ID: 1104691905

View in Genome Browser
Species Human (GRCh38)
Location 12:130832874-130832896
Sequence CTGTGGACAGGGCTGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1250
Summary {0: 1, 1: 1, 2: 18, 3: 151, 4: 1079}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104691905_1104691920 29 Left 1104691905 12:130832874-130832896 CCCTCCCCCAGCCCTGTCCACAG 0: 1
1: 1
2: 18
3: 151
4: 1079
Right 1104691920 12:130832926-130832948 GGGTGGCCCCCTGACCCACCCGG 0: 1
1: 0
2: 0
3: 17
4: 243
1104691905_1104691916 8 Left 1104691905 12:130832874-130832896 CCCTCCCCCAGCCCTGTCCACAG 0: 1
1: 1
2: 18
3: 151
4: 1079
Right 1104691916 12:130832905-130832927 TTATCCACAGCTCAGCTCACGGG 0: 1
1: 0
2: 1
3: 18
4: 162
1104691905_1104691919 12 Left 1104691905 12:130832874-130832896 CCCTCCCCCAGCCCTGTCCACAG 0: 1
1: 1
2: 18
3: 151
4: 1079
Right 1104691919 12:130832909-130832931 CCACAGCTCAGCTCACGGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 164
1104691905_1104691917 9 Left 1104691905 12:130832874-130832896 CCCTCCCCCAGCCCTGTCCACAG 0: 1
1: 1
2: 18
3: 151
4: 1079
Right 1104691917 12:130832906-130832928 TATCCACAGCTCAGCTCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1104691905_1104691915 7 Left 1104691905 12:130832874-130832896 CCCTCCCCCAGCCCTGTCCACAG 0: 1
1: 1
2: 18
3: 151
4: 1079
Right 1104691915 12:130832904-130832926 CTTATCCACAGCTCAGCTCACGG 0: 1
1: 2
2: 1
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104691905 Original CRISPR CTGTGGACAGGGCTGGGGGA GGG (reversed) Intronic
900151605 1:1181389-1181411 CAGTGGGCAGGGCTGGGAGCAGG - Intronic
900155599 1:1202280-1202302 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155614 1:1202318-1202340 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155648 1:1202413-1202435 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155675 1:1202489-1202511 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155710 1:1202584-1202606 CTGGGTACTGGGCTCGGGGATGG - Intergenic
900155723 1:1202622-1202644 CTGGGTACTGGGCTCGGGGATGG - Intergenic
900155736 1:1202660-1202682 CTGGGTACTGGGCTCGGGGATGG - Intergenic
900155767 1:1202755-1202777 CTGGGTACTGGGCTCGGGGATGG - Intergenic
900155780 1:1202793-1202815 CTGGGTACTGGGCTTGGGGATGG - Intergenic
900204866 1:1427481-1427503 CTGGGGGCAGGGCAGGGTGATGG - Intronic
900225031 1:1528983-1529005 CTGTGGGCAGGGCTGGTGTGAGG + Intronic
900402393 1:2477916-2477938 CTGTGGCCAGGGGCGGGGGCAGG + Intronic
900415592 1:2533045-2533067 CTGCGGAGGGGGCTGGAGGAGGG + Intergenic
900425193 1:2575123-2575145 ATGTGGCCAGGGCTGGGGAGGGG + Intergenic
900584658 1:3426836-3426858 CTGGGGACAGGGCTGTGGTCTGG + Intronic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900626633 1:3611548-3611570 CTGGGGTCCGGGCTGGGGGCGGG - Intergenic
900743803 1:4346508-4346530 GGGTGGACAGGGCTGAGGAAGGG + Intergenic
900931120 1:5738469-5738491 CTATGGAGAAGGGTGGGGGAGGG - Intergenic
901025324 1:6276080-6276102 GTGTAGACAGGGCGGGGTGAGGG - Intronic
901127247 1:6938334-6938356 CTGGGGTCAGGGCTGGGGTGGGG + Intronic
901464568 1:9413111-9413133 GTGAGGACAGGGCTGCGGGGGGG - Intergenic
901673792 1:10871107-10871129 CTGGGGAAATGGCTGGGGGCGGG + Intergenic
901689787 1:10965256-10965278 CTGTGGTCTGGAGTGGGGGAAGG - Intronic
901786698 1:11629577-11629599 CTGCGCACTGGGCTGGGGGCTGG - Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902224503 1:14988233-14988255 GTGCAGACAGGGCTGGGGTAGGG - Intronic
902374990 1:16026419-16026441 CTGAGGACAGCCCTGGGGGTTGG + Intronic
902525269 1:17053444-17053466 TTGGGGACAGGGCAGGGGAAGGG - Intronic
902608567 1:17583247-17583269 CCCTGGACATGGCTGGGGGCAGG + Intronic
902865253 1:19273731-19273753 GTGTGGACAGGGATGGGGTGGGG + Intergenic
903181769 1:21608493-21608515 CTGTGGAGTGGCCTGGGGGAAGG - Intronic
903219301 1:21860080-21860102 CTGGGGACAGGGCTGAGGGTGGG - Intronic
903325028 1:22564424-22564446 GGGAGGAGAGGGCTGGGGGATGG + Intronic
903494626 1:23757271-23757293 CTATGGACAAAGCAGGGGGAAGG - Intronic
903654686 1:24942105-24942127 CTGAGGACACGGATGGGGGCAGG - Intronic
903685714 1:25130554-25130576 TTGTGGTCAGGGCTCGGGGAGGG + Intergenic
903739730 1:25551814-25551836 CTGGGGCCAGGGCTGGGGATGGG + Intronic
903816379 1:26067183-26067205 CTCTGGACAGGGCTGAGAGGGGG - Intronic
903827510 1:26156536-26156558 CTCTGGTGGGGGCTGGGGGAGGG - Intergenic
904013876 1:27405914-27405936 TCGTGGAAAGGGCTGGGGGCAGG - Exonic
904036820 1:27563545-27563567 CTGGTGACAGTGATGGGGGAGGG - Intronic
904354556 1:29930672-29930694 TTGAGGACAGAGCTGGGGGTGGG - Intergenic
904355269 1:29934501-29934523 CTGTGGGCAGGGCTGGGAGGAGG + Intergenic
904453511 1:30632262-30632284 CTGTGGGGAGGGCAGGGCGAGGG + Intergenic
904491009 1:30859038-30859060 CCATGGACAGTGCTGGGAGAGGG + Intergenic
904613616 1:31738373-31738395 CAGTGGCCAGGACTGGGGGCAGG - Intronic
904867789 1:33595473-33595495 GTGTGGAGTGGGGTGGGGGAAGG + Intronic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
905307128 1:37027552-37027574 CTGTGCACAGGGCTGGGTGTAGG - Intronic
905699154 1:39999064-39999086 CCGTGGAAAGGGGAGGGGGAGGG - Intergenic
906211857 1:44016604-44016626 CAGTGGCAAGGGGTGGGGGAAGG - Intronic
906265280 1:44424308-44424330 ATGGGGACAGGGATGGGGGTGGG + Intronic
906376326 1:45299629-45299651 CTGTGATCAGGGCTTGGGGAAGG - Intronic
906484209 1:46221976-46221998 CTGGGGACAGGGTGGGGGAAGGG - Intergenic
906501294 1:46343138-46343160 CAGTGGGCAGGGATGGGGGGTGG - Intronic
906527010 1:46499701-46499723 CTGTGATCTGGGCTGGGGGCGGG + Intergenic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907848153 1:58228545-58228567 GTGTGGATATGGCAGGGGGAGGG + Intronic
