ID: 1104676151

View in Genome Browser
Species Human (GRCh38)
Location 12:130713884-130713906
Sequence GGAGGCGCTTTACGCATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104676151_1104676157 11 Left 1104676151 12:130713884-130713906 CCAGAGATGCGTAAAGCGCCTCC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1104676157 12:130713918-130713940 TATTCAAGGATCCTCAAAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 132
1104676151_1104676159 19 Left 1104676151 12:130713884-130713906 CCAGAGATGCGTAAAGCGCCTCC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1104676159 12:130713926-130713948 GATCCTCAAAGTGGGGTCCCTGG 0: 1
1: 1
2: 43
3: 230
4: 732
1104676151_1104676154 -3 Left 1104676151 12:130713884-130713906 CCAGAGATGCGTAAAGCGCCTCC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1104676154 12:130713904-130713926 TCCTGGTCACGCTGTATTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 88
1104676151_1104676156 10 Left 1104676151 12:130713884-130713906 CCAGAGATGCGTAAAGCGCCTCC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1104676156 12:130713917-130713939 GTATTCAAGGATCCTCAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 95
1104676151_1104676158 12 Left 1104676151 12:130713884-130713906 CCAGAGATGCGTAAAGCGCCTCC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1104676158 12:130713919-130713941 ATTCAAGGATCCTCAAAGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104676151 Original CRISPR GGAGGCGCTTTACGCATCTC TGG (reversed) Intronic
1075889842 10:125938500-125938522 AGAGGTGCTTTAAACATCTCTGG + Intronic
1083469845 11:62876500-62876522 TGAGGCTCTTTACTCACCTCTGG + Intronic
1102454612 12:113063830-113063852 GGAGGAGCTTTTCCCATCACCGG + Intronic
1104676151 12:130713884-130713906 GGAGGCGCTTTACGCATCTCTGG - Intronic
1114145193 14:19967549-19967571 GGAGGTACTTTCCACATCTCAGG + Intergenic
1135054889 16:19223252-19223274 GGATGAGCATTACTCATCTCAGG + Intronic
1135173481 16:20207749-20207771 GGAGGCGAGTTTCTCATCTCAGG + Intergenic
1141485772 16:84339377-84339399 GGAGGCTCTTTAGCCATCCCAGG - Intergenic
1160311126 18:77791207-77791229 GGAAGCACATAACGCATCTCTGG - Intergenic
1161427177 19:4210091-4210113 GGAGGCGCCTTCCGCTTCTTGGG - Exonic
925691066 2:6523747-6523769 GGAGCCTTTTTTCGCATCTCAGG - Intergenic
944057522 2:195538648-195538670 GGAGACCCTTTACAAATCTCTGG - Intergenic
944474985 2:200094384-200094406 GGGGGCCCTTGATGCATCTCTGG - Intergenic
1182371117 22:29811694-29811716 GGAGAAGCTATACCCATCTCAGG - Intronic
1183616479 22:38948782-38948804 GTAGGCCCTTTACCCACCTCTGG - Intergenic
952770220 3:36993138-36993160 GGAGGTGCTTGGCGCTTCTCAGG - Exonic
961332902 3:126153508-126153530 GGAGACGCTTTGCCCATCCCAGG - Exonic
965955250 3:174361790-174361812 GGAAGTGCCTTACTCATCTCAGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1029648723 7:101875663-101875685 GGAGGGGCTCAACGCGTCTCAGG - Intronic
1037585245 8:20271492-20271514 GGAGCCTCTTTAAGCACCTCTGG - Intronic