + Intergenic
1152323421 17:79622173-79622195 CCCACAAAGGCAGCAGCTGCTGG + Intergenic
1152436346 17:80278594-80278616 GCCCTGGAGGCAGACGGTGCTGG + Intronic
1152729427 17:81962190-81962212 CCCCCAGTGGCGGCTGGGGCAGG - Intergenic
1152926028 17:83088168-83088190 CCTGCAGAGGCGGCTGGTGCAGG - Intronic
1153882739 18:9434889-9434911 ACCCCAGAGGCAGAGGTTGCAGG + Intergenic
1157272949 18:46290567-46290589 CCCTCAGAGGCAGCCAGCGGGGG + Intergenic
1157405896 18:47422685-47422707 CACCCAGCGGCAGCCCGGGCTGG + Intergenic
1157558858 18:48632199-48632221 GCCCCAGAGGCAACCTGTCCAGG - Intronic
1157689197 18:49667181-49667203 CCCTCGGAGGCTGCCGGTGCTGG + Intergenic
1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG + Exonic
1157845491 18:51000276-51000298 CTCCAGGAGGCTGCCGGTGCAGG - Intronic
1157870593 18:51226928-51226950 CCCCAAGAGGCAGCTGATGCAGG + Intergenic
1158478480 18:57801874-57801896 CCCCCAAGGGCAGCGCGTGCAGG + Intronic
1159891727 18:73959249-73959271 CCTCCTGAGGCAGGAGGTGCAGG - Intergenic
1160845135 19:1162949-1162971 GCCCCAGGGACAGCCTGTGCTGG + Intronic
1160894478 19:1396198-1396220 GCGCCAGATGCCGCCGGTGCTGG + Intergenic
1161222259 19:3123120-3123142 CCCCCAGAGGGCTCCGCTGCTGG - Exonic
1161808760 19:6459656-6459678 CCCACTGAGGCCGCCGCTGCCGG - Exonic
1162794524 19:13079625-13079647 AGCCCAGAGGCAGCCGGTGCTGG + Intronic
1163415864 19:17186116-17186138 CATCCAGAGGCAGCCGGGGATGG + Intronic
1163519750 19:17784862-17784884 CCCCCACAGGCAGCAGGATCTGG - Exonic
1163846003 19:19638314-19638336 CCCCCAGAATGAGGCGGTGCAGG - Exonic
1165775681 19:38403198-38403220 ACCCCAGAGCCAGCAGGTCCTGG - Exonic
1165963824 19:39557810-39557832 CCCCCTGAGGCTGTAGGTGCAGG + Intergenic
1166747142 19:45146775-45146797 CCCCCAGAGTCTTCCAGTGCTGG - Exonic
1167011702 19:46813106-46813128 CCATCAGAGGCAGCTGGAGCCGG + Intergenic
925284848 2:2709253-2709275 CCCCCAGAGTGCGCCGGTGCCGG + Intergenic
926061390 2:9807231-9807253 GCCCCAGAGGCAGACGCTGAGGG - Intergenic
926120595 2:10239412-10239434 CCTCCAGAGGCTGGCCGTGCTGG + Intergenic
926634377 2:15164537-15164559 CCCCCAGGGTGAGCCAGTGCAGG - Intergenic
927848139 2:26482249-26482271 CCCCCTGAGGCAGGGGCTGCTGG + Intronic
927944010 2:27123847-27123869 CCGCCATAGGCGGCCTGTGCAGG - Exonic
928186135 2:29113017-29113039 CCCCCAAAGACAGCCTGTGTAGG + Intronic
932234361 2:70109138-70109160 GCCCCAAAGGCAGCCGATGCAGG - Intergenic
932345397 2:70991990-70992012 CAACCAGAGGCAGACAGTGCAGG + Intronic
932722253 2:74146831-74146853 CCCTCAGAGGCACTTGGTGCTGG + Intronic
932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG + Exonic
933847423 2:86337268-86337290 GCCCAGGAGGCAGCCGGCGCCGG - Intronic
939558138 2:143701745-143701767 AACCCAGAGGCAGACAGTGCAGG + Intronic
940971187 2:159898775-159898797 CCTTCAGAGCCAGCCGGTACCGG + Exonic
943317891 2:186412032-186412054 CCCCCTGAGGCCAACGGTGCAGG + Intergenic