908237870 1:62164789-62164811 CTGTGAACAGGGGTTGGGGAAGG - Intergenic
908440946 1:64153728-64153750 TGGTTGTCAGGGCTGGGGGAAGG + Intronic
909902963 1:81160868-81160890 ATGTGGCCACTGCTGGGGGATGG - Intergenic
910222171 1:84898606-84898628 CCATGGACAGGGGTGGGGGATGG + Intergenic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
911696524 1:100895845-100895867 CTGCAGACTGGGCTGGGAGATGG - Exonic
912037094 1:105331667-105331689 TTGTGGCCAGGGTTGGGGGGTGG + Intergenic
912490026 1:110057669-110057691 CTGTGGAGGAGGCTGGGGCAGGG + Intronic
912538128 1:110391198-110391220 CTATGCTCAGGGCAGGGGGATGG + Intergenic
912754409 1:112312539-112312561 CTGTGGCCGGGGCTGAGGGGAGG - Intergenic
913094167 1:115500607-115500629 TTGTTGTCAGGGCTGGGGGAAGG + Intergenic
913156339 1:116103277-116103299 CTGTAGACATGGCTGGCTGAAGG + Intergenic
913196715 1:116462856-116462878 CTGTGGCCAGGGATGGGTCATGG - Intergenic
913223629 1:116679535-116679557 CTGAGGACAGCTGTGGGGGAAGG + Intergenic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
913544367 1:119852999-119853021 TTGGGGTGAGGGCTGGGGGAGGG + Intergenic
913602425 1:120434498-120434520 ATGGGGTGAGGGCTGGGGGAGGG - Intergenic
914084623 1:144442010-144442032 ATGGGGTGAGGGCTGGGGGAGGG + Intronic
914190634 1:145407277-145407299 ATGGGGTGAGGGCTGGGGGAGGG + Intergenic
914363596 1:146958128-146958150 ATGGGGTGAGGGCTGGGGGAGGG - Intronic
914429159 1:147604240-147604262 CTGTGGATAGACCTGGGGGACGG - Intronic
914488079 1:148128998-148129020 ATGGGGTGAGGGCTGGGGGAGGG + Intronic
914588441 1:149084151-149084173 ATGGGGTGAGGGCTGGGGGAGGG + Intronic
915109592 1:153554556-153554578 CTTTGGAGATGGCTGTGGGAAGG + Intergenic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915355613 1:155253922-155253944 CTCTGGACAGGGCCGGAGGAGGG + Exonic
915518601 1:156428521-156428543 GTGTGAAGAGGGCTGGGGTAGGG + Intronic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
915966031 1:160308997-160309019 ATGTGGCCATGGCTTGGGGATGG + Intronic
917706772 1:177642587-177642609 TTGTGGACAGAGCTGGTGTAAGG + Intergenic
917836812 1:178947533-178947555 CTGTGGACAGGGGGTGGGGGGGG + Intergenic
917919956 1:179743233-179743255 AGGTGGCCAGGGCTGGGGGCAGG - Exonic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918104424 1:181404181-181404203 CGGTGCACAAGGTTGGGGGATGG + Intergenic
918136740 1:181680672-181680694 CTGAGGACAGGGATGGGGTGTGG - Intronic
919686295 1:200486733-200486755 CTGTGGGGAGGGCCGGTGGAGGG - Intergenic
920191173 1:204194876-204194898 CTAGTGACAAGGCTGGGGGAAGG + Intronic
920366323 1:205450080-205450102 CCGTCCTCAGGGCTGGGGGAGGG - Intronic
920399801 1:205669751-205669773 CTGTGGGGAGGGCTGCGGGGTGG - Intronic
920415516 1:205796879-205796901 CAGAGGGCAGGGCTGGGGGAAGG - Intronic
920438194 1:205961669-205961691 CTGGGCCCAGAGCTGGGGGATGG + Intergenic
920446579 1:206022868-206022890 CTGGGGTCAGGGCTGGGGAGAGG - Intronic
920673842 1:208025285-208025307 CCCAGGAGAGGGCTGGGGGAGGG - Exonic
921034083 1:211359720-211359742 CTGAGGAGAGGGCATGGGGAGGG - Intronic
921498890 1:215875987-215876009 CTATGGAGGGGGCGGGGGGAAGG + Intronic
921986184 1:221315521-221315543 CTGTGTCCATAGCTGGGGGAAGG + Intergenic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
922471594 1:225880427-225880449 CTGAGGAGAAGGCAGGGGGAGGG + Intronic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
922894375 1:229088905-229088927 CTGAGGACAGGGGTGGGGCTGGG + Intergenic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923148971 1:231217350-231217372 CTCTGGACAGGGCTCTGGGATGG - Intronic
923203820 1:231738971-231738993 CTGAGGCCAGGGCTGAGGCAGGG - Intronic
923291165 1:232547557-232547579 CTGTGGCCCGGGGTGGGGGCTGG + Intronic
923337495 1:232983135-232983157 TTGAGGAGAGGGTTGGGGGAAGG - Exonic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
923997884 1:239517115-239517137 CTATGGACCGGGCAGGAGGATGG - Intronic
924244486 1:242070411-242070433 CCATGGACTGGGCAGGGGGATGG + Intergenic
924392765 1:243581061-243581083 CTCTGCACAGGGATAGGGGATGG - Intronic
924501648 1:244643925-244643947 CCATGGACAGGGCATGGGGAAGG - Intergenic
924557187 1:245128491-245128513 CTGGGGACAGGGCTGGAGATGGG + Intergenic
924736488 1:246761564-246761586 CGGTTGCCGGGGCTGGGGGAGGG - Intronic
924821753 1:247498744-247498766 CCATGGACTGGGCAGGGGGACGG + Intergenic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1062830771 10:604018-604040 CTGAGGGCAGGGCTGGGGGGTGG - Intronic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1063663279 10:8048189-8048211 CTGAGGCCAGCGCTGGGGGTTGG + Intergenic
1063809727 10:9691287-9691309 CCCTGCACAGGGCTGGAGGAGGG - Intergenic
1064104316 10:12488513-12488535 CCGTGGACTGGGATGGGGGATGG + Intronic
1064541083 10:16405923-16405945 CTGTTCCCAGGGCAGGGGGAGGG + Intergenic
1065310980 10:24415796-24415818 CTCTGGCCAGGGCTGAGAGAAGG + Intronic
1065815641 10:29480248-29480270 CTGGGGACAGGGGCAGGGGAGGG + Intronic
1065923192 10:30411475-30411497 CTGCAGTCAGGGCTGGGGGAAGG - Intergenic
1065957290 10:30704956-30704978 CTGGGGACAGGGGCAGGGGAGGG - Intergenic
1066497181 10:35953933-35953955 GAGTGGACATGGCTTGGGGAAGG + Intergenic
1066624811 10:37395756-37395778 GAGTGGACAAGGCTTGGGGAAGG + Intergenic
1067068614 10:43117225-43117247 CTGTTCACAGGGCTGGGGCCTGG - Intronic
1067178623 10:43968534-43968556 CTGTGGACAGGATTGAGGGGCGG + Intergenic
1067413325 10:46084357-46084379 CTGTGGCCAGGGGAGAGGGAGGG + Intergenic
1067469074 10:46523306-46523328 CTGTTCACAGGGGTGGGGGTGGG - Intergenic
1067473871 10:46553918-46553940 CTGTGGACTGGGCCAGAGGAGGG + Intronic
1067509254 10:46881740-46881762 CTCTGGGCAGGGCTGGGGGGAGG + Intergenic
