ID: 1104685313

View in Genome Browser
Species Human (GRCh38)
Location 12:130780988-130781010
Sequence GGGGATCGGTGGACGCTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104685313_1104685326 17 Left 1104685313 12:130780988-130781010 CCACGGAGCGTCCACCGATCCCC No data
Right 1104685326 12:130781028-130781050 AGGGAGGCGGCACCCACAACAGG No data
1104685313_1104685321 -3 Left 1104685313 12:130780988-130781010 CCACGGAGCGTCCACCGATCCCC No data
Right 1104685321 12:130781008-130781030 CCCAGGACAGGTTGTGGCTCAGG No data
1104685313_1104685324 1 Left 1104685313 12:130780988-130781010 CCACGGAGCGTCCACCGATCCCC No data
Right 1104685324 12:130781012-130781034 GGACAGGTTGTGGCTCAGGGAGG No data
1104685313_1104685325 4 Left 1104685313 12:130780988-130781010 CCACGGAGCGTCCACCGATCCCC No data
Right 1104685325 12:130781015-130781037 CAGGTTGTGGCTCAGGGAGGCGG No data
1104685313_1104685327 26 Left 1104685313 12:130780988-130781010 CCACGGAGCGTCCACCGATCCCC No data
Right 1104685327 12:130781037-130781059 GCACCCACAACAGGCTTCCCAGG No data
1104685313_1104685318 -9 Left 1104685313 12:130780988-130781010 CCACGGAGCGTCCACCGATCCCC No data
Right 1104685318 12:130781002-130781024 CCGATCCCCAGGACAGGTTGTGG No data
1104685313_1104685323 -2 Left 1104685313 12:130780988-130781010 CCACGGAGCGTCCACCGATCCCC No data
Right 1104685323 12:130781009-130781031 CCAGGACAGGTTGTGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104685313 Original CRISPR GGGGATCGGTGGACGCTCCG TGG (reversed) Intergenic
No off target data available for this crispr