ID: 1104686299

View in Genome Browser
Species Human (GRCh38)
Location 12:130787305-130787327
Sequence GGTCCCATGGGACCAAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104686299_1104686312 28 Left 1104686299 12:130787305-130787327 CCATGTCTTGGTCCCATGGGACC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1104686312 12:130787356-130787378 GCTTGTAGACATGAGCTTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 142
1104686299_1104686314 30 Left 1104686299 12:130787305-130787327 CCATGTCTTGGTCCCATGGGACC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1104686314 12:130787358-130787380 TTGTAGACATGAGCTTTTGGGGG 0: 1
1: 0
2: 0
3: 31
4: 491
1104686299_1104686313 29 Left 1104686299 12:130787305-130787327 CCATGTCTTGGTCCCATGGGACC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1104686313 12:130787357-130787379 CTTGTAGACATGAGCTTTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 171
1104686299_1104686311 27 Left 1104686299 12:130787305-130787327 CCATGTCTTGGTCCCATGGGACC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1104686311 12:130787355-130787377 AGCTTGTAGACATGAGCTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 151
1104686299_1104686303 -3 Left 1104686299 12:130787305-130787327 CCATGTCTTGGTCCCATGGGACC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1104686303 12:130787325-130787347 ACCTGGCCCTACTTGACCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104686299 Original CRISPR GGTCCCATGGGACCAAGACA TGG (reversed) Intergenic
902874427 1:19332288-19332310 GGTCTCATGGGATGAAGAAACGG - Intergenic
906050598 1:42868237-42868259 GGGCCCATTGGACAATGACAGGG - Intergenic
906178319 1:43795898-43795920 GGTGCCTTGAGTCCAAGACATGG - Intronic
906258014 1:44365499-44365521 AGTCCCCTGGGACCAAGCCCTGG - Intergenic
907492525 1:54817198-54817220 GTTCCCATGGGAACCAAACATGG - Intronic
908300970 1:62760974-62760996 GCTGCCATGGGACCTAGAAAGGG - Intergenic
909172493 1:72314638-72314660 GGTCCCATTGGGCAATGACAGGG + Intergenic
909663881 1:78112547-78112569 GCTCTCATGGGACCAGAACAAGG + Intronic
912021776 1:105115057-105115079 GCTGCCATGGGACCTAGAAATGG - Intergenic
912631957 1:111254132-111254154 TGTCCCATGGGACAAAAGCAGGG + Intergenic
913197735 1:116471959-116471981 TGTCCTATGGGAGCAACACAGGG - Intergenic
913968812 1:143398388-143398410 GGACCAAGGGGACCAAGGCAAGG - Intergenic
914063191 1:144223987-144224009 GGACCAAGGGGACCAAGGCAAGG - Intergenic
914115959 1:144742367-144742389 GGACCAAGGGGACCAAGGCAAGG + Intergenic
916190108 1:162170165-162170187 GGACACATGTGACCAACACAAGG - Intronic
916676175 1:167065944-167065966 GGTCCCCGGGGAACAAGAGAAGG + Intronic
917149363 1:171928496-171928518 TGTGCTATGGGACCAAGCCAGGG + Intronic
917462814 1:175246984-175247006 GGGCCCATTGGGCCATGACAGGG - Intergenic
918154448 1:181831913-181831935 GCTGCCATGGGACCTAGAAAGGG - Intergenic
919926279 1:202193494-202193516 GGTCACATGGGACCCAGAGGAGG - Intergenic
920203143 1:204273022-204273044 GGTCACAGGGGACCCTGACAAGG - Intronic
920756542 1:208739168-208739190 GCTCCCATGGGACCTAGAAAGGG - Intergenic
922561194 1:226570779-226570801 GGTCCAATGGCACAAAAACAAGG - Intronic
