ID: 1104688570

View in Genome Browser
Species Human (GRCh38)
Location 12:130806988-130807010
Sequence AGGCCGCATCCAGCGCCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104688570_1104688575 26 Left 1104688570 12:130806988-130807010 CCAGCTGGCGCTGGATGCGGCCT 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1104688575 12:130807037-130807059 TGCCTCATTGTACTCCGCCATGG 0: 1
1: 0
2: 1
3: 8
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104688570 Original CRISPR AGGCCGCATCCAGCGCCAGC TGG (reversed) Exonic
900487575 1:2930702-2930724 TGCCCCCACCCAGCGCCAGCCGG + Intergenic
902359688 1:15935655-15935677 ACCCCGCAGCCAGCCCCAGCTGG + Exonic
905607716 1:39318220-39318242 AGGCAGCATCCAGGGCTAGCAGG + Intronic
907045160 1:51296204-51296226 AGCCCTCCTCCAGCCCCAGCCGG + Intronic
907320975 1:53602127-53602149 AGGCAGCAGCCAGGGCCAGTGGG - Intronic
914169984 1:145214983-145215005 AGGCCGGAAGCAGCCCCAGCCGG + Intergenic
914386282 1:147172679-147172701 ACGCAGCCTCCAGCGCCAGGAGG + Intergenic
914525101 1:148458946-148458968 AGGCCGGAAGCAGCCCCAGCCGG + Intergenic
914641302 1:149608188-149608210 AGGCCGGAAGCAGCCCCAGCCGG - Intergenic
920843629 1:209575654-209575676 GGGACACATCCAGCCCCAGCTGG - Intergenic
922767521 1:228163586-228163608 TGGCCACATCCAGGGCCTGCGGG + Intergenic
923462545 1:234219733-234219755 AGGCCACATCCAGGCTCAGCAGG - Intronic
1063214037 10:3907766-3907788 AGGCTGCAGCCAGCAGCAGCTGG - Intergenic
1069773914 10:70915956-70915978 AGGCCGCATTCAGGCTCAGCCGG + Intergenic
1069824112 10:71244867-71244889 AGACCGCCTCCAGCTCCCGCTGG + Intronic
1070915063 10:80148243-80148265 AGGCAGCATTCACCACCAGCTGG + Intergenic
1073426783 10:103459813-103459835 AGGTCAGATCCAGCTCCAGCCGG + Intergenic
1074224243 10:111468005-111468027 AGGTCCCATCCAGCTCCAGGGGG + Intergenic
1075634408 10:124020440-124020462 AGGCAGCATGCAGGGGCAGCAGG - Intronic
1075677708 10:124307723-124307745 CAGCCGCAGCCAGCACCAGCAGG + Intergenic
1076035692 10:127196755-127196777 AGGCGGCAGCCGGCGGCAGCCGG - Intronic
1076841909 10:133049991-133050013 AGGCCTCTCCCAGCGCCAACAGG - Intergenic
1077015440 11:397154-397176 AGGCCAGCTCCAGCTCCAGCCGG + Exonic
1077015555 11:397596-397618 AGGCCGCTCCCAGCACCTGCAGG - Exonic
1080517750 11:33039648-33039670 AGGCCGCATCCCTCGCCACGCGG - Exonic
1083714024 11:64565471-64565493 AGGACGCAGACAGCCCCAGCAGG + Intronic
1083737010 11:64687219-64687241 AGGGTGCATCCAGGGCCACCAGG + Intronic
1084325953 11:68400134-68400156 AGGCTACAGCCAGCCCCAGCCGG + Intronic
1084705388 11:70813377-70813399 AGGCTGCATCCAGGGTGAGCTGG - Intronic
1084778901 11:71396147-71396169 ATCCCGCACCCAGCCCCAGCAGG - Intergenic
1088893456 11:114061226-114061248 ACGCTGCAGCCAGCGCCAGCCGG + Intronic
1091808548 12:3375867-3375889 TGGGCGCATCCAGGGTCAGCTGG + Intergenic
1095650552 12:44603960-44603982 AGGCAGCATCCAACTCCAGCAGG + Intronic
1096365678 12:51026559-51026581 AGGCAGCATGCAGCTCCCGCCGG - Intronic
1098230415 12:68367359-68367381 AGGCTGCATCCAGGCTCAGCTGG - Intergenic
1098356612 12:69618281-69618303 AGGCAGCAGCCAGCACCAGTGGG - Intergenic
1103613551 12:122138378-122138400 AGGCAGCACCCACAGCCAGCAGG - Intronic
1104688570 12:130806988-130807010 AGGCCGCATCCAGCGCCAGCTGG - Exonic
1105964422 13:25371969-25371991 ACGCCGCAGCCCGGGCCAGCGGG + Intergenic
1110059356 13:71022070-71022092 CGGGTGCATCCAGCACCAGCTGG - Intergenic