1067652998 10:48170115-48170137 CTCTGGGCAGGGCTGGGGGGAGG - Intronic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1067713705 10:48671249-48671271 CTGAGGGCAGGGCAGGGGCAGGG + Intergenic
1068078163 10:52284485-52284507 CGGTGGCCAGGGGTGGGGGTGGG + Intronic
1068748165 10:60559259-60559281 CTGGGGAAAGGGTTGGGGGGTGG - Intronic
1068976569 10:63016491-63016513 CTGTGGCCAGGACTGGGGCATGG - Intergenic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1069620176 10:69832626-69832648 CTGTGGACAGGGCAGGGGAAGGG + Intronic
1069912402 10:71767541-71767563 CTGTGGACCATCCTGGGGGATGG - Intronic
1069930899 10:71880928-71880950 CTGCGGTCAGGGGTGGGGGGGGG + Intergenic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070248167 10:74751058-74751080 ATGTGGAGAGGGCTGAGGGTGGG - Intergenic
1070778340 10:79123261-79123283 CTGTGGACCGGGCTGAGGCATGG + Intronic
1070779570 10:79129772-79129794 CTCAGGCCAGGGCTGGGGGCAGG - Intronic
1070833046 10:79432037-79432059 CCCAGGATAGGGCTGGGGGAAGG - Intronic
1071299758 10:84247751-84247773 CTGTGGACTGGGGAGGGGGCTGG - Intronic
1071514393 10:86287583-86287605 TTGTGGTCAGGGCTGGGGCTAGG - Intronic
1071519220 10:86318634-86318656 CTGAGGACATGGCAGGGTGAGGG + Intronic
1072254981 10:93612921-93612943 CTGTGGACCGTGCAGGAGGAGGG + Exonic
1072560355 10:96567574-96567596 TGGAGGAAAGGGCTGGGGGATGG - Intronic
1072606702 10:96990166-96990188 CTGGGGGCTGGGCAGGGGGAGGG - Intergenic
1072756215 10:98022877-98022899 CTGGGGCCAGGGGTGGGGTAGGG + Intronic
1072759252 10:98042327-98042349 CAGTGAGCAGGACTGGGGGATGG - Intergenic
1073143227 10:101262404-101262426 CTGGGGACTGGGCCGGGAGATGG + Intergenic
1073152866 10:101323614-101323636 CTTTGGACTGGGATGGGGGCAGG - Intergenic
1073217009 10:101842024-101842046 CTAGGGACAGTGATGGGGGATGG + Intronic
1073331749 10:102674486-102674508 CGGGGGAGAGGGCTGGGGGCCGG - Exonic
1073466890 10:103699555-103699577 CTGAGCAAAGGGCTGGGCGAAGG + Intronic
1074003127 10:109392290-109392312 TTGAGGAGAGGGGTGGGGGACGG + Intergenic
1074050351 10:109876038-109876060 CTGGGGTCAGGGCTGAAGGAGGG - Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074542232 10:114374488-114374510 TTGAGGCCAGGGCTGGGGAAGGG - Intronic
1074781364 10:116804540-116804562 CTGTGGCTGGGGCTGGGGGCTGG - Intergenic
1075181619 10:120216027-120216049 CCGTGGAAAGGGGAGGGGGAGGG + Intergenic
1075263364 10:120981097-120981119 GAGTGGAAAGGGATGGGGGAGGG - Intergenic
1075458394 10:122599713-122599735 CTGTGATCAGGGCTTGAGGACGG + Intronic
1075630390 10:123997157-123997179 CAGAGGCCAGGGCTGGGGGCTGG + Intergenic
1076057369 10:127386763-127386785 CCATGGACCGGGGTGGGGGATGG - Intronic
1076076018 10:127534451-127534473 CTGTGGACAGAGCTGTGGATGGG - Intergenic
1076193370 10:128498356-128498378 CTGGGGACTGGGCTGGGGTCAGG + Intergenic
1076522734 10:131091025-131091047 CTGTGGGCAGGGGTGGGGCTGGG + Intergenic
1076612373 10:131734349-131734371 CTGAGGACTGGGGTTGGGGAGGG - Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1076778987 10:132713709-132713731 CCGTGCACAGGGCTGAGGGCCGG - Intronic
1076825427 10:132964863-132964885 CTGTGGCCAGGCCTGGCGGGCGG + Intergenic
1076870348 10:133189832-133189854 CTGGGGGCAGGGCTGGGGCAGGG - Intronic
1076873787 10:133206292-133206314 TTGTGGGCGGGGCTGGGGGCAGG - Intronic
1076896658 10:133316571-133316593 CTGTGTCCAGGTCGGGGGGAGGG - Intronic
1076990696 11:271971-271993 CAGGGGCCAGGGCTGTGGGAAGG - Intergenic
1077034698 11:489003-489025 CTAAGGAAAGGCCTGGGGGACGG + Intronic
1077147800 11:1053678-1053700 GTGTGGCCAGCCCTGGGGGAAGG + Intergenic
1077169191 11:1158832-1158854 CTGGGGACAGGGCTGGGCGAGGG - Intronic
1077321784 11:1946158-1946180 GTGGGAACAGGGCTGCGGGAGGG - Intergenic
1077323979 11:1955659-1955681 CTGTGGCCTGGGCTGGGGCTTGG + Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078059137 11:8032128-8032150 CTGGGGAAAGGCCTGGGGAAAGG + Intronic
1078574336 11:12485791-12485813 GTGGGGACAGGGTAGGGGGAGGG + Intronic
1079078235 11:17396712-17396734 CTGAGGGCAGCACTGGGGGAAGG + Intronic
1080169452 11:29281776-29281798 GTGAGGGGAGGGCTGGGGGAGGG + Intergenic
1080384387 11:31802577-31802599 CTGGGGACTGGGGTGGGTGAGGG + Intronic
1080642912 11:34168144-34168166 CTGGGCACAGGGCATGGGGAAGG + Intronic
1080809560 11:35689796-35689818 CTGAGGACTGGGCAGGGGGAAGG - Intronic
1081525327 11:43924323-43924345 CCAGGGCCAGGGCTGGGGGACGG - Intergenic
1081535031 11:43990046-43990068 CTGGGGTCAGGGCTCTGGGAAGG - Intergenic
1081651948 11:44830068-44830090 GTGTGGAGTGGGCTAGGGGAAGG - Intronic
1081998118 11:47377636-47377658 CAGGGGACAGGGCTGGGACAAGG - Intronic
1082005619 11:47417559-47417581 CTCTTGACAGGACTGGGGAAGGG - Intergenic
1082787835 11:57326660-57326682 CTGTGGGCTGGGCAGGGTGAGGG - Intronic
1082811048 11:57479184-57479206 CTGGGGCCTGGGCAGGGGGAGGG + Intergenic
1082877589 11:58003571-58003593 GGGTGGACAGAGCAGGGGGAAGG + Intergenic
1083234486 11:61342879-61342901 CTTTGGAAAGGGCTGAGGGAGGG + Intronic
1083278296 11:61609973-61609995 CAGTGCAGAGGGATGGGGGAGGG + Intergenic
1083470610 11:62881503-62881525 CTGGGGACAGGGGAGGGGGTCGG - Intronic
1083615500 11:64024052-64024074 CTGGGGACAGGGCTTGGAGAGGG - Intronic
1083886726 11:65576674-65576696 CTGCGGTCAGGGCTGGGGGAGGG + Intronic
1083957488 11:65993160-65993182 CTGTGGCCAGGGCCGGGGGGTGG - Intergenic
1084067936 11:66716043-66716065 CAGTTGGCAGGGGTGGGGGATGG + Intronic
1084085564 11:66853526-66853548 GTGAGGAGAGGGCTGAGGGACGG - Intronic
1084086170 11:66856403-66856425 CTGGGGACAGGGCGGGGCGGCGG + Intronic
1084125348 11:67095558-67095580 CAGGGGACAGGGCAGGGAGAGGG - Intergenic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1084267870 11:68014215-68014237 ATGTGGACAGGGTTGGGAGGTGG + Intronic
