ID: 1104691262

View in Genome Browser
Species Human (GRCh38)
Location 12:130828094-130828116
Sequence TAGGGTCTTCTGATGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104691262_1104691269 25 Left 1104691262 12:130828094-130828116 CCCATCTCCATCAGAAGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1104691269 12:130828142-130828164 ATAAGGTAACACTACTTTCATGG 0: 1
1: 0
2: 0
3: 11
4: 133
1104691262_1104691268 8 Left 1104691262 12:130828094-130828116 CCCATCTCCATCAGAAGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1104691268 12:130828125-130828147 ATATTTATCAGTGTTTTATAAGG 0: 1
1: 0
2: 2
3: 53
4: 535
1104691262_1104691270 26 Left 1104691262 12:130828094-130828116 CCCATCTCCATCAGAAGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1104691270 12:130828143-130828165 TAAGGTAACACTACTTTCATGGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104691262 Original CRISPR TAGGGTCTTCTGATGGAGAT GGG (reversed) Intronic
900040722 1:461473-461495 TAAGTTTTTCTGATAGAGATGGG - Intergenic
900062152 1:696444-696466 TAAGTTTTTCTGATAGAGATGGG - Intergenic
902179283 1:14675633-14675655 TAAGTTCTAATGATGGAGATGGG - Intronic
903892054 1:26576312-26576334 TAGGGTGGTGGGATGGAGATTGG + Intergenic
904893595 1:33797725-33797747 TAGTGTCTTCTGCTGGAGGAAGG + Intronic
905392863 1:37649120-37649142 TAGGGTCTTCAGCTGGGCATTGG - Intergenic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
908420635 1:63955352-63955374 TAAGGTTATCTGAGGGAGATGGG - Intronic
908903046 1:68978238-68978260 TAGGTTATTCTGATGCACATGGG + Intergenic
909976730 1:82054202-82054224 TAGGTTCTTCAGGTGGAAATTGG + Intergenic
915619225 1:157069506-157069528 TAGGATTATCTGGTGGAGATGGG + Intergenic
915973987 1:160372930-160372952 TAGGCTCTTCTGATGGGGTCAGG + Intergenic
918025396 1:180739881-180739903 TAGGCGCTTTTGATGGAGATGGG + Intronic
918590007 1:186230558-186230580 AAGGTTCTTATGAGGGAGATGGG + Intergenic
920227177 1:204447275-204447297 TAGTGTCAGCTGATGGAGAAAGG + Intronic
1066935140 10:41820268-41820290 TAGTGTCTGCAGATGGATATTGG - Intergenic
1068506804 10:57910833-57910855 TTGTGGCTTCTGGTGGAGATTGG - Intergenic
1071056723 10:81520102-81520124 GAGGCTCTTCTGATACAGATGGG + Intergenic
1072121962 10:92412532-92412554 GGGGTTCTTCTGATGGACATTGG + Intergenic
1075916228 10:126169907-126169929 CAGAGTCTTCTGATGTAGATTGG + Intronic
1076966995 11:97699-97721 TAAGTTTTTCTGATAGAGATGGG - Intergenic
1078731050 11:13974352-13974374 CAGGGTCTTCTCATTGAGGTTGG + Intronic
1080638129 11:34141086-34141108 TAGGCTCTTCTCTTGGGGATTGG + Exonic
1080834104 11:35923943-35923965 AAGGGACTTAAGATGGAGATAGG + Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1086323519 11:85674891-85674913 TTGGGTATTCTGAAGGAGAGAGG - Intronic
1087223993 11:95577614-95577636 GATGGTCTTCTGAAGGAGGTTGG - Intergenic
1090016624 11:123091992-123092014 TAGTGTCTTCTGATAGATCTCGG + Intronic
1093894875 12:24563683-24563705 GAGTTTCTTCTGATGGGGATGGG - Intergenic
1094788745 12:33883710-33883732 TAGGGTCTATTGATGGAGGGAGG + Intergenic