1112424584 13:99286086-99286108 AGGCCAGATCCAGCGCCTCCAGG - Intronic
1119700789 14:76753120-76753142 AGGCAGCAGCCAGCTCCAGCTGG - Intergenic
1121664326 14:95660411-95660433 CAGCCCCATCCAGCCCCAGCTGG + Intergenic
1130078151 15:80707995-80708017 TGGCCGCAGCCAGAGGCAGCTGG - Intronic
1133237027 16:4392218-4392240 GGGCCTCACCCAGCCCCAGCTGG + Intronic
1133769639 16:8860253-8860275 AGGCTGCATCCAGCTCCATCAGG + Intronic
1139270810 16:65681043-65681065 AGGCAGCATCAAGATCCAGCAGG + Intergenic
1141563281 16:84884483-84884505 ATCCTGCATCCAGCGCCGGCTGG - Intronic
1142888495 17:2928262-2928284 CGGCCGCATGGAGAGCCAGCAGG - Intronic
1143451374 17:7038726-7038748 AGGCCACAGCCAGAGCCACCAGG - Exonic
1143837117 17:9701348-9701370 AGGCGTCATCCTGGGCCAGCTGG - Exonic
1145240981 17:21240983-21241005 AGGCCTCATCAAGCTCCCGCAGG - Exonic
1145711386 17:26982233-26982255 ATGCAGCATCCACCCCCAGCCGG + Intergenic
1148106871 17:45123660-45123682 AGGCCCCATCCCACACCAGCTGG - Intronic
1148127396 17:45243941-45243963 CAGCCGCATCCCGCGCCTGCCGG + Exonic
1148850458 17:50552020-50552042 AGGCCTCATACAGGTCCAGCAGG - Exonic
1151745020 17:76007333-76007355 AGGCCGCATCCCCATCCAGCAGG - Exonic
1154395811 18:13987583-13987605 AGGCCTCATAGAGGGCCAGCTGG - Intergenic
1156376969 18:36523462-36523484 AGGCCACATCCAGCATCAGCAGG + Intronic
1157331235 18:46705271-46705293 AAGCCCCTTCCAGCACCAGCTGG + Intronic
1157530927 18:48419777-48419799 AGGCCGCATGCAGGCACAGCAGG + Intergenic
1160419001 18:78731541-78731563 CCTCCGCATCCAGCGGCAGCCGG - Intergenic
1160735142 19:658952-658974 AGGCAGACCCCAGCGCCAGCCGG + Intronic
1160939735 19:1614670-1614692 AAGCAGCCGCCAGCGCCAGCGGG + Intronic
1160954248 19:1682848-1682870 AGGAGGCACCCAGCGCCTGCAGG - Intergenic
1161077833 19:2294884-2294906 TGGCCGCCTCCCCCGCCAGCCGG + Intronic
1161428543 19:4217572-4217594 AGGCCGCCTCCAGCTCCCGCAGG - Exonic
1161587265 19:5112449-5112471 GGGCACCATCCATCGCCAGCTGG - Intronic
1162069979 19:8147620-8147642 AGGAGGCATCCAGCCCCAACCGG + Intronic
1163687329 19:18719273-18719295 AGGCCGCATTCTGGGCTAGCGGG - Intronic
1164566751 19:29331216-29331238 AGACCCCCTCCAGCCCCAGCTGG + Intergenic
1165324878 19:35108790-35108812 AGGCCCCATCCAGCCCCTGCGGG - Intergenic
1166129944 19:40740132-40740154 AGGCCGCATCCAGTCCCATGGGG - Exonic
925145878 2:1583090-1583112 TGGCCTCATCCTGTGCCAGCAGG + Intergenic
925351165 2:3201477-3201499 AGCCCGCCTCCCGCACCAGCTGG - Intronic
925911237 2:8574881-8574903 AGGCAGCCTCCCCCGCCAGCGGG + Intergenic
926301910 2:11610937-11610959 AGTGCTCCTCCAGCGCCAGCCGG - Exonic
926798732 2:16640408-16640430 AGTCCCCAGCCAGGGCCAGCTGG - Intronic
929944035 2:46357001-46357023 AGGCACCATGCAGGGCCAGCAGG - Intronic
931728246 2:65130691-65130713 AGCCCCCAACCAGCGCCACCAGG - Intergenic
932446668 2:71785892-71785914 GGGCCGCCCCCAGCGCCTGCCGG + Intergenic
933750433 2:85599573-85599595 AGGCCACAGCCAGGTCCAGCGGG + Exonic
933759425 2:85663712-85663734 GGGCCGCATGCTGCCCCAGCTGG - Exonic
935265097 2:101387153-101387175 AGGCCGCCCCCCGCGCCACCCGG - Exonic
941812410 2:169768040-169768062 AAGCCACATCCAGTACCAGCAGG - Intronic
1173672983 20:44810649-44810671 AGGCCGCAGCCCGCGCCCTCCGG - Intergenic
1176448541 21:6841930-6841952 AGGCCACATCCAGCCCCTCCTGG - Intergenic
1176826711 21:13706952-13706974 AGGCCACATCCAGCCCCTCCTGG - Intergenic
1179821598 21:43940296-43940318 AGGCCAAAGCCACCGCCAGCAGG - Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183858399 22:40652144-40652166 AGGCAGCATCCAGCTCACGCAGG - Intergenic