1084359329 11:68659572-68659594 AGATGGACGGGGCTGGGGGAGGG + Intergenic
1084419695 11:69054116-69054138 CTGTGGCCGGGCCTGGGGGGTGG + Intronic
1084546389 11:69817141-69817163 CTGTGGTGGGGGCTGGGGGCGGG + Intronic
1084689324 11:70715963-70715985 CTGTGGACAGGGCGTCTGGAGGG + Intronic
1084890064 11:72232421-72232443 CTGGAGACAGGCCTGCGGGAGGG - Intronic
1084945583 11:72636699-72636721 GAGTGGCCAGGGCTGGTGGAGGG - Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085128231 11:74016554-74016576 CTGTGTACAGGGCAGGGGCGGGG + Intronic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085304379 11:75476875-75476897 GTGTGGGCCGGGGTGGGGGATGG - Intronic
1085527743 11:77173940-77173962 CTGAGGACTGGGCCGAGGGAAGG - Intronic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1085938247 11:81176680-81176702 CCATGGACAGGGCTGGGGCGGGG + Intergenic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1087440621 11:98178720-98178742 ATGTGGACAGGGCTTGGTGAGGG - Intergenic
1088505568 11:110523459-110523481 CTGTGGAAAGGGGTGGGTGATGG + Intergenic
1088543599 11:110937860-110937882 TTGGGGACAGGGCCTGGGGAAGG + Intergenic
1088638655 11:111849625-111849647 CTGTGGAGGGGGCGGAGGGAGGG - Intronic
1088711856 11:112515808-112515830 CTGTGGGCAGGGGAGGGGGGTGG - Intergenic
1088724410 11:112621413-112621435 CTGAGGCCAGGGTTGGGAGAGGG + Intergenic
1089214901 11:116829518-116829540 CTGTGTTCAGGGCTTGGGGCTGG + Intergenic
1089288014 11:117420071-117420093 CTGTAGAAATGCCTGGGGGAGGG + Intergenic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089794503 11:120969432-120969454 CTGTGGGCAGGGCTGTGTGCAGG + Intronic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1089992140 11:122871449-122871471 CAGTGGACCAGCCTGGGGGAAGG + Exonic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1090634143 11:128678848-128678870 CTCTGGTCAGAGCTTGGGGAGGG + Intergenic
1090645681 11:128765037-128765059 GTGTGCACAGGGCCGGGGGAGGG + Intronic
1090703427 11:129315977-129315999 CTCTGGGCAGGGCTGCGAGAGGG - Intergenic
1090796786 11:130142109-130142131 CTGTGGGCTGGGTTGGGGGTGGG + Intronic
1091215778 11:133900607-133900629 CTGTGGGCCGGCCTGGGAGAGGG - Intergenic
1202804801 11_KI270721v1_random:1471-1493 GTGGGAACAGGGCTGCGGGAGGG - Intergenic
1202806965 11_KI270721v1_random:10854-10876 CTGTGGCCTGGGCTGGGGCTTGG + Intergenic
1091388389 12:109706-109728 AGGTTGGCAGGGCTGGGGGAAGG - Intronic
1091556997 12:1581342-1581364 CTGGGGAGAGGGTTTGGGGAAGG + Intronic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1091820248 12:3470681-3470703 CGGTGTCCAGGGCGGGGGGATGG + Intronic
1091826853 12:3519373-3519395 AGGTTGGCAGGGCTGGGGGAAGG + Intronic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092023484 12:5222027-5222049 GTGGGGAGAGGGCTGGGGAAGGG + Intergenic
1092487380 12:8914500-8914522 CTGCGGGCCGGGCTGGAGGAGGG - Intronic
1092751546 12:11724023-11724045 CTCAGGTCAGGGGTGGGGGAGGG - Intronic
1092798733 12:12141183-12141205 AAGAGGAAAGGGCTGGGGGAGGG + Intronic
1092859272 12:12705978-12706000 CTGTGGCCAGGGGTGAGGGCTGG - Intergenic
1093182651 12:15984336-15984358 CTGTGGACAGGATGGGTGGAGGG - Intronic
1093619877 12:21276684-21276706 ATGTGGCCACTGCTGGGGGATGG - Intronic
1093775041 12:23063956-23063978 CTGTGGAGAGGCCTGCGGTAGGG - Intergenic
1094025747 12:25958656-25958678 CTGGGGGCCGGGCTGGGGGCCGG - Intergenic
1094165227 12:27436458-27436480 CCATGGTCAGGGCTGGAGGAAGG - Intergenic
1094452976 12:30601646-30601668 CACTGCACAGGGATGGGGGATGG - Intergenic
1095951665 12:47785033-47785055 CTGTGGCCAGGACTGAGGGGAGG + Intronic
1096033496 12:48442514-48442536 CTGTGTTCAGGGCTGGTGGGGGG - Intergenic
1096139147 12:49227784-49227806 CTGTGGACTAGGATGGCGGAGGG + Intronic
1096220560 12:49826138-49826160 AGGTGGGCAGGGCTGGGGGTGGG + Intronic
1096258453 12:50076697-50076719 CTGCTGACAGAGCTGGGGGCAGG + Intronic
1096470407 12:51871967-51871989 CGGGGGACAGGGATGGGGGGAGG - Intergenic
1096672952 12:53211017-53211039 CACATGACAGGGCTGGGGGAGGG + Exonic
1096845270 12:54403164-54403186 GTGAGGACAGGGCAGGGAGAAGG - Intronic
1096867048 12:54570800-54570822 CTCTTGACAGGGCTCGGGGCGGG + Intronic
1096919204 12:55065877-55065899 GTGTGGACAGGGATTGGGGAGGG + Intergenic
1097058876 12:56267586-56267608 CTAAGGACAGGGCTGGGGGCGGG - Intronic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097427543 12:59466055-59466077 TTTTGGACAGGGTTGGGGAAGGG - Intergenic
1098130466 12:67344978-67345000 CTGTGGTGAGGGGAGGGGGAGGG - Intergenic
1098143046 12:67469977-67469999 CTGCAGCCAGGGGTGGGGGAGGG + Intergenic
1098213707 12:68193618-68193640 CTGTGGGAAGGCCTGGGGAAGGG + Intergenic
1098549097 12:71743126-71743148 TTGTGGCCAGGGCAGGGGGAGGG + Intergenic
1098618698 12:72563797-72563819 CTGGGGGCGGGGGTGGGGGATGG + Intronic
1099025469 12:77459688-77459710 CTGTGGACGAGGCTGGGGGAGGG + Intergenic
1100113386 12:91272627-91272649 CTGCCAACAGGGCTGGGAGATGG + Intergenic
1100280313 12:93112304-93112326 CTGGGGAAAGTGCTGGGAGACGG - Intergenic
1100435504 12:94567714-94567736 CTGAGGAGTGGGCTGGGGGTAGG - Exonic
1100860743 12:98803697-98803719 CTGGGAACAGGGCTGGGGGTGGG + Intronic
1101301129 12:103483803-103483825 ATGTGGTGGGGGCTGGGGGAGGG - Intronic
1101316357 12:103632576-103632598 ATGTCGAGAGGGCTGTGGGAAGG + Intronic
1101456841 12:104841451-104841473 CTAGGGACAGGGCTGGGTGCTGG + Intronic
1101724960 12:107381358-107381380 CTGTGTACAGGGTTAGGGCAAGG + Intronic
1102131374 12:110531801-110531823 CTGTAAACAGGTTTGGGGGAGGG - Exonic
1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG + Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102490221 12:113286098-113286120 CTGTGGGCAGGGCTGCTTGAGGG - Intronic
