ID: 1104676369

View in Genome Browser
Species Human (GRCh38)
Location 12:130714755-130714777
Sequence CAGGGTCTGACCGGCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104676369_1104676373 -9 Left 1104676369 12:130714755-130714777 CCTCCGGAGCCGGTCAGACCCTG 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1104676373 12:130714769-130714791 CAGACCCTGCCCATCCCACTGGG 0: 1
1: 1
2: 2
3: 27
4: 246
1104676369_1104676372 -10 Left 1104676369 12:130714755-130714777 CCTCCGGAGCCGGTCAGACCCTG 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1104676372 12:130714768-130714790 TCAGACCCTGCCCATCCCACTGG 0: 1
1: 1
2: 6
3: 29
4: 269
1104676369_1104676382 14 Left 1104676369 12:130714755-130714777 CCTCCGGAGCCGGTCAGACCCTG 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1104676382 12:130714792-130714814 AGCTTGGGATCATGTCTCACAGG 0: 1
1: 0
2: 0
3: 15
4: 87
1104676369_1104676376 -2 Left 1104676369 12:130714755-130714777 CCTCCGGAGCCGGTCAGACCCTG 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1104676376 12:130714776-130714798 TGCCCATCCCACTGGGAGCTTGG 0: 1
1: 0
2: 7
3: 39
4: 249
1104676369_1104676377 -1 Left 1104676369 12:130714755-130714777 CCTCCGGAGCCGGTCAGACCCTG 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1104676377 12:130714777-130714799 GCCCATCCCACTGGGAGCTTGGG 0: 1
1: 0
2: 3
3: 37
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104676369 Original CRISPR CAGGGTCTGACCGGCTCCGG AGG (reversed) Intronic
900101234 1:962983-963005 CAGGACCTGACCGGCACAGGTGG - Intronic
901497488 1:9630244-9630266 CAAGGCCTGACGGCCTCCGGGGG - Intergenic
901634930 1:10666143-10666165 CAGGGGCTGACGTGCTCGGGTGG - Intronic
904140322 1:28348014-28348036 CAGGGGCTGACCGGGTGCAGTGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906115022 1:43350719-43350741 CAGGTTCTGGCCGGGTGCGGTGG + Intronic
906944858 1:50286985-50287007 CAGGCTCTGTCCCGCTCTGGGGG + Intergenic
907836904 1:58118196-58118218 CAAGGCCTGACCGGGTGCGGTGG - Intronic
908413213 1:63887059-63887081 CATGGTCTGACCTGCCCAGGTGG - Intronic
913960830 1:143337087-143337109 CAGGGTCTGAGGGGCCCAGGAGG - Intergenic
914055184 1:144162659-144162681 CAGGGTCTGAGGGGCCCAGGAGG - Intergenic
914123962 1:144803702-144803724 CAGGGTCTGAGGGGCCCAGGAGG + Intergenic
916656807 1:166884126-166884148 CAGGAACTCACCGGCTCTGGCGG + Intergenic
917819471 1:178747791-178747813 CAGGGCCTGAGCGTCTCCGCTGG - Intronic
922574038 1:226650692-226650714 CAGGGGCTGACAGGCTTCAGGGG + Intronic
1064109960 10:12530152-12530174 CAAGGTCTGGCCGGCTCCCAAGG + Intronic
1065828946 10:29597075-29597097 CAGGGAGAGACCGGCTCCTGAGG + Intronic
1067216942 10:44311053-44311075 CGGGGTCTGCGCGGCTGCGGTGG + Intergenic
1069386169 10:67884913-67884935 CAGGGGCTGCCCGGGTGCGGCGG + Exonic
1073308068 10:102518850-102518872 AAGGGTCTGGCCGGGTGCGGTGG + Intronic
1076587048 10:131556396-131556418 CCTGGTCTGACCAGCTCCTGGGG - Intergenic
1079348391 11:19672541-19672563 CAGGGGCTCACTGGCTCCTGAGG - Intronic
1083639871 11:64139667-64139689 CAGGGGCTGGCCGGGTGCGGTGG + Intronic
1085019704 11:73198006-73198028 CAGGGTCTGGCCGGGCACGGTGG - Intergenic
1089523764 11:119083326-119083348 CAGGGTCTCACCGGGCGCGGTGG + Intergenic
1091547303 12:1509988-1510010 CAAGGTCTAACCGGCTCAGGAGG + Intergenic