1184787744 22:46680052-46680074 AGGCCGCGTCCCTCGCCACCTGG - Intergenic
1185340852 22:50290458-50290480 AGGCCTCATCCACAGCCAGGTGG + Exonic
954590543 3:51778236-51778258 TGGCTGCAGCCAGGGCCAGCTGG - Intergenic
954594504 3:51813655-51813677 TGGCTGCAGCCAGGGCCAGCTGG + Intergenic
956467744 3:69536003-69536025 AGGTCCCTTCCAGTGCCAGCGGG - Intronic
960311504 3:116121800-116121822 AGGCCACATGCAGCCCCAGATGG + Intronic
961624250 3:128248937-128248959 TGCCCTCATCCAGCACCAGCAGG + Intronic
963801004 3:149676113-149676135 AGGCGGAATCCAGCACCAGGGGG + Intronic
969613748 4:8240724-8240746 CGGCGGCTGCCAGCGCCAGCTGG - Exonic
972247146 4:37257108-37257130 AGGCCACAGCCAGCACCACCTGG + Intronic
973207731 4:47579099-47579121 AGGCTGCATTCAGATCCAGCAGG - Intronic
983820895 4:172192758-172192780 AGGTTGCAACCAGCGGCAGCAGG + Intronic
990744932 5:58950102-58950124 AGGCAGCAGCCAGCAGCAGCAGG - Intergenic
996567143 5:124892370-124892392 CGGCCTCATCCAGCCCCAGAGGG - Intergenic
996716795 5:126594906-126594928 CTACCGCATCCAGCGCCAGCGGG + Intronic
997508816 5:134439053-134439075 AGGCCACATCCACAGGCAGCGGG - Intergenic
1003347633 6:5285354-5285376 AGGCCTCATCCTCCGGCAGCTGG - Intronic
1006319703 6:33313319-33313341 AAGCCCCATCCAGGGCCCGCGGG + Exonic
1013173411 6:107657688-107657710 CCACCGCATCCAGCCCCAGCAGG - Intronic
1016099503 6:140080629-140080651 GGGCCTCAACCAGTGCCAGCTGG + Intergenic
1016451437 6:144187101-144187123 GATCCGCATCCAGCGCCAGCTGG + Exonic
1018908746 6:168089885-168089907 AGGGCACCACCAGCGCCAGCGGG - Intergenic
1019320982 7:415160-415182 AGGCCGCATCCCCCGTGAGCTGG - Intergenic
1020119604 7:5495654-5495676 AGGCCGCATCCTGGGGCGGCCGG - Intronic
1021464062 7:20921791-20921813 AGGCTGCAAGCAGCGCCTGCTGG - Intergenic
1024082005 7:45863888-45863910 AGGCCTGAGCCAGAGCCAGCAGG + Intergenic
1026847036 7:73704154-73704176 AGGCCGCATCCAGAGGCAGCTGG - Exonic
1034223273 7:149461194-149461216 TGGCCACTTCCAGCCCCAGCAGG - Intergenic
1034399678 7:150854112-150854134 AGGCGGAACCCAGAGCCAGCAGG - Intronic
1035215676 7:157364816-157364838 AGGCAGCCTTCAGTGCCAGCTGG + Intronic
1035245463 7:157559901-157559923 TGGCCTCATCCAGCTCCTGCTGG + Intronic
1035714971 8:1747045-1747067 AGGCCAGATCCAGGCCCAGCTGG + Intergenic
1037420425 8:18696010-18696032 AGGGCACATCCAGCGTCACCTGG + Intronic
1047024548 8:120811788-120811810 CGGCCGCCTCCCGCGCCAGCCGG + Exonic
1047415892 8:124664122-124664144 AGGCAGAAGCCAGCGCCTGCAGG + Intronic
1049265169 8:141664042-141664064 AGGCCACATCCAGCCCCAGCAGG - Intergenic
1049281850 8:141753450-141753472 AGGCCGAGTCCTGCCCCAGCAGG + Intergenic
1052465539 9:28824605-28824627 AGGCAGCATCCAGACTCAGCAGG + Intergenic
1059405410 9:114096042-114096064 AGGTCTCACCCAGGGCCAGCAGG + Exonic
1061095793 9:128456272-128456294 AGGCGGGATCCAGCGCCCTCCGG + Intronic
1061512322 9:131068823-131068845 AGGCCCCAGCCAGCTGCAGCCGG + Intronic
1061566437 9:131443893-131443915 AGGCCACAGCCTGCCCCAGCAGG - Intronic
1061874271 9:133536095-133536117 AGTCAGCATCCAGCAACAGCCGG - Intronic
1203520650 Un_GL000213v1:42588-42610 AGGCCACATCCAGCCCCTCCTGG + Intergenic
1186430314 X:9499311-9499333 AGGTCGCATCAAGGGCGAGCTGG - Intronic
1187519366 X:20000267-20000289 AGAACCCATCCAGAGCCAGCTGG - Intergenic
1188536428 X:31201749-31201771 AGGCTGTATTCAGGGCCAGCTGG - Intronic