1102493518 12:113303751-113303773 CTGTGGGCAGTGCTGGGATATGG + Intronic
1102791400 12:115649416-115649438 CCTTGGACATGACTGGGGGAGGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1102928936 12:116847995-116848017 CTGTTGCGGGGGCTGGGGGAGGG - Intronic
1102959805 12:117085134-117085156 GGGTGGACAGGGCTGGCAGAAGG + Intronic
1103173696 12:118843865-118843887 GTGTGAACCTGGCTGGGGGAGGG - Intergenic
1103342929 12:120230654-120230676 ATGTGCTCTGGGCTGGGGGAGGG - Intronic
1103443182 12:120978589-120978611 CTGGGGCCAGGGTTGGGGGTTGG + Exonic
1103468411 12:121160515-121160537 CTGTGGCCAGGGACAGGGGAAGG - Intronic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1103487867 12:121295547-121295569 CTGGGGGCAGAGCTAGGGGAGGG + Intronic
1103518857 12:121524577-121524599 ATGTGAGCAGAGCTGGGGGAGGG - Intronic
1103578659 12:121898030-121898052 CTGTGGACCTCACTGGGGGAGGG + Intronic
1103716618 12:122948940-122948962 CTGTGGGCGGGGTTGGGGGGTGG + Intronic
1103884806 12:124192322-124192344 CTGTAGGCTGGGCTGGGGGTGGG + Intronic
1103972749 12:124682289-124682311 GGAAGGACAGGGCTGGGGGAGGG + Intergenic
1103995436 12:124826944-124826966 CTCAGGAGAGGGCTGGGGGCTGG + Intronic
1104065406 12:125301403-125301425 CTGGGCACAGGGCTGGTGCACGG - Intronic
1104484673 12:129140412-129140434 CTGTGGTCAGGGATTGGGGAGGG - Intronic
1104512433 12:129392708-129392730 CTGGGGTGAGGGTTGGGGGAGGG - Intronic
1104541668 12:129671621-129671643 CTTGGGGCAGGGCTGGGGAAGGG + Intronic
1104572643 12:129938522-129938544 CTGTGGCCAGGGCCAGGCGAAGG + Intergenic
1104688197 12:130804232-130804254 CTGATGACAGGGCTGACGGAAGG + Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104729259 12:131095993-131096015 CTCTGGGCAGGGCTGGGAGGCGG - Intronic
1104856709 12:131905559-131905581 ATGTGTACAGGGCAGAGGGAGGG + Intronic
1104874973 12:132027330-132027352 CTGTGGAGTGTGCTGGTGGAGGG + Intronic
1104910180 12:132236516-132236538 AAGGGGAAAGGGCTGGGGGAGGG - Intronic
1104980037 12:132569681-132569703 CCGTGGCCAGGGGTGGGGGTGGG - Intronic
1105520872 13:21129813-21129835 CTGTGGACTGGGCTAGGAGCTGG + Intergenic
1105546280 13:21353033-21353055 CTACGCACAGGCCTGGGGGAAGG + Intergenic
1105761880 13:23522617-23522639 CTATGGAAAGGGTGGGGGGATGG + Intergenic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1106016622 13:25875079-25875101 CAGTTGCCGGGGCTGGGGGAGGG + Intronic
1106049695 13:26178504-26178526 ATGTGGGCGGGGGTGGGGGAGGG + Intronic
1106076282 13:26464065-26464087 CTCTGGCCAGGGCTGGAAGAGGG + Intergenic
1107172992 13:37365380-37365402 GTGTGGGCAGGGCAGGGGGCGGG + Intergenic
1107893650 13:44936955-44936977 CCATGCACAGGGCAGGGGGATGG - Intergenic
1108404414 13:50085401-50085423 GAGTGGAAAGGGGTGGGGGAGGG - Intronic
1108481897 13:50881174-50881196 CTGGGGACAGGGGTGTGGGAGGG + Intergenic
1108833918 13:54516337-54516359 ATAGGGACAGGGCTGGGGGAAGG + Intergenic
1109044183 13:57387064-57387086 CTGTGGAACGGTCTGGGGGGTGG - Intergenic
1109047003 13:57425661-57425683 CTCTGGACAGGAATGGGAGATGG - Intergenic
1109741856 13:66563956-66563978 CTGTCGAAAGGGCTGTGGTAAGG - Intronic
1110484337 13:76020125-76020147 CTGAGCACAGGCCTGGGGGGTGG + Intergenic
1111215795 13:85139766-85139788 ATGCTGACAGGGCTTGGGGAGGG - Intergenic
1111747515 13:92289285-92289307 CTGTTGGCAGGGGTGGGGGTTGG - Intronic
1111885814 13:94018940-94018962 CCGTGGACAGGTGTGGGGGTGGG - Intronic
1111924772 13:94451058-94451080 CTATGGACTAGGCTGGGGGCTGG - Intronic
1112062702 13:95756851-95756873 CTGTGCACAGGGCTGGGGTTGGG + Intronic
1112369026 13:98778635-98778657 CTCTGGACATGGCTGAGGGTTGG - Intergenic
1112436033 13:99391948-99391970 CAGTGGGTAGGGCTGGGGCAGGG + Intergenic
1112452244 13:99523200-99523222 CTGTGGCCTGGGCTGGGCCACGG + Intronic
1112943509 13:104895496-104895518 CTTTGCACAGGGCCGGGGGTAGG + Intergenic
1113209640 13:107960539-107960561 CTTTGCAGGGGGCTGGGGGATGG + Intergenic
1113586163 13:111467623-111467645 CAGGGGACATTGCTGGGGGAGGG + Intergenic
1113611381 13:111647025-111647047 AGGTGGAAAGGGGTGGGGGAGGG - Intronic
1113724416 13:112587778-112587800 CCGGGCAGAGGGCTGGGGGACGG - Intronic
1114318450 14:21526849-21526871 TTGTGGAGAGGGATGGGGGTAGG - Intronic
1114454248 14:22845134-22845156 CTGTGGACAGGGTGGGGACAGGG - Intronic
1114654833 14:24309906-24309928 TTGGGGCCAGAGCTGGGGGAGGG + Intronic
1114703915 14:24706670-24706692 ATATGGAGAGGCCTGGGGGAAGG + Intergenic
1115662458 14:35510802-35510824 CCATGGACAGGGGTGGGGGTGGG + Intergenic
1116012667 14:39369158-39369180 TTGTGGGTAGGGCTTGGGGAGGG + Intronic
1116861699 14:50000780-50000802 CAGTGGACAGGGATGTGGGATGG + Intronic
1117322177 14:54634477-54634499 GTGGGGACAGGGATGGGGGTTGG + Intronic
1117646836 14:57862069-57862091 CTTTGGAAAGGGGTGGGGGGTGG - Intronic
1117955947 14:61123793-61123815 TGGTGGGGAGGGCTGGGGGAGGG - Intergenic
1118302658 14:64629033-64629055 CTGGAGACAGGGGTGGGGGAGGG + Intergenic
1118693835 14:68364527-68364549 GAGTGGAAGGGGCTGGGGGAGGG - Intronic
1118735429 14:68697518-68697540 CAATGGCTAGGGCTGGGGGAAGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119406188 14:74401221-74401243 CAGTGGGCAGGGCTGGGGTGAGG - Intergenic
1119601862 14:75982043-75982065 CTCTGGCCTGGGGTGGGGGAGGG + Intronic
1119778126 14:77260666-77260688 CTGGGGACGGGACTGGGGCAGGG + Intergenic
1119866037 14:77975387-77975409 CTGAGGACAGGACTGGGAGGAGG + Intergenic
1121102241 14:91257800-91257822 GTGTGGACAGGGTTAAGGGATGG - Intergenic
1121231975 14:92364961-92364983 CAGTGGAAAGGGCAGGGGCAAGG - Intronic
1121326055 14:93020171-93020193 GTGGGGGCAGGGCTGGGAGACGG + Intronic
1121326667 14:93024183-93024205 CTGTTGCCAGGCCTGGAGGAAGG + Intronic