946152558 2:217786084-217786106 CCCCAAGAGGCAGACGAAGCTGG - Intergenic
946280906 2:218664795-218664817 CTACCAGAGGCAGCAGGAGCGGG - Exonic
947588630 2:231371850-231371872 GCCCCAGAAACAGCAGGTGCTGG + Intronic
948581415 2:238989479-238989501 CCCCGAGAGGCTGCTAGTGCAGG + Intergenic
948715534 2:239858676-239858698 CCTCCAAAGGCAGTGGGTGCAGG - Intergenic
948783055 2:240336498-240336520 CCCCAAGATGTAGCCGATGCTGG - Intergenic
948789508 2:240370076-240370098 CCCCCAGACACAGCTGGTCCTGG - Intergenic
948863156 2:240762680-240762702 CCTCCTGACGCAGCAGGTGCTGG + Intronic
1168800543 20:641830-641852 CCCCCAGAGGGAGGCTCTGCTGG - Intergenic
1169077143 20:2768268-2768290 CCCAGAGAGGCAGCAGGGGCAGG - Intergenic
1169282578 20:4280086-4280108 CCCCTGGAGGAAGCCTGTGCAGG - Intergenic
1169305936 20:4490412-4490434 CTGCCAGAGGCAGCTGGGGCCGG - Intergenic
1169867536 20:10217795-10217817 CCCCCCGAGGCAGCCTGCACGGG + Intergenic
1171978221 20:31608715-31608737 CCCCCAGCTGCAGCCGGGCCTGG + Intergenic
1172511373 20:35503469-35503491 CACTCAGAGGCAGCTGATGCAGG + Exonic
1172565822 20:35929563-35929585 ACCCCAGAGGCAGCTGCTGCAGG - Intronic
1172976355 20:38908830-38908852 CCCCCAGAGGGAACCAATGCTGG - Intronic
1174125069 20:48298280-48298302 CCCCCAGAGCAAGCCGGTGATGG + Intergenic
1175911049 20:62405767-62405789 TTCCCAGAGGCAGCCCCTGCAGG - Intronic
1176217312 20:63954323-63954345 CCCCCAGAGCTGGCCCGTGCTGG - Intronic
1176310159 21:5145142-5145164 CCTCCAAAGGCAGCCCGTTCTGG + Intronic
1178404529 21:32313232-32313254 CCCCCAGAGGCATGGGGTTCAGG + Exonic
1179624678 21:42642128-42642150 AGGCCAGAGGCAGCGGGTGCTGG - Intergenic
1179846897 21:44116894-44116916 CCTCCAAAGGCAGCCCGTTCTGG - Intronic
1179926568 21:44538359-44538381 CCCACAGATGATGCCGGTGCGGG - Intronic
1179937114 21:44612923-44612945 CCCCCAGGGCCAGCCGGCTCCGG + Exonic
1179959741 21:44761477-44761499 CCCCAAGACGCAGCCGAGGCTGG + Intergenic
1180127096 21:45800266-45800288 CCCACAGAGACAGCAGGTCCAGG + Intronic
1180716078 22:17873332-17873354 CACACAGAGGCGGCCTGTGCAGG - Intronic
1181235928 22:21447571-21447593 TCCCCTGAGGCAGCCGAGGCAGG - Exonic
1182828306 22:33284358-33284380 CCACCCTAGGCAGCCAGTGCTGG + Intronic
1183262829 22:36806942-36806964 CCCCCAGAGGCAGAAGGAGAGGG + Intronic
1183333617 22:37234495-37234517 CCCTCAGGGGCAGGCGGTGAGGG - Intronic
1183474198 22:38026876-38026898 GCCTCAGAGGCAGCCGGGGTAGG - Intronic
1183949907 22:41347152-41347174 CCACCAGCAGCAGCTGGTGCTGG - Intronic
1184089036 22:42282912-42282934 CCCACGGAGGGAGCCCGTGCTGG - Intronic
1184287853 22:43482017-43482039 CCCTCAGGTGCAGCCGGTGTTGG + Intronic
1184453696 22:44597456-44597478 ACCCCAGAGGGGGCTGGTGCGGG - Intergenic
1184737843 22:46409638-46409660 CCACCAGAGGCTGCCGGACCTGG + Intronic
1184784370 22:46664619-46664641 CCCGCTGGGGCAGCCGCTGCAGG - Intronic
