ID: 1104683553

View in Genome Browser
Species Human (GRCh38)
Location 12:130768972-130768994
Sequence AAGGAAAAGAAAAATGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104683549_1104683553 1 Left 1104683549 12:130768948-130768970 CCATGTGATTTCCATTTCTGTAA No data
Right 1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG No data
1104683551_1104683553 -10 Left 1104683551 12:130768959-130768981 CCATTTCTGTAAAAAGGAAAAGA No data
Right 1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG No data
1104683545_1104683553 24 Left 1104683545 12:130768925-130768947 CCCTGTCAGCTCCTTATGACCTA No data
Right 1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG No data
1104683546_1104683553 23 Left 1104683546 12:130768926-130768948 CCTGTCAGCTCCTTATGACCTAC No data
Right 1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG No data
1104683544_1104683553 28 Left 1104683544 12:130768921-130768943 CCAGCCCTGTCAGCTCCTTATGA No data
Right 1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG No data
1104683548_1104683553 5 Left 1104683548 12:130768944-130768966 CCTACCATGTGATTTCCATTTCT No data
Right 1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG No data
1104683547_1104683553 13 Left 1104683547 12:130768936-130768958 CCTTATGACCTACCATGTGATTT No data
Right 1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104683553 Original CRISPR AAGGAAAAGAAAAATGAGGC CGG Intergenic
No off target data available for this crispr