1121413721 14:93764432-93764454 CTGTGGACAGCTTTGGGGGCGGG - Intronic
1121507737 14:94489554-94489576 CTCTGGCCCCGGCTGGGGGAAGG + Intronic
1122112030 14:99509910-99509932 GTGTGGTCAGGGCTGAGGGAGGG + Exonic
1122117947 14:99536951-99536973 CAGGGCAGAGGGCTGGGGGAAGG + Intronic
1122203299 14:100135696-100135718 CAGTGGACAAAGCTGGGGAAGGG - Intronic
1122254297 14:100465365-100465387 TGGTGGCCAGGGCTGGGGGAGGG - Intronic
1122279182 14:100611068-100611090 CAGCGGAGAGGGCTGGGAGAGGG - Intergenic
1122470380 14:101962189-101962211 CTCTGGGCAGGGCAGGGGGCAGG - Intergenic
1122548748 14:102538956-102538978 CTGGGGCCAGGCCTGGAGGAGGG - Intergenic
1122718241 14:103707906-103707928 CTGTGGGCAGGGCTCTGGGCAGG - Intronic
1122796935 14:104210710-104210732 CGGGGGGCAGGGCTGGGGGAGGG + Intergenic
1122830374 14:104392889-104392911 CTGTGGACAGGGCAGAGGCCCGG + Intergenic
1122840470 14:104460028-104460050 CTGGGGGCGGGGCGGGGGGAGGG + Intergenic
1123010493 14:105347356-105347378 GTGTGGACATGGCGGTGGGAAGG - Intronic
1123028119 14:105438193-105438215 CTGTGGGCAGGGCTGGTGGCTGG + Intronic
1123039126 14:105483218-105483240 CTGGGGGCAGGGCTGGCTGAGGG + Intergenic
1123040721 14:105489221-105489243 ATGAGGACAGGGTTGGGGGGTGG - Intronic
1123506240 15:20942757-20942779 CTGTGGCCATGGCAGGGGCAGGG + Intergenic
1123704583 15:22941724-22941746 CTGTGTGCAAAGCTGGGGGAAGG - Intronic
1124239754 15:28019640-28019662 CTGTGGAGGAGGCTGGGTGAAGG - Intronic
1124634063 15:31353764-31353786 CTGTGGCCAAGCCTGGGGCAGGG + Intronic
1125495768 15:40192298-40192320 CTGTGTACAGGGTTGAGGGGTGG - Intronic
1125522749 15:40357362-40357384 CTGTGGACAGGCCTGGCTAAGGG - Intergenic
1126876501 15:53047444-53047466 CAGTTGCCAGGGCTGGTGGAGGG - Intergenic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1127447205 15:59076153-59076175 CTGTGGAGGGGGCTGGGGCTGGG - Exonic
1127681556 15:61303092-61303114 CCATGGACAGAGCTGGGGGTGGG - Intergenic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1127774216 15:62253000-62253022 CTGGGGACTGGGCTGGGGGAAGG - Intergenic
1127775850 15:62263893-62263915 CTGGGAACTGGACTGGGGGAAGG - Intergenic
1127841558 15:62836175-62836197 ACGTGGACAGGGCTGGCTGATGG - Intronic
1127846475 15:62875590-62875612 CTGGGGTCAGGGTTGGGGTAGGG - Intergenic
1128095060 15:64947741-64947763 CTGTGCAGAGGCCTGGAGGAGGG - Intronic
1128110287 15:65071818-65071840 CTGGGGGCAGGGCTGGAGAAGGG - Intronic
1128240143 15:66096110-66096132 CTGAGGCCAGGGCTGGGAGCTGG - Intronic
1128467891 15:67928154-67928176 CTGCCGAGAGGGCTGGGGGTGGG + Intergenic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1128678083 15:69626492-69626514 CTTGGGTCAGGGCTGGGGAACGG - Intergenic
1128804029 15:70517488-70517510 CCCTGGGCAGGGCTGGGGGAAGG - Intergenic
1129010147 15:72408596-72408618 CTGGGGGCGGGGCGGGGGGAAGG - Intergenic
1129107368 15:73319199-73319221 CTGGAGACAGGGGTGGGGAAGGG + Intergenic
1129268919 15:74409439-74409461 GGATGGACAGGGCTGGGGGCAGG + Exonic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129616778 15:77105048-77105070 CTTTGCCCAGGGTTGGGGGATGG - Exonic
1129685796 15:77685433-77685455 CAGTGGACATGTCTGGGGTATGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1130059480 15:80559334-80559356 CTGTGGCCGGGGCTGGGGCTGGG - Intronic
1130195527 15:81777159-81777181 CTGGGAACATGGCTGGGGCATGG - Intergenic
1130221906 15:82026544-82026566 TTTTGGCCAGGGCTAGGGGAGGG - Intergenic
1130563751 15:84978461-84978483 CTGGGGGCAGGACTGGAGGAAGG + Intergenic
1130878337 15:88033092-88033114 CTGTGGACAGGGCTGGAAACTGG - Intronic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131157073 15:90081830-90081852 CTGACGGCGGGGCTGGGGGAGGG - Exonic
1131280039 15:91013738-91013760 CTGAGGACCGGGCAGGGGTAAGG - Intronic
1131370170 15:91874419-91874441 TGGTGGCCAGGGCTGGGGGAAGG - Intronic
1131382382 15:91974595-91974617 CTGTGGGCAGGGCAGGGAGGCGG + Intronic
1131432937 15:92401131-92401153 CAGTGGAAACGGCCGGGGGAGGG + Intronic
1132133938 15:99313890-99313912 TTGTAGACTGGGCTGGGGGTAGG + Intronic
1132244015 15:100280572-100280594 TTGTGGACAGGGCCTGGTGAGGG - Intronic
1132347311 15:101116132-101116154 CTGAGAACAGTGGTGGGGGAAGG - Intergenic
1132399677 15:101497647-101497669 CTGGGGACAGGGCAGGGCGGCGG - Intronic
1202971824 15_KI270727v1_random:243598-243620 CTGTGGCCATGGCAGGGGCAGGG + Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132462239 16:61362-61384 GTGAGGACGGGGCTGGGGGCGGG - Intronic
1132518298 16:376091-376113 CTGTGGCCTGGGCTCGGGCAGGG - Intronic
1132579857 16:679914-679936 CTGCGGATGGGGCTGGGGGCGGG + Intronic
1132586246 16:706754-706776 CTGGGAGCAGGGCCGGGGGAGGG + Intronic
1132701894 16:1225539-1225561 CCGGGGCCAGGGCTGAGGGAGGG + Intergenic
1132734357 16:1378234-1378256 CTGTGGGCAGGCCTGCGGGTTGG - Intronic
1132880816 16:2160976-2160998 CTGGGGACTGGGCTGAGGGGAGG + Intronic
1132935035 16:2475667-2475689 CACTGGACAGGGCCGGGGGCTGG - Intronic
1132940063 16:2502023-2502045 GTGTGGCCAGGGCCAGGGGAGGG - Exonic
1133117617 16:3587005-3587027 TGGTTGCCAGGGCTGGGGGAAGG + Intronic
1133253777 16:4503314-4503336 TTTGGGGCAGGGCTGGGGGAGGG - Intronic
1133400173 16:5479954-5479976 CTGTGGGCTGGGCTGGAGGGTGG - Intergenic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1134036401 16:11034572-11034594 CCGTGGACAGGGGTGGAGGGCGG - Intronic
1134408024 16:13979662-13979684 GAATGGCCAGGGCTGGGGGAGGG - Intergenic
1135121787 16:19772564-19772586 CTATGGACAGGGGTGAGGGAGGG + Intronic
1135462724 16:22659259-22659281 TTTGGGACAGGGCTGTGGGATGG + Intergenic
1135853328 16:25984257-25984279 CCATGGCCAGGGATGGGGGACGG + Intronic
1136037201 16:27549585-27549607 CTGGGGGCAGGGCGGGGGAATGG - Intronic