1185141062 22:49101498-49101520 ACCCCACAGGCAGGAGGTGCAGG + Intergenic
1185315889 22:50178966-50178988 CCCACAGAGCCAGCCCGGGCAGG + Exonic
950574117 3:13820970-13820992 CCCCCACACGCAGCCCATGCTGG + Intronic
950637205 3:14323620-14323642 CCCCGGGAGGCAGGCGGGGCTGG + Intergenic
950703551 3:14766552-14766574 CCCTCAGGGGCAGCCGGCGAGGG + Intronic
953775326 3:45811851-45811873 CCCCTAGAGGCCTCCTGTGCTGG - Intergenic
954131538 3:48563702-48563724 ACCCCAGAAGCAGCTGGTGGCGG - Exonic
954874784 3:53794923-53794945 CCCCTAAAGGCAGAGGGTGCTGG + Intronic
955094689 3:55785616-55785638 CCTCAAGAGGCAGCCCTTGCTGG - Intronic
956786533 3:72647508-72647530 CGCCAAGGGGCAGCAGGTGCAGG + Intergenic
956990463 3:74757007-74757029 TTCCCAGAGGCAGCCCATGCTGG - Intergenic
958503780 3:94946855-94946877 CAGGCAGTGGCAGCCGGTGCTGG + Intergenic
961676274 3:128568910-128568932 CTTCCTGAGGCAGCCAGTGCTGG - Intergenic
963960910 3:151307791-151307813 ACCACAGAGGCAGCCTGTTCTGG - Intronic
965226723 3:166000474-166000496 CCCCCTGAGGCCATCGGTGCAGG + Intergenic
965828153 3:172751182-172751204 CCCCCAAAGGCTGCAAGTGCCGG - Intronic
968471234 4:783355-783377 TCCCCAGAGGCAGCAGGAGGAGG + Intergenic
968516267 4:1016919-1016941 CCCCCAGGGGCACCCAGGGCAGG - Intronic
968554029 4:1238287-1238309 CCACCAGGGGCCGCGGGTGCAGG + Exonic
968908699 4:3466018-3466040 CCCCCAGGGGCAGCCCCTGTGGG - Intronic
969604866 4:8197436-8197458 TCCTCAGACGCAGCCGGGGCTGG + Intronic
971268374 4:25114383-25114405 CACACAGAGGCAGCAGGTGTGGG - Intergenic
972201268 4:36716899-36716921 CCCCCTGAGGCCATCGGTGCAGG + Intergenic
972552178 4:40144068-40144090 CACCAAGAGGCAGCTGGTGCAGG + Intronic
976958864 4:90942022-90942044 GCCCGAGAGGCAGACGTTGCAGG - Intronic
979693379 4:123584306-123584328 ATCCCAGAGGCAGCCAGGGCAGG - Intergenic
981641215 4:146945764-146945786 CCCCCACCGGCGGCAGGTGCTGG + Exonic
984765554 4:183398067-183398089 CCTCCCGAGGCAGCCTGGGCTGG - Intergenic
984837154 4:184032754-184032776 CCACCAGAGCCAGCCACTGCAGG - Intergenic
985604423 5:850751-850773 CCCGCAGAGGGAGCAGGGGCTGG + Exonic
985817157 5:2135556-2135578 CCCCTAGAAGCACCCTGTGCAGG - Intergenic
987258129 5:16179002-16179024 GACCCCGAGGCAGCCGGTGGCGG - Intronic
987472600 5:18351471-18351493 CCCCATGAGGCTGCAGGTGCAGG - Intergenic
988941379 5:36151607-36151629 CCCCGAGTGGCCGCCGCTGCGGG - Exonic
992111533 5:73498686-73498708 CCCCGAGAGTCAGCCTGAGCGGG - Exonic
998406702 5:141878336-141878358 CGCCCAGAGCCAGCCGGAGCCGG - Exonic
998446099 5:142199589-142199611 CCCAGAGAGGCGCCCGGTGCCGG - Intergenic
999448322 5:151659173-151659195 CCCCCAGAGCCAGCGGGACCCGG - Intergenic
999748551 5:154609818-154609840 CCACCTGCGGCAGCAGGTGCAGG + Intergenic
1002167660 5:177358328-177358350 GCCCCAGATGCAGCAGGTGAGGG - Intronic
1002503699 5:179664542-179664564 GCTCCAGGGGCAGCCTGTGCAGG + Intergenic
