ID: 1104684573

View in Genome Browser
Species Human (GRCh38)
Location 12:130776366-130776388
Sequence CTGGCTTCCCAGCTGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104684566_1104684573 22 Left 1104684566 12:130776321-130776343 CCATTTCAAAGCGCTGTGGCGGA No data
Right 1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104684573 Original CRISPR CTGGCTTCCCAGCTGGAAGG AGG Intergenic
No off target data available for this crispr