ID: 1104684966

View in Genome Browser
Species Human (GRCh38)
Location 12:130778893-130778915
Sequence CCATCTAGACAGGAGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104684966_1104684980 30 Left 1104684966 12:130778893-130778915 CCCGCCACCTCCTGTCTAGATGG No data
Right 1104684980 12:130778946-130778968 TTGTTTTTTTGCGGAAGAGGGGG No data
1104684966_1104684979 29 Left 1104684966 12:130778893-130778915 CCCGCCACCTCCTGTCTAGATGG No data
Right 1104684979 12:130778945-130778967 TTTGTTTTTTTGCGGAAGAGGGG No data
1104684966_1104684978 28 Left 1104684966 12:130778893-130778915 CCCGCCACCTCCTGTCTAGATGG No data
Right 1104684978 12:130778944-130778966 TTTTGTTTTTTTGCGGAAGAGGG No data
1104684966_1104684977 27 Left 1104684966 12:130778893-130778915 CCCGCCACCTCCTGTCTAGATGG No data
Right 1104684977 12:130778943-130778965 TTTTTGTTTTTTTGCGGAAGAGG No data
1104684966_1104684975 21 Left 1104684966 12:130778893-130778915 CCCGCCACCTCCTGTCTAGATGG No data
Right 1104684975 12:130778937-130778959 TCTTCCTTTTTGTTTTTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104684966 Original CRISPR CCATCTAGACAGGAGGTGGC GGG (reversed) Intergenic
No off target data available for this crispr