1002630310 5:180570279-180570301 ACCCCAGAGGCAGAAGTTGCAGG + Intronic
1003319990 6:5042962-5042984 CCCCAAGAGGCAGCTGCTGCAGG + Intergenic
1005959187 6:30684181-30684203 CACCCAGAGACAGCCTTTGCTGG + Intronic
1005990000 6:30896770-30896792 CCCCCAGGGGCAGTCGGGGATGG + Exonic
1006269353 6:32951850-32951872 ACCCCAGAGGCAGGGGTTGCAGG + Intronic
1006451752 6:34109424-34109446 GCTCCAGAGGCAGCCCCTGCAGG - Intronic
1006683130 6:35811612-35811634 CCCCCACAGGAAGATGGTGCAGG + Intronic
1007769253 6:44180053-44180075 CCCCCGGAGGCAGCCGGAGTTGG - Exonic
1008896093 6:56557318-56557340 CACACAAAGGCAGCAGGTGCAGG - Exonic
1012996154 6:105976959-105976981 ACCCCAGAGGCAGAGGTTGCAGG + Intergenic
1014198330 6:118583129-118583151 CCCCCAGAGGCAGAGGTCGCTGG + Intronic
1016385019 6:143522471-143522493 CCCCCAGAGGCAGGCAGGGCTGG - Intergenic
1016894079 6:149035679-149035701 GCCCCAGAGGCAGAGGTTGCAGG + Intronic
1017842069 6:158230695-158230717 CCCCGAGAGGCAGAGGTTGCAGG - Intergenic
1018824496 6:167398936-167398958 CCCTCTGAGGCAGCCAGGGCAGG - Intergenic
1018903989 6:168064669-168064691 CCCCCAAAGGCAGGCAGTGTGGG - Intronic
1019269533 7:139308-139330 CAACCAGAGGCTGCAGGTGCAGG - Intergenic
1019313768 7:375342-375364 TCCCCAGATGCATGCGGTGCAGG - Intergenic
1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019492970 7:1323701-1323723 CCCCCAGCGCCAGGCGGTGGGGG + Intergenic
1019601249 7:1884834-1884856 CCCTCAGACGCAGGCGGGGCAGG + Intronic
1019615434 7:1957429-1957451 ACTCCAGAGGCAGCCAGTGCAGG + Intronic
1019689656 7:2403581-2403603 CCCCCAGAGGCAGCCCTCGCCGG - Exonic
1021564921 7:22007507-22007529 TCCCCAGAGGCAGCCTGTAAAGG - Intergenic
1022518453 7:30990097-30990119 CCCCCAGAGGCAACCTCAGCAGG + Intronic
1023859724 7:44211133-44211155 ACCCAGGAGGCAGCAGGTGCTGG - Intronic
1024236832 7:47405226-47405248 CCCCCAATGCCAGCCGTTGCTGG + Intronic
1026969567 7:74459811-74459833 GCCCCAGAGGCAGCAGTTGTAGG - Intronic
1028922403 7:96322268-96322290 GCCGCAGAGGCCGCCGCTGCTGG - Intergenic
1030270050 7:107661095-107661117 CCCCAAGAGGCGGACGCTGCAGG - Intronic
1034447984 7:151123099-151123121 CCCCCAGGAGCAGCCGGGCCGGG - Intronic
1034672871 7:152871106-152871128 TCCCCAGAGGCTGGCAGTGCTGG - Intergenic
1034878831 7:154748632-154748654 ACTCCAGAGGCAGGCTGTGCAGG - Intronic
1035758480 8:2051691-2051713 CCTTCAGAGCCAGCCAGTGCCGG - Intronic
1035937771 8:3861507-3861529 TCCCAAGAGGCATCAGGTGCAGG - Intronic
1036750476 8:11440545-11440567 CAACCAGAGGCAGGCAGTGCTGG - Intronic
1038362037 8:26889883-26889905 TCCCAGGAGGCAGCCGGAGCAGG + Intergenic
1038425535 8:27461826-27461848 CCCCCAGTGGCCGCCTGTGCAGG - Intronic
1039409657 8:37342255-37342277 CCCTGAGAGGCAGCGCGTGCTGG - Intergenic
1041729812 8:61052223-61052245 CCCCCTGTGGCACCCAGTGCTGG + Intergenic
1045047559 8:98294024-98294046 GCCCGAGAGGGAGCCGTTGCCGG + Exonic