1136060196 16:27721228-27721250 TTGAGGAGAGCGCTGGGGGAGGG - Intronic
1136073379 16:27802362-27802384 CTGTGGTCAGAGCTGAGGGAGGG - Intronic
1136110174 16:28059628-28059650 CTGAGGAGAGGCCTGGAGGAGGG - Intronic
1136186477 16:28591508-28591530 CTGTGGTCTAGGCTGGGGGAAGG + Intronic
1136188964 16:28604232-28604254 CTGTGGTCTAGGCTGGGGGAAGG + Intergenic
1136368746 16:29822547-29822569 CTGTGGGAAGGTCTGGGGGCAGG + Intronic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1136395115 16:29988250-29988272 CTGGGGCCAGGGGTGGTGGAGGG + Exonic
1136561577 16:31042274-31042296 CTCTGGACTGGGCTAGGGGAAGG + Intronic
1136777489 16:32879584-32879606 CTGAGGGCTGGGCTGGGGCATGG - Intergenic
1136893135 16:33981930-33981952 CTGAGGGCTGGGCTGGGGCATGG + Intergenic
1138019618 16:53466335-53466357 CCATGGACAGGGTTGGGGGTTGG + Intronic
1138589329 16:57991042-57991064 CTGCGGGCAGGGGTGGGGTAGGG + Intergenic
1139021288 16:62753102-62753124 CTCTGGACAATGCTGGGGGAGGG - Intergenic
1139258068 16:65562588-65562610 CTGGGGAAATGGCTGGGTGATGG - Intergenic
1139576657 16:67846602-67846624 CTGTGCACTGGGGTGGGGGTTGG - Intronic
1139599271 16:67976818-67976840 CTGGGGACAGGGCTGGTGCCAGG - Intronic
1140126086 16:72120078-72120100 CTGTGGAGGTGGCTGTGGGAAGG + Exonic
1140872672 16:79121494-79121516 CTGTTTACGGGGCTGTGGGATGG + Intronic
1140888093 16:79261907-79261929 CAGTGGAGAGGGCTGGGAGAAGG + Intergenic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141464591 16:84197338-84197360 CTGTTCACAGGGCTGGAGGCAGG + Intergenic
1141585945 16:85033665-85033687 GTGGGGGCAGGGATGGGGGAGGG + Intronic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1141984607 16:87571690-87571712 CTGGGAACAGTGCTGGGTGACGG + Intergenic
1142092881 16:88224497-88224519 ATGTGGACGGGGTTGGGGGCTGG + Intergenic
1142108295 16:88317999-88318021 CAGAGGACAGGGCTGGGGCCAGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142126321 16:88412296-88412318 CTGTGGAGAGGGCACTGGGAAGG - Intergenic
1142140409 16:88470257-88470279 CTGGGGACAGGGCTGCTGGACGG + Intronic
1142156624 16:88535374-88535396 GTATGGACAGGGCTGGGGTGGGG - Exonic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142286883 16:89175127-89175149 CTGTGGACAGGCCTGGGCCCAGG + Intronic
1142303285 16:89271173-89271195 CTGGGGGCAGGGCTGGGGACCGG - Intronic
1203079902 16_KI270728v1_random:1141693-1141715 CTGAGGGCTGGGCTGGGGCATGG - Intergenic
1142559046 17:799117-799139 CGGTGGCCAGGGCTGCAGGAGGG + Intergenic
1142582625 17:951703-951725 GTCTGGGCAGGGCTGGGGGTGGG + Intronic
1142613843 17:1123981-1124003 CTGTGGGAAGGGCTGGCGGGGGG - Intronic
1142805493 17:2369135-2369157 TTGGGGAGAGGGCTGGGGAATGG + Intronic
1142859031 17:2749730-2749752 CCGTGGGCGGGGCGGGGGGAGGG + Intergenic
1143095782 17:4477615-4477637 CTGGGAGCAGGGCTGGGGGTGGG + Intronic
1143481368 17:7229342-7229364 CTGTGGCTAGGGCGTGGGGAGGG - Intronic
1143632018 17:8144930-8144952 CTGGGGGCTGGGCTGGGGGCTGG + Exonic
1143655208 17:8289802-8289824 CTGTTGTCAGGGCTTGGGGTGGG - Exonic
1143697490 17:8630942-8630964 CTGTGGCCTGGGCTGGGAGCGGG - Intergenic
1143727155 17:8856987-8857009 CTGTGGGGAAAGCTGGGGGAAGG - Intronic
1144677710 17:17172630-17172652 CTGCTGACAGGGGTGGGGGTGGG - Intronic
1144767889 17:17742816-17742838 CTGGGGACAGGGATGGCCGAGGG - Intronic
1144798819 17:17911553-17911575 CTGGGGACAGGACTGAGTGAGGG + Intronic
1145037451 17:19551264-19551286 CTCAGGACAGGGCTGGGGCCAGG - Intronic
1145811900 17:27769294-27769316 TTGGTGACAAGGCTGGGGGATGG - Intronic
1145975143 17:28979539-28979561 CTAAGGCCAGGGCTGGGAGATGG - Intronic
1145993306 17:29091943-29091965 CAGTGGGCTGGGCAGGGGGAAGG + Intronic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146283509 17:31559748-31559770 CGAGGGACAGCGCTGGGGGAGGG - Intergenic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146430079 17:32784821-32784843 CTGTGGGGAGGGGTGGGGTATGG + Intronic
1146787244 17:35731397-35731419 CTGGTGACAGGCCTGGGCGAGGG + Intronic
1147159181 17:38560687-38560709 CTGTGGAATGGTTTGGGGGAGGG - Intronic
1147249234 17:39143354-39143376 CTGGGGAGTGGGCTGGGGGAAGG - Intronic
1147334031 17:39716206-39716228 CTGTGGGCATGGCTGTGGGCTGG - Intronic
1147342050 17:39758507-39758529 CTGTGGCGAGGGATTGGGGAAGG + Intergenic
1147446009 17:40475695-40475717 CCGTGGCCAGGGGTGCGGGAGGG + Intergenic
1147836264 17:43334185-43334207 CTGTGGGCATGGCTGCGGGTGGG + Intergenic
1148051798 17:44773198-44773220 TTGGGGCCAGGGCTGGAGGAGGG - Intronic
1148115590 17:45172847-45172869 CTGGGGCCTGGGGTGGGGGAAGG - Intergenic
1148437254 17:47694207-47694229 CTGGGGCTAGGGCTGGGGGAGGG + Intronic
1148461217 17:47840092-47840114 CTGTGAACCAGGCTGGGGGAGGG + Intronic
1148678619 17:49459708-49459730 CTGAGGGCTTGGCTGGGGGAGGG + Intronic
1148680425 17:49470428-49470450 CTGGGGATCGGGGTGGGGGAGGG + Intronic
1148749125 17:49934704-49934726 CTGTGCCCAAGGCTGGGGGTGGG + Intergenic
1149566667 17:57645188-57645210 CTGTGGGCAGGGTTGGGGCCAGG + Intronic
1149986749 17:61353268-61353290 TTGGGGACAGGCCAGGGGGAGGG + Intronic
1150131975 17:62674380-62674402 CTCAGGACTGGGCTGGGGGTGGG - Intronic
1150229971 17:63544421-63544443 CTGTGGTCAGGGCTGGGGGCTGG + Intronic
1150620467 17:66804065-66804087 CTGCGGGGAGGGCTGGGGGCTGG - Exonic
1150883654 17:69059706-69059728 ATGGGGGCAGGGTTGGGGGAAGG + Intronic
1151412176 17:73938263-73938285 CTGTGGACAGGGCGGGGCTGAGG - Intergenic
1151418664 17:73983505-73983527 TTGTGGGCAGGGCTGGGCGAGGG - Intergenic
1151429057 17:74050318-74050340 CCGTGGACAGGGCAGAGGGCAGG - Intergenic
1151530731 17:74703197-74703219 CTGTGTGCAGGGCTGCGGGTGGG - Intronic
1151576239 17:74953891-74953913 ATGGGCACAGGGATGGGGGAGGG - Intronic