1097637144 12:62136992-62137014 TAGAGACTTCTGCTGGGGATGGG - Intronic
1103393177 12:120588964-120588986 AAGGGGCTTCTGCTGGAGATGGG - Intergenic
1104691262 12:130828094-130828116 TAGGGTCTTCTGATGGAGATGGG - Intronic
1104751911 12:131245344-131245366 GAGGGTCCTGTGATGGACATGGG - Intergenic
1104779981 12:131413731-131413753 GAGGGTCCTGTGATGGACATGGG + Intergenic
1108064428 13:46563085-46563107 TAGTGAATTCTGAGGGAGATGGG + Intronic
1115259047 14:31434557-31434579 GAGGGACTTATGAAGGAGATAGG - Intronic
1117478828 14:56122668-56122690 TAGGGTCCACAGATGGAGTTCGG + Intronic
1120713402 14:87816089-87816111 TAGGGCCTTCAGAAGGAGCTTGG - Intergenic
1122801583 14:104232971-104232993 TGGGGTCTGCTGATGGGGAGGGG + Intergenic
1128736687 15:70057619-70057641 TAGGAGCTGGTGATGGAGATGGG + Exonic
1134467042 16:14488407-14488429 AAGTGTCTTCTGATGGACAAAGG - Intronic
1135405844 16:22197198-22197220 AAGGATCTTCTGATGGGGAGAGG + Intergenic
1136709287 16:32222024-32222046 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136758623 16:32707395-32707417 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1136809485 16:33162984-33163006 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136815961 16:33273064-33273086 TAGGGTCTTCAGAGGGAGTATGG - Intronic
1138197103 16:55059783-55059805 TAGGGTCTTGGGATTAAGATGGG - Intergenic
1139205010 16:65020159-65020181 TAAGGCCTACTGATGGACATAGG - Intronic
1139574866 16:67834665-67834687 TGGTCTCTTCTGATAGAGATAGG - Intronic
1141202571 16:81909171-81909193 TAGCGTCTTTTGAAGGAGATGGG + Intronic
1141932029 16:87211948-87211970 TTGGGTCTTCTGCAGGGGATAGG - Intronic
1203060777 16_KI270728v1_random:967723-967745 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1143408616 17:6695202-6695224 TAGGGTCTTATTGTGGAGCTTGG + Intronic
1143577365 17:7802057-7802079 TGGTGTCTTCTGAGGGCGATGGG + Intronic
1145050933 17:19659938-19659960 TAGGGTCTTGACATGGAAATTGG + Intronic
1145866553 17:28245618-28245640 TGGGGGCTTCTGGTGGGGATGGG + Intergenic
1146704814 17:34993363-34993385 TAGGGTTTTATGTTTGAGATAGG + Intronic
1151033039 17:70763912-70763934 TAGGGTCTTTTGATGGTGAGGGG + Intergenic
1156843872 18:41640224-41640246 GTGGTTCTTCTGATGGAAATGGG + Intergenic
1159917845 18:74202115-74202137 TAGAGTCTTCAGAGGGAGAATGG + Intergenic
1160643798 19:167322-167344 TAAGTTTTTCTGATAGAGATGGG - Intergenic
1166209564 19:41297492-41297514 TGGGGTCCTCTGTTGGAGGTGGG + Intronic
930097232 2:47574386-47574408 TAGTGTCTGCTAATGGGGATGGG + Intergenic
930313070 2:49766316-49766338 TGGGGTCTTATGAGGGAGGTGGG + Intergenic
930884040 2:56303861-56303883 GAGTGTCTCCTAATGGAGATTGG + Intronic
936442934 2:112571343-112571365 TAGGGTCCTCTGAAGAGGATTGG + Intronic
941314045 2:163970084-163970106 TAGAGCCTTCTGATGAAGAGTGG - Intergenic
945663113 2:212710297-212710319 TAAGGTCTACTGATGCAAATGGG + Intergenic
947993696 2:234508903-234508925 TGTGGTCTCCTGATGGTGATGGG + Intergenic
948808167 2:240461838-240461860 GAGGGGCTGCTGGTGGAGATGGG - Intronic
