ID: 1104684673

View in Genome Browser
Species Human (GRCh38)
Location 12:130777084-130777106
Sequence ACTATCCTGCCCAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104684665_1104684673 29 Left 1104684665 12:130777032-130777054 CCTAAGCTCTGTACGTGTAGAAT No data
Right 1104684673 12:130777084-130777106 ACTATCCTGCCCAGGCTGGAGGG No data
1104684669_1104684673 -3 Left 1104684669 12:130777064-130777086 CCTTTTAGATATGGGGTCTCACT No data
Right 1104684673 12:130777084-130777106 ACTATCCTGCCCAGGCTGGAGGG No data
1104684664_1104684673 30 Left 1104684664 12:130777031-130777053 CCCTAAGCTCTGTACGTGTAGAA No data
Right 1104684673 12:130777084-130777106 ACTATCCTGCCCAGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104684673 Original CRISPR ACTATCCTGCCCAGGCTGGA GGG Intergenic
No off target data available for this crispr