1096100882 12:48969939-48969961 CTGGCTCAGAGCGGCTCCGGGGG + Intronic
1096997377 12:55847244-55847266 CTGGGTCAGCCCGGCTCAGGGGG - Intergenic
1102124404 12:110468780-110468802 CAGTGTCCGAACGGCTTCGGAGG + Exonic
1103500789 12:121400227-121400249 GAGGGTCTGTCCGGCTCCACCGG - Intronic
1103637648 12:122320993-122321015 CAGAGTCTCACCGGGTGCGGTGG - Intronic
1104676369 12:130714755-130714777 CAGGGTCTGACCGGCTCCGGAGG - Intronic
1105013125 12:132769134-132769156 CAGGCTCTCACAGGATCCGGAGG - Exonic
1114570540 14:23664333-23664355 GAAGGACTGACAGGCTCCGGTGG + Intergenic
1119998640 14:79279266-79279288 GAGGGACTGGCTGGCTCCGGAGG - Intronic
1127995783 15:64152444-64152466 CGGGGGCTGACCGGCTGCGCAGG - Intronic
1128145147 15:65328885-65328907 CAGTGTCTGGCAGGCTCCAGAGG - Exonic
1129290402 15:74562512-74562534 CAGGGTCTCACTGTCTCCCGGGG + Intronic
1129467180 15:75730770-75730792 CAGGCTCTGGCTGGGTCCGGGGG + Intergenic
1130874306 15:87999047-87999069 CAGGGTATGAAAGGCTCCTGTGG + Intronic
1132802034 16:1759234-1759256 CAGGGTCTGCCCGGCGCTTGTGG - Intronic
1134156130 16:11844702-11844724 CTGGGTCTGCACGGCTCCTGGGG + Intronic
1135029010 16:19022739-19022761 CAGGCTGTGGCCGGGTCCGGGGG + Intronic
1135196860 16:20401993-20402015 CAGAGTCTGACCGACTGTGGAGG - Intronic
1136590543 16:31215458-31215480 CAGGGACTGACCAGCCCCTGCGG + Intronic
1137389540 16:48069845-48069867 CAGGGTCTGGCCGGGCGCGGTGG - Intergenic
1139379428 16:66521281-66521303 CTGGGACTGACAGACTCCGGTGG + Intronic
1141039050 16:80655815-80655837 CAGAGTCTGAGGGGCTCTGGAGG - Intronic
1141430517 16:83968490-83968512 CGGGGACTGGCCGGCGCCGGGGG - Intergenic
1141888590 16:86910702-86910724 CAGGGTTTGGCCGGCCCCTGCGG - Intergenic
1141924667 16:87160318-87160340 CCGGCTCTGAGCGGCTCCCGAGG - Intronic
1142130725 16:88430473-88430495 CGGGGTCTGCGCGGCTCCCGGGG - Exonic
1147890129 17:43711260-43711282 CAGGGTGTGACCGTCACCTGAGG + Intergenic
1148000551 17:44384881-44384903 CAGGACCTGACCGTCTGCGGTGG + Intronic
1148010158 17:44472979-44473001 GAGGGTCTGGCCGGGTGCGGTGG - Intronic
1148795767 17:50195957-50195979 CAGGGTCCCACCGGCCCCGCTGG - Exonic
1148805835 17:50263553-50263575 CAGGGTCTGACTGGCCATGGGGG + Intergenic
1151499097 17:74477559-74477581 CAGGGTCTGACCACCCCAGGTGG - Intronic
1151656829 17:75500117-75500139 CAGGGTCTGCCCACCCCCGGCGG + Intergenic
1154144127 18:11852019-11852041 CAGGGCCAGACCGGCTCCGTGGG + Exonic
1154163820 18:11999246-11999268 CAGGGTCTGCCGGGGTCAGGGGG + Intronic
1157860018 18:51133021-51133043 CAGGGTCTGCCCGGCCTGGGGGG - Intergenic
1160371770 18:78378057-78378079 CTGGGTCTAACAGGCTCTGGGGG - Intergenic
1161520944 19:4723361-4723383 CAGGCTCTGACCCCTTCCGGAGG - Intronic
1161574277 19:5047320-5047342 CAGGGTATGACCGGCCCCTGGGG + Intronic
1161722946 19:5913842-5913864 CAGGTTCTGACCGGCCACTGCGG - Intronic
1161955012 19:7488922-7488944 CAGGGGCGGACCGGGGCCGGAGG - Intronic
1165313667 19:35042266-35042288 CAGTGTCTGACCAGCAGCGGGGG - Exonic
1165434339 19:35788141-35788163 CGGGATCTGAACGGCTTCGGGGG - Exonic
1166309885 19:41956988-41957010 CAGGGTCTGAGCAGCTGGGGTGG - Intronic
1167677680 19:50897617-50897639 CAGGGTCTCACCGCCTAAGGTGG - Intergenic
1202694666 1_KI270712v1_random:115336-115358 CAGGGTCTGAGGGGCCCAGGAGG - Intergenic
930075665 2:47403551-47403573 CAGGTTCTGCTTGGCTCCGGAGG + Intronic
933354139 2:81194109-81194131 CAGAGCCTCACCGGCCCCGGCGG - Intergenic
934275838 2:91572382-91572404 CAGGGTCTGAGGGGCCCAGGAGG - Intergenic
936017547 2:108971131-108971153 CAGGGTCTGACCGCCTGCCCAGG - Intronic
1168771864 20:420811-420833 CGGGGTCTGACCCGCCCCCGAGG + Intronic
1171413501 20:24962041-24962063 CAGGGCATGACCAGCGCCGGGGG + Intergenic
1175124288 20:56739922-56739944 CAGTGACTGATCAGCTCCGGAGG + Intergenic
1175202847 20:57290014-57290036 CAGGGAGTGACAGGCTCCTGAGG + Intergenic
1175828683 20:61950752-61950774 CTGGGACTGACTGGCTCCTGAGG - Intergenic
1175905217 20:62376316-62376338 CAGGGATTCACCAGCTCCGGGGG - Intergenic
1179935654 21:44602126-44602148 AAGGGTCTGACCTGCTCCCGTGG - Exonic
949517446 3:4820534-4820556 CAGGCTCTGACCGGGTTGGGTGG - Intronic
950388686 3:12679336-12679358 CAGGGCCTGGCCGGGTGCGGTGG - Intergenic
950976839 3:17255485-17255507 CAGGATCTGGCCGGGTGCGGTGG - Intronic
954682480 3:52353161-52353183 CAGCGTCTGACTGGCTGCGCTGG + Exonic
956846686 3:73189995-73190017 CAGGGTCTGACAGGTTTCGAGGG - Intergenic
961626797 3:128269633-128269655 CAGGGTATGGCAGGCTCCGCAGG - Intronic
967515561 3:190364648-190364670 TAGGGTCTGACTGGCTCAAGTGG + Intronic
968765842 4:2468763-2468785 CGGGGCCTGCTCGGCTCCGGAGG + Intronic
971438364 4:26652526-26652548 CAGGCTCTGGCCGGGTGCGGTGG - Intronic
972417445 4:38855716-38855738 CAGGGTATGAACGCCTCTGGAGG - Intronic
987310732 5:16678916-16678938 CCGGGACTGACCGGCTACGTGGG + Intronic
988100389 5:26669462-26669484 CAGAGCCTCACCGGCCCCGGCGG - Intergenic
988968755 5:36445280-36445302 CAGGGTCTGACCTGCTCCAGGGG + Intergenic
997747315 5:136310531-136310553 CAGGGTCTGGAAGGCTCAGGAGG + Intronic
1001834951 5:174824100-174824122 CAGGCTCTGAGGGGCTCCTGAGG - Intergenic
1006317443 6:33298859-33298881 CAGGCTCTGACCTGCTCGGGAGG + Exonic
1016881063 6:148912619-148912641 CAGGCTCTGACCGGCCAGGGAGG - Intronic
1018963407 6:168464953-168464975 CAGTGTCTGAGAAGCTCCGGAGG + Intronic
1020062952 7:5166293-5166315 TAGGGTCTGGCCGGCCGCGGTGG - Intergenic
1020165294 7:5802871-5802893 TAGGGTCTGGCCAGCTGCGGTGG + Intergenic
1021657861 7:22889971-22889993 CAGGGGCTGGCCGGCACAGGTGG - Intergenic
1033644293 7:143288671-143288693 CAGGCTCGGAGCGGCTCGGGCGG - Intronic
1035044883 7:155957196-155957218 TAGGGTGTGACAGGCTCCTGAGG - Intergenic
1035066016 7:156105595-156105617 CAGGGACTTACAGGCTCCGCGGG - Intergenic
1037547556 8:19939486-19939508 CAGAGTCTGACCGCCTCCCGCGG + Exonic
1039549656 8:38433608-38433630 CAGGGTCTGGCTGGGTGCGGTGG - Intronic
1047537389 8:125732350-125732372 CAGCGTCTGTCTGGCTCCTGAGG - Intergenic
1047880493 8:129187164-129187186 CAGGGTCTTACAGGCTCTTGTGG - Intergenic
1048861103 8:138724937-138724959 CAGGGCCTGACCCACTCCGTAGG + Intronic
1049616273 8:143577051-143577073 GAGGGACTGACCGGGTCAGGGGG + Exonic
1057222684 9:93266117-93266139 CAGGGACAGACTGGCTCCAGAGG + Intronic
1060876924 9:127090335-127090357 CAGGGTCTGACCAGCTCTGAAGG + Intronic
1062303547 9:135889208-135889230 CAGGCCCTGACCTGCTCCTGGGG - Intronic
1186860180 X:13665440-13665462 CATGGTCTGGCCGGGTGCGGTGG + Intronic
1190106014 X:47561647-47561669 CAGTGTCTGACCGCCCCCGCCGG + Intronic
1190984762 X:55490155-55490177 CAGGCTCTGACAGGATCCTGAGG - Intergenic
1192472053 X:71407591-71407613 TAGGGTCTGTGCGGCGCCGGTGG - Exonic