1169906421 20:10609250-10609272 GTGGGTGTTCTGATGAAGATGGG - Intronic
1171958706 20:31478062-31478084 AAGGGTCTTCTGTTTGGGATTGG - Intronic
1172558382 20:35863798-35863820 TATGGGCTTCTGAAGGAGATGGG + Intronic
1173133819 20:40421552-40421574 TATATTCTTCTCATGGAGATGGG - Intergenic
1174534038 20:51237125-51237147 TAGGATCTTCTGGAGGAGCTGGG + Intergenic
1175352795 20:58337393-58337415 GAGGATCTTGTGATGGAGAGAGG - Intronic
1177827611 21:26101789-26101811 GAGGGTCTTATTCTGGAGATAGG - Intronic
1179075275 21:38114680-38114702 TGGGGTTTTCTGAGGGTGATTGG - Intronic
1179971639 21:44839101-44839123 CAGGCTCTCCTGCTGGAGATGGG - Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1182526658 22:30924647-30924669 TAGGGTGTTTTGTTTGAGATGGG - Intergenic
1182535022 22:30994601-30994623 TCAGGTCTTCAGATGCAGATTGG - Intergenic
1183335757 22:37244920-37244942 TGGGGTCCGCTGATGGAGAAGGG + Intergenic
952039216 3:29241349-29241371 TAGAATCTTCTGCTGGAGTTTGG + Intergenic
952576980 3:34787108-34787130 TAGTGTCTTCAGATGATGATTGG - Intergenic
958632307 3:96699988-96700010 TAGGGTTTTCTGCTGGCGTTGGG - Intergenic
960794049 3:121465794-121465816 TAGGGAGTTCTGAGAGAGATGGG - Intronic
962257539 3:133882809-133882831 TATCCTCTTCTGATGAAGATGGG + Intronic
963973249 3:151452800-151452822 ATGGTTATTCTGATGGAGATGGG + Intronic
965044418 3:163557352-163557374 TAGTGTCTTCAGATGGAGCATGG - Intergenic
967405118 3:189106809-189106831 TAGGTTCATCAGATGGAAATTGG - Intronic
968052663 3:195666108-195666130 TTGGATCTCCTGATGGAGAATGG + Intergenic
968103148 3:195982246-195982268 TTGGATCTCCTGATGGAGAATGG - Intergenic
969189294 4:5504014-5504036 TAGGGTCTTCGGGAGGTGATTGG + Intergenic
970608533 4:17704771-17704793 CAGGGTCTTTTGGAGGAGATGGG - Intronic
972992600 4:44840391-44840413 TAGGGTCTGTTGATGGAGACAGG - Intergenic
974016068 4:56650325-56650347 TGGGATGTGCTGATGGAGATGGG + Intronic
978566371 4:110086559-110086581 TAGGAACTTCTGAGGGAGAGTGG - Intronic
979217508 4:118183129-118183151 TAGTGTCGTCTGGTGGAGAATGG - Intronic
981076710 4:140599687-140599709 GTGGGTCTTCTGATGCAGATGGG + Intergenic
981258806 4:142694975-142694997 TAGGGTCTTGTGGTGGGGGTAGG + Intronic
985498913 5:228227-228249 TTGGATCTCCTGATGGAGAATGG + Exonic
987421162 5:17721460-17721482 TAGGTTCTTTTGAAGCAGATCGG - Intergenic
991568601 5:68030864-68030886 TAGGGAATTCTGATGGAAAGAGG - Intergenic
994605833 5:101965019-101965041 TTGTGTCTTCTCATGGAGAATGG - Intergenic
995835808 5:116398366-116398388 TAGGGGCTTCTGAGGGAGGGAGG - Intronic
1000409368 5:160921985-160922007 TTGTGTCCTCTGATAGAGATGGG + Intergenic
1002733124 5:181357459-181357481 TAAGTTTTTCTGATAGAGATGGG + Intergenic
1002751415 6:116646-116668 TAAGTTTTTCTGATAGAGATGGG - Intergenic
1007558723 6:42787849-42787871 TAGTGGCTTCAGAGGGAGATGGG + Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1011151187 6:84275247-84275269 TAAGGTCTAGTGATGGAGACAGG + Intergenic
1011512355 6:88115009-88115031 TAGGGTCTTTTGTTGCTGATTGG + Intergenic