1048978726 8:139691247-139691269 ACCCCAGACACAGCCAGTGCAGG - Intronic
1049037286 8:140086503-140086525 CCCCCAGAGGCAGCAGGAGCTGG - Intronic
1049594797 8:143478323-143478345 CCCCCAGGGGCAGCCACAGCTGG + Intronic
1053322272 9:37109769-37109791 GCCCCAGAGGCAGAGGTTGCGGG + Intergenic
1054870551 9:70044281-70044303 CCCCCGGGGGCAGCAGGAGCGGG - Intronic
1057307720 9:93921779-93921801 CCCTGAGAGGCTGCCGGGGCTGG - Intergenic
1058650851 9:107174655-107174677 ACCACAGAGGCTGCCTGTGCCGG - Intergenic
1059446590 9:114342023-114342045 CCCCCAGAGGCAGATGGTCCAGG - Exonic
1060933600 9:127503704-127503726 GGCCCAGAGGCAGCCAGGGCCGG + Intergenic
1061321789 9:129835512-129835534 CCCACAGAAGCAGCCGGTGGCGG - Intronic
1061486246 9:130921975-130921997 CCCGCACAGGCGGCCGGTGGAGG - Intronic
1061791777 9:133062979-133063001 GCCCCACAGGAAGCCGGTGTCGG + Intronic
1061795452 9:133083545-133083567 GCCCCACAGGAAGCCGGTGTCGG + Intronic
1062376757 9:136265285-136265307 CCCCCAGGGAAAGTCGGTGCTGG - Intergenic
1062597983 9:137307614-137307636 CACCCAGAGCCAGGCGGTGCAGG - Exonic
1062652917 9:137587479-137587501 CCTCCAGAGGCTGCCGGTCCTGG + Intronic
1203760779 EBV:12363-12385 CCCCCGGAGGGACCGGGTGCTGG - Intergenic
1203761708 EBV:15435-15457 CCCCCGGAGGGACCGGGTGCTGG - Intergenic
1203762637 EBV:18507-18529 CCCCCGGAGGGACCGGGTGCTGG - Intergenic
1203763566 EBV:21579-21601 CCCCCGGAGGGACCGGGTGCTGG - Intergenic
1203764495 EBV:24651-24673 CCCCCGGAGGGACCGGGTGCTGG - Intergenic
1203765424 EBV:27723-27745 CCCCCGGAGGGACCGGGTGCTGG - Intergenic
1203766353 EBV:30795-30817 CCCCCGGAGGGACCGGGTGCTGG - Intergenic
1203767282 EBV:33867-33889 CCCCCGGAGGGACCGGGTGCTGG - Intergenic
1203626943 Un_KI270750v1:33827-33849 CCCCCAGAGGCATACAGGGCAGG - Intergenic
1185846634 X:3443490-3443512 CCCATAGAAGCAGCCGGTGCAGG - Intergenic
1187326426 X:18294941-18294963 CCCCCAGTGGCAGCTGCTGTGGG - Intronic
1199820419 X:151440086-151440108 CCCTCAGAAGAAGCAGGTGCTGG + Intergenic
1200121665 X:153794044-153794066 CCCCCTGGGGGAGCCGGTCCAGG + Exonic
1200686823 Y:6265603-6265625 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1200989701 Y:9336519-9336541 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1200992370 Y:9356852-9356874 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1200995021 Y:9377130-9377152 CCCCCAGAGCCTACGGGTGCGGG - Intronic
1200997686 Y:9397476-9397498 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1201000198 Y:9466012-9466034 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1201002857 Y:9486322-9486344 CCCCCAGAGCCTACGGGTGCGGG - Intronic
1201005513 Y:9506605-9506627 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1201008176 Y:9526935-9526957 CCCCCAGAGCCTACGGGTGCGGG - Intergenic
1201729067 Y:17185993-17186015 CCCACAGAGGGAGCCAGTTCTGG + Intergenic