1064139426 10:12777970-12777992 TGTCCCCTGGGCCCAAGCCAGGG + Intronic
1064603019 10:17012238-17012260 GCTGCCATGGGACCTAGAAAGGG + Intronic
1066613718 10:37276187-37276209 GCTGCCATGGGACCTAGAAAGGG + Intronic
1072370796 10:94764831-94764853 GCTGCCATGGGACCTAGAAAGGG + Intronic
1074250411 10:111739799-111739821 GATCCTTTGGGAACAAGACAAGG + Intergenic
1075002655 10:118809639-118809661 GGTACCATGGGTCCAAGATGAGG + Intergenic
1077933243 11:6755102-6755124 GAACACATGGGACCAAGGCAAGG - Intergenic
1079107373 11:17580059-17580081 GGTCCCAAGGGTCCTAGGCAGGG - Intronic
1079730701 11:23935597-23935619 GCTGCCATGGGACCTAGAAAGGG + Intergenic
1081421933 11:42880871-42880893 GCTGCCATGGGACCTAGAAAGGG - Intergenic
1081537225 11:44004798-44004820 GGTCCCGTGGGACCAGGAAGGGG - Intergenic
1082235857 11:49820128-49820150 GGTACCATGGGGCCAGCACAGGG + Intergenic
1083877682 11:65532880-65532902 GGACCCATGGGCCAAAGCCAAGG - Intronic
1085053871 11:73393050-73393072 GCTCCCATGGGCCCAGGGCAGGG - Intronic
1085342364 11:75741411-75741433 GGTCTCATTTGCCCAAGACAAGG - Intergenic
1085807025 11:79645537-79645559 GGTGCTATGGGAGCAAGACCGGG - Intergenic
1086317967 11:85613137-85613159 GCTGCCATGGGACCTAGAAAGGG - Intronic
1087075611 11:94124957-94124979 GCTGCCATGGGACCTAGAAAGGG - Intergenic
1088493157 11:110406155-110406177 GCTGCCATGGGACCTAGAAAGGG - Intergenic
1088688820 11:112307221-112307243 GGTCCCATAGCACCAACTCAAGG - Intergenic
1089499583 11:118924624-118924646 GGTTCCTTTGGATCAAGACAGGG + Intronic
1094856027 12:34403226-34403248 AGTCCCACGGGGCCAAGCCAAGG + Intergenic
1100050570 12:90444101-90444123 GCTCTCATGGGACCTAGAAAGGG + Intergenic
1101399603 12:104376065-104376087 GGTCCCAAGGGATTCAGACAAGG + Intergenic
1103898555 12:124291085-124291107 GGTCCCAGTGGACCGTGACATGG - Intronic
1104686299 12:130787305-130787327 GGTCCCATGGGACCAAGACATGG - Intergenic
1105770832 13:23610453-23610475 GCTCCCTTGGGACCAAGATAAGG + Intronic
1107352709 13:39532545-39532567 GGTCCCATGGGATATATACATGG - Intronic
1109156259 13:58913738-58913760 GCTTCCATGGGATCAAGAGATGG - Intergenic
1114353177 14:21877225-21877247 GGTTCCATGTGACCATTACAAGG + Intergenic
1115285039 14:31706461-31706483 GCTGCCATGGGACCTAGAAAGGG + Intronic
1116604153 14:46968212-46968234 GCTATTATGGGACCAAGACAAGG + Intronic
1118367692 14:65109622-65109644 GGTGCAATGGGAACAATACATGG - Intergenic
1119303287 14:73587749-73587771 GGTCCCGTGGAAACAAGTCAGGG - Intergenic
1121413303 14:93762472-93762494 TGTCCCAGGGGAACAGGACAGGG - Intronic
1202935374 14_KI270725v1_random:82896-82918 GGTCTCATTGGACAATGACAGGG + Intergenic
1125347746 15:38735796-38735818 GGTCTTAGGGGAACAAGACATGG + Intergenic
1129109276 15:73328266-73328288 CCTGCCATGGGACCCAGACACGG - Intronic
1129547596 15:76413783-76413805 GGTCCCACGGAAACAACACAGGG - Intronic
1129992578 15:79977810-79977832 GGTCCCATGGGGCCAAGCCTTGG + Intergenic
1134784765 16:16931736-16931758 ATTCCCATGGGACTAACACAGGG - Intergenic
1135517833 16:23149815-23149837 CGTCCCTTGGGAGCCAGACAGGG - Intergenic
1140194812 16:72847451-72847473 GCTCCCAGGGTACCAAGAGATGG - Intronic
1145397516 17:22507003-22507025 GGACCCAGGGAAGCAAGACATGG + Intergenic
1146843797 17:36171433-36171455 GGTCCGCTGGGAACATGACATGG - Intronic
1146856104 17:36259367-36259389 GGTCCGCTGGGAACATGACATGG - Intronic
1146864517 17:36329008-36329030 GGTCCGCTGGGAACATGACATGG + Intronic
1146872009 17:36383278-36383300 GGTCCGCTGGGAACATGACATGG - Intronic
1146879371 17:36434363-36434385 GGTCCGCTGGGAACATGACATGG - Intronic
1147067375 17:37929596-37929618 GGTCCGCTGGGAACATGACATGG + Intronic
1147074897 17:37983902-37983924 GGTCCGCTGGGAACATGACATGG - Intronic
1147078906 17:38009157-38009179 GGTCCGCTGGGAACATGACATGG + Intronic
1147086420 17:38063448-38063470 GGTCCGCTGGGAACATGACATGG - Intronic
1147094843 17:38133092-38133114 GGTCCGCTGGGAACATGACATGG + Intergenic
1147102365 17:38187411-38187433 GGTCCGCTGGGAACATGACATGG - Intergenic
1150861015 17:68800696-68800718 GCTCCCAGGGGACCAGAACAAGG + Intergenic
1155362503 18:25016594-25016616 GGTTCCATGGGCCCAGGACAGGG + Intergenic
1159082548 18:63752220-63752242 GGTCACATGGGTCCAAGATGGGG + Intergenic
1160991366 19:1861650-1861672 AGGCCCCTGGGACCAGGACAGGG + Intronic
1164714968 19:30384547-30384569 GGTCCCATGCAACCAAAGCAGGG - Intronic
1202702601 1_KI270712v1_random:175858-175880 GGACCAAGGGGACCAAGGCAAGG - Intergenic
925006488 2:447135-447157 GGTCACAAGGGACCAAGGGAGGG - Intergenic
925078170 2:1037233-1037255 TGTCCCAAAGGACCCAGACATGG - Intronic
925295647 2:2774731-2774753 AGTCCCAGGGGACCAAGGCAAGG - Intergenic
925777137 2:7346766-7346788 GGTGCCATGGCTCCAAGACTGGG - Intergenic
927488259 2:23504002-23504024 GGTCCCTGAGGGCCAAGACAGGG + Intronic
927892246 2:26758841-26758863 GGTCCTAAGGAAGCAAGACAAGG - Intergenic
929246140 2:39705827-39705849 GTACACATGGGGCCAAGACAAGG - Intronic
930304785 2:49665058-49665080 GGTGCTATGGGCCCAAGCCAGGG + Intergenic
931159819 2:59676641-59676663 GGTTCCAAGAGACTAAGACAAGG + Intergenic
932574972 2:72957767-72957789 GGTGCCATGGGTCCCAAACAGGG + Intronic
934173511 2:89559311-89559333 GGACCAAGGGGACCAAGGCAAGG - Intergenic
934283825 2:91633664-91633686 GGACCAAGGGGACCAAGGCAAGG - Intergenic
934460586 2:94212224-94212246 GGTAGCACGGGGCCAAGACAGGG - Intergenic
948372970 2:237502366-237502388 GGTCCCTTGGGTCCAGGACAGGG - Intronic
948892175 2:240912879-240912901 GATCCCAAGGGACCAAGTCTAGG + Intergenic
1170160803 20:13308295-13308317 GGTACCATGGGACCAAATGAGGG + Intergenic
1172030605 20:31979706-31979728 GGTATCACGGGACCAAGGCAGGG - Intronic
1172615658 20:36282058-36282080 GGGCCTATGGTACCAAGCCAGGG + Intergenic
1176000933 20:62830802-62830824 AGTCCCCTGGGACGCAGACAGGG + Intronic
1176039925 20:63060031-63060053 GGTCACATGGGGGCAAGAGATGG - Intergenic
1176295618 21:5070519-5070541 GGCCCCAAGGGACCCAGACAAGG - Intergenic
1177446207 21:21199476-21199498 AGGCCCAAGGGAGCAAGACATGG + Intronic
1179861431 21:44191605-44191627 GGCCCCAAGGGACCCAGACAAGG + Intergenic
1180009549 21:45040512-45040534 GGGGCCATGGGTCCAGGACAGGG - Intergenic
1182419295 22:30241179-30241201 GGTCCCATGGGGCCAAGTCCAGG + Exonic
1185299148 22:50070441-50070463 GGTCACATGGCACCAAGGGAGGG + Intronic
1185420126 22:50730533-50730555 GGTCCCAGGGGCCAAAGAAAAGG + Intergenic
949169928 3:985801-985823 GGGCCCATTGGACAATGACAGGG + Intergenic
950423163 3:12910521-12910543 CCTCCCCTGGGACCAAGGCAAGG + Intronic
954599347 3:51855915-51855937 GCTGCCATGGGACCTAGAAAGGG - Intergenic
958564042 3:95783697-95783719 GATGCCAAGGGACCAGGACAGGG - Intergenic
958601633 3:96302207-96302229 GCTGCCATGGGACCTAGAAAGGG - Intergenic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
963408837 3:144904534-144904556 GCTGCCATGGGACCTAGAAAGGG + Intergenic
969454215 4:7291944-7291966 GGTCTCACGGGGCCAAGGCAGGG + Intronic
969693781 4:8723709-8723731 GGTCCCATGGGTGTAAGCCATGG + Intergenic
969827372 4:9768124-9768146 GGACCAAGGGGACCAAGGCAAGG - Intergenic
971541922 4:27829062-27829084 GGTCCCATGGAAGAAAGAAAAGG + Intergenic
974184576 4:58430069-58430091 TGTCCTGTGGGCCCAAGACAGGG + Intergenic
974187885 4:58464618-58464640 GCTGCCATGGGACCTAGAAAGGG - Intergenic
974564889 4:63569110-63569132 GGGCCCATTGGACAATGACAGGG - Intergenic
974838358 4:67276106-67276128 GCTGCCATGGGACCTAGAAAGGG + Intergenic
975595325 4:76044158-76044180 GCTGCCATGGGACCTAGAAAGGG + Intronic
977031754 4:91892609-91892631 GGACCCATTGGACAATGACAAGG - Intergenic
977834413 4:101631850-101631872 GCTGCCATGGGACCTAGAAAGGG + Intronic
978457791 4:108914190-108914212 GGTTGCATGGAAACAAGACATGG + Intronic
982597669 4:157406244-157406266 GGGCCCATTGGACGATGACAGGG + Intergenic
983711346 4:170720554-170720576 AGTCCAAAGGGACTAAGACATGG + Intergenic
985469068 5:26506-26528 GGTCCCATGGAATTCAGACAAGG - Intergenic
987072940 5:14354854-14354876 GGTCCCATTGGACAGTGACAAGG + Intronic
989957803 5:50376322-50376344 GCTGCCATGGGACCTAGAAAGGG - Intergenic
992455716 5:76913929-76913951 GCTGCCATGGGACCTAGAAAGGG - Intronic
993203501 5:84848342-84848364 GGGCCCATTGGACAACGACAGGG - Intergenic
993351226 5:86853058-86853080 TGTGCCATGGGCCCAAGCCAGGG + Intergenic
995582955 5:113619809-113619831 GCTGCCATGGGACCTAGAAAGGG + Intergenic
996681067 5:126228627-126228649 GCTGCCATGGGACCTAGAAAGGG - Intergenic
997073153 5:130641494-130641516 GCTGCCATGGGACCTAGAAAGGG - Intergenic
998112195 5:139510941-139510963 GCTGCCATGGGACCTAGAAAGGG - Intergenic
1000085733 5:157886363-157886385 GCTGCCATGGGACCTAGAAAGGG - Intergenic
1000295437 5:159909323-159909345 GGCCCCAGGGGAGCAAGGCAAGG - Intergenic
1001669452 5:173461681-173461703 GATCCCATAGGACCAGGCCAAGG + Intergenic
1002280521 5:178127429-178127451 GGCCCCTTGGCACCAAGGCAAGG + Intergenic
1003038177 6:2662914-2662936 GGTTCCAATGTACCAAGACAAGG - Intergenic
1003806076 6:9727256-9727278 GCTGCCATGGGACCTAGAAAGGG - Intronic
1008676984 6:53829563-53829585 GGGCCCATGGTACCAGAACATGG + Intronic
1009407234 6:63327325-63327347 GCTGCCATGGGACCTAGAAAGGG + Intergenic
1013481686 6:110558394-110558416 GGTCCCAGAGGACCAAGTAAAGG + Intergenic
1013817585 6:114117262-114117284 GATCACATGGAGCCAAGACAGGG - Intronic
1018803185 6:167238913-167238935 GGCCCACTGGGACCAGGACAAGG - Intergenic
1019135010 6:169902511-169902533 GGTCCCAAGGCACCAAGACCGGG + Intergenic
1019515959 7:1440309-1440331 GGCCCCACGGGACCCACACATGG + Intronic
1019797474 7:3062463-3062485 GTTCCCGTGGCAACAAGACAAGG - Intergenic
1023091258 7:36619455-36619477 GGGACCATGGAACGAAGACAGGG + Intronic
1023820849 7:43979775-43979797 GCACCCAGGGAACCAAGACAAGG + Intergenic
1024109255 7:46128763-46128785 AGTCCCATGGGAGGATGACAAGG + Intergenic
1029702563 7:102257103-102257125 GGGCCCATGGGATCAAGGCAGGG - Exonic
1031732303 7:125314512-125314534 GCTGCCATGGGACCTAGAAAGGG - Intergenic
1033758734 7:144418769-144418791 GCTGCCATGGGACCTAGAAATGG + Intergenic
1035289721 7:157830108-157830130 CTTCCCATGGGACCAAGAGCAGG - Intronic
1036078090 8:5523241-5523263 GGTCCCAGGGGACCTTGACATGG - Intergenic
1039630643 8:39107912-39107934 GGACCAAAGGGACCCAGACAGGG - Intronic
1039998967 8:42560543-42560565 GCTGCCATGGGACCTAGAAAGGG + Intergenic
1044185346 8:89244006-89244028 GCTCCCATGGGACAAAGAATTGG - Intergenic
1044456127 8:92394406-92394428 GCTGCCATGGGACCTAGAAAGGG + Intergenic
1047790950 8:128203113-128203135 AGACCCATGGGACCGAAACAAGG + Intergenic
1049255349 8:141610747-141610769 GGTCCCATGGGCCAAAATCAAGG - Intergenic
1050265240 9:3882732-3882754 GGCCCCATGAGAACAAGAAAGGG + Intronic
1051183558 9:14436634-14436656 AAACCCATGGGACCAAAACATGG + Intergenic
1051349849 9:16188756-16188778 GTTCACATGGAACCAAAACAGGG - Intergenic
1051475505 9:17503712-17503734 GGTCCCATGAGATTAAGGCAAGG + Exonic
1053023269 9:34709986-34710008 GGACCCAAGGTACCAAGGCAGGG - Exonic
1053691085 9:40587921-40587943 GGTAGCACGGGGCCAAGACAGGG - Intergenic
1054273720 9:63049570-63049592 GGTAGCACGGGGCCAAGACAGGG + Intergenic
1054302344 9:63388892-63388914 GGTAGCACGGGGCCAAGACAGGG - Intergenic
1054401120 9:64715398-64715420 GGTAGCACGGGGCCAAGACAGGG - Intergenic
1054434725 9:65199712-65199734 GGTAGCACGGGGCCAAGACAGGG - Intergenic
1054495664 9:65821969-65821991 GGTAGCACGGGGCCAAGACAGGG + Intergenic
1056197239 9:84240526-84240548 GGTCCCTTGGGACCATCAAATGG + Intergenic
1056391934 9:86148753-86148775 GCTGCCATGGGACCTAGAAAGGG + Intergenic
1059747788 9:117219844-117219866 TTCCCCATGGGAACAAGACAAGG + Intronic
1060344802 9:122806702-122806724 AGTCCCCTGGTCCCAAGACAGGG + Intronic
1061806418 9:133139920-133139942 GGTCCCCTGAGGCCAAGCCAGGG + Intronic
1062579052 9:137221618-137221640 GGCCCCATGGCTCCAGGACAGGG + Intergenic
1185432067 X:17276-17298 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185441383 X:229990-230012 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1186383988 X:9090963-9090985 GGGCCCATTGGGCCATGACAGGG + Intronic
1186414722 X:9373285-9373307 GGTCTCATGGGAGCAAGTAAAGG + Intergenic
1186548556 X:10477683-10477705 GGCCCCATGTGTCCCAGACATGG - Intronic
1189302254 X:39960437-39960459 TGGCCCATGGGACCCAGCCAAGG - Intergenic
1198514280 X:137389127-137389149 AGTCCCATGGGACCATGCAATGG + Intergenic
1202114488 Y:21457663-21457685 GGTCCCTTGGGACCTAGGTAGGG - Intergenic
1202162397 Y:21948877-21948899 GGTCCCTTGGGACCTAAATAGGG + Intergenic
1202228959 Y:22637496-22637518 GGTCCCTTGGGACCTAAATAGGG - Intergenic
1202314195 Y:23558669-23558691 GGTCCCTTGGGACCTAAATAGGG + Intergenic
1202556607 Y:26111926-26111948 GGTCCCTTGGGACCTAAATAGGG - Intergenic