1013072770 6:106743874-106743896 GAGGGACTTCTGATCGAGTTAGG + Intergenic
1013209384 6:107973219-107973241 TAGGTTCATCTATTGGAGATGGG - Intergenic
1014079967 6:117274844-117274866 TAGTGTCATTTGATGGAGTTTGG - Intergenic
1014712545 6:124824056-124824078 TATGGTCTTCTGATGGGGTTGGG + Exonic
1014926870 6:127282468-127282490 TAAGGTCTCCAGGTGGAGATAGG - Intronic
1015302495 6:131669735-131669757 TAGGATTCTCTGATGGGGATTGG - Intronic
1016879643 6:148898329-148898351 TTTGGTATTCTGTTGGAGATGGG + Intronic
1018294841 6:162334720-162334742 TTGAGTCTTCTTATGGAGCTTGG + Intronic
1019237374 6:170629781-170629803 TAAGTTTTTCTGATAGAGATGGG + Intergenic
1023701645 7:42897697-42897719 AGTGGTATTCTGATGGAGATTGG - Intergenic
1029328473 7:99830679-99830701 TAGTATCTTCTGATGGGGAGTGG - Intronic
1029376738 7:100181974-100181996 TATGTTTTTCTCATGGAGATGGG + Intronic
1029716197 7:102328088-102328110 TATGTTTTTCTCATGGAGATGGG - Intergenic
1029722832 7:102381292-102381314 TATGTTTTTCTCATGGAGATGGG - Intronic
1031081065 7:117257334-117257356 TAGGGCATTCTGAGGGGGATAGG + Intergenic
1031864660 7:127025230-127025252 CAGGGTCTTTTGATAGAGAGTGG + Intronic
1032293198 7:130609050-130609072 TATTTTCTTCTGATAGAGATGGG + Intronic
1034478434 7:151302217-151302239 CGGAGTCTTCTGATGGAGATGGG + Intergenic
1035510393 8:176831-176853 TAAGTTTTTCTGATAGAGATGGG - Intergenic
1039652778 8:39360269-39360291 TAGTGTCTTCTGATGGGTGTGGG + Intergenic
1043012529 8:74899234-74899256 AAGGGTATTCTGATGGAAATAGG - Intergenic
1045422637 8:102031421-102031443 AAGGGGGTTATGATGGAGATAGG + Intronic
1047002454 8:120586604-120586626 TAGGATCTTGAGATGGAGAGAGG - Intronic
1047908137 8:129494821-129494843 TAGGATCTTGAGATGGAGAGAGG - Intergenic
1048700519 8:137083463-137083485 TAGGATCTTGTGATGGGGGTAGG + Intergenic
1050104391 9:2150422-2150444 TAGTCTCACCTGATGGAGATGGG - Intronic
1051933555 9:22415718-22415740 TAGGGTCATGTGATAGAGATTGG + Intergenic
1052613970 9:30813821-30813843 TTGGGTCTTTTGTTGGTGATTGG + Intergenic
1058242305 9:102580165-102580187 TAGTTTCTTCTGGTGGAGAGTGG - Intergenic
1058729986 9:107840519-107840541 TAAGGGCTTCTGAAGAAGATGGG + Intergenic
1060302168 9:122381203-122381225 TAGGGTCTTTTGGTAGAGAGTGG + Intronic
1062757529 9:138309783-138309805 TAAGTTTTTCTGATAGAGATGGG + Intergenic
1185853699 X:3512571-3512593 CAGGGTCTTTTGATGTACATTGG - Intergenic
1189385988 X:40537327-40537349 TGGGGGCATCTGATAGAGATCGG + Intergenic
1189919954 X:45893809-45893831 TATGGTCTTATCATGGAGACAGG + Intergenic
1192198592 X:69048886-69048908 GAGGTTCTTCTGAGGGAGACAGG - Intergenic
1193176617 X:78401805-78401827 TTGGGTTTCCTGAAGGAGATGGG + Intergenic
1199004307 X:142676852-142676874 TAGGGTCTTTTGAAGCACATGGG + Intergenic
1199464079 X:148116353-148116375 TGGGGTCTTCTCATGGGGGTGGG - Intergenic
1199900515 X:152167817-152167839 TAGAGTCATCTGATCTAGATGGG + Exonic
1200096165 X:153664078-153664100 TAGTGTCTTTTGATGCACATGGG - Intergenic
1200809747 Y:7471950-7471972 CAGGGTCTTTTGATGTACATTGG + Intergenic