1151625426 17:75272671-75272693 CTGTGGGCAGGCGTGGGTGAAGG - Intergenic
1151658136 17:75505074-75505096 CTGCGGCCAGGGGTGGGGGGCGG + Intronic
1151787085 17:76280238-76280260 CTGGGGGCAAGGCTGTGGGATGG + Intronic
1151816813 17:76475184-76475206 CTGTGGCCGGGACTGGGGGTTGG - Intronic
1151957529 17:77387905-77387927 CTGGGAACAGGGCTGGTGAAGGG - Intronic
1151965343 17:77428240-77428262 CCTTGGACAGAGCTCGGGGACGG + Intronic
1152106074 17:78329795-78329817 CTGTGGTCAGAGCTGGCAGAGGG - Intergenic
1152155927 17:78632762-78632784 ATGGGGGCAGGGGTGGGGGATGG - Intergenic
1152229438 17:79107087-79107109 CTGTGGACAGGCCTGGGCTGCGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152430581 17:80246400-80246422 CTGGGGACAGGGGTGGGGGTAGG - Intronic
1152520499 17:80853225-80853247 CTGAGGTCAGTGATGGGGGAGGG - Intronic
1152521755 17:80860500-80860522 CTATGGTCAGGGCTGGGTGCAGG - Intronic
1152594786 17:81232823-81232845 GTGTGTCCAGGGCTCGGGGAGGG + Intronic
1152677835 17:81650812-81650834 CTGTGGGCAGGACTGAGGGGTGG + Exonic
1152705628 17:81842082-81842104 CTGTGTGCAGGGCTGGGCGATGG - Intergenic
1152745299 17:82036064-82036086 CTGTGGGCAGGGCGGGGGTCAGG + Intronic
1152816787 17:82412549-82412571 AGGTGGACAGGGCAGGGGCAGGG + Intronic
1152820603 17:82435875-82435897 CGGCCAACAGGGCTGGGGGAGGG + Intronic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1153051368 18:905767-905789 CTGTGGGCCGGGTTGGGGGAGGG - Intronic
1153471073 18:5445923-5445945 CTATGGACTGGGGTGGAGGATGG - Intronic
1153597394 18:6741775-6741797 ATGTGGGCAGGGTTGGGGGTAGG - Intronic
1153981532 18:10314756-10314778 CTGTCGCCAGGACTGGAGGAAGG + Intergenic
1154460280 18:14576634-14576656 CTGGGGACTGTGGTGGGGGAGGG + Intergenic
1155279173 18:24220519-24220541 TTGTGGTGAGGGCTGGGGGCTGG - Intronic
1155606244 18:27609424-27609446 GTGTGGTCAGAGCTGAGGGATGG + Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157359404 18:46964023-46964045 CTGTGCTCAGGGCTGTGAGATGG + Exonic
1157360998 18:47023542-47023564 CTGTGCTCAGGGCTGTGAGATGG + Exonic
1157361988 18:47029457-47029479 CTGTGCTCAGGGCTGTGAGATGG + Exonic
1157362866 18:47034879-47034901 CTGTGCTCAGGGCTGTGAGATGG + Exonic
1157473701 18:48008340-48008362 CGGGGGCCAGGGCTGGGGGTGGG + Intergenic
1157501989 18:48197406-48197428 GTGTGGAGAGGGCTGGAGCAGGG - Intronic
1157523227 18:48359781-48359803 CTGAGGCCAGGGCTCTGGGAGGG + Intronic
1157681177 18:49608214-49608236 CTGGGGCTAGGGCTGGGTGAGGG + Intergenic
1157747341 18:50147355-50147377 CTGTGGACAGGGCAGTGGCAGGG - Intronic
1157795780 18:50573631-50573653 CTGTGTACAGGGCTGGGTATGGG - Intronic
1157816148 18:50730641-50730663 GTGTGCACAGGCCTGGGAGAAGG - Exonic
1158348613 18:56541158-56541180 GTGGGAACAGGGCTGGGAGAGGG - Intergenic
1158427612 18:57353395-57353417 CTGCGGACAGGGCGCGGGGAGGG - Intronic
1159084139 18:63768806-63768828 CTGGGGCCAGGGCTGGAGGGAGG - Intronic
1159134138 18:64317194-64317216 CTGTTGTCAGGGGAGGGGGAGGG - Intergenic
1159282507 18:66305017-66305039 CTGTTAACAGGGCTGGAGGTAGG - Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159986634 18:74849515-74849537 GTGTGGTCAGGGGTGGGGGACGG + Intronic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1160843334 19:1156032-1156054 CGGTGGACGGAGCTTGGGGAGGG + Intronic
1160876833 19:1300358-1300380 CTGTGCCCTGGCCTGGGGGAGGG + Intergenic
1161009815 19:1954724-1954746 CTGAGGCTAGGGCTGGGGAAGGG + Intronic
1161039305 19:2101564-2101586 CTGTGGGCAGGGCGGGGCCAGGG - Exonic
1161080803 19:2309065-2309087 GTGAGGACAGGCCAGGGGGAAGG - Intronic
1161219571 19:3112276-3112298 CTGGGGGCAGGGCAAGGGGAGGG + Intronic
1161236467 19:3200817-3200839 CTGTGGACTGGCCTGTTGGACGG + Intronic
1161260837 19:3337009-3337031 CTGCCAACAGGGCTGGGGGTGGG + Intergenic
1161396682 19:4048245-4048267 CTGTGGACGGGGCACGGGGCGGG + Intronic
1161437586 19:4273034-4273056 CTGTCGGCAGGGATAGGGGAAGG - Intergenic
1161479988 19:4505638-4505660 CTGTGGACAGGGTGGGGCGTGGG - Intronic
1161583952 19:5095106-5095128 CTGTGGACAGGGATGGGGACGGG - Intronic
1161753428 19:6114129-6114151 CTCTGGCCAGGGCTGGGAGCGGG - Intronic
1161924732 19:7292457-7292479 CTGGGGGCGGGGCTGGGGGGGGG + Intronic
1161949627 19:7460554-7460576 CTGTTGCCAGGGTTGGGGCATGG - Intronic
1162110784 19:8398526-8398548 CTGGGGACAGGGGTGGTGGGAGG + Intronic
1162261622 19:9538851-9538873 CTGTGGGCAGGGCTACGGGCAGG + Intergenic
1162344539 19:10111622-10111644 CTGGGGATGGGGCTGGGGCAGGG + Exonic
1162345259 19:10114895-10114917 CTGTGGCCAGCGCTGTGGGTGGG - Exonic
1162463737 19:10829013-10829035 CTGCGGGCAGGGGTTGGGGAGGG - Intronic
1162479303 19:10919504-10919526 CCGTGGGCAGACCTGGGGGAAGG + Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162531118 19:11237005-11237027 CTGGGACCAGGGCTGGGGGCAGG - Intronic
1162550527 19:11355712-11355734 GAGGGGACCGGGCTGGGGGAGGG + Intronic
1162555713 19:11384255-11384277 CTGTGGACTGTGCCGGGGGCGGG - Exonic
1162935184 19:13978553-13978575 CTGCAGACAAGGGTGGGGGATGG - Intronic
1162967808 19:14164265-14164287 CTGTGCACAGGGGTGGGGGTGGG + Intronic
1163034403 19:14562829-14562851 CTGAGGCCGGGCCTGGGGGAAGG + Intronic
1163125766 19:15243392-15243414 CTGGTGACACGGCTGGGGGCCGG + Exonic
1163188286 19:15656074-15656096 CAGAGGCCAGGGGTGGGGGAGGG - Intronic
1163216535 19:15882305-15882327 CAGAGGCCAGGGCTGAGGGAGGG + Intronic
1163242946 19:16075645-16075667 CTGGGGACAGGGATGGGCGGAGG + Intronic
1163266909 19:16227230-16227252 CAGTGGACTTGGCTGGGGGATGG - Intronic
1163476039 19:17526812-17526834 CTGAGGTCAGTGCTGGGGCAGGG - Intronic
1163478800 19:17542454-17542476 TGGTGGACAGAGCTGGGGCAGGG + Intronic
1163695186 19:18760332-18760354 TGGGGGACAGGGCTGGGGGGCGG + Intronic
1163768033 19:19174191-19174213 CