ID: 1104679438

View in Genome Browser
Species Human (GRCh38)
Location 12:130739354-130739376
Sequence ATAATCCAGCTGTGCCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104679438_1104679441 10 Left 1104679438 12:130739354-130739376 CCTAACTGGCACAGCTGGATTAT No data
Right 1104679441 12:130739387-130739409 CAGAGACTAACACGTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104679438 Original CRISPR ATAATCCAGCTGTGCCAGTT AGG (reversed) Intergenic
No off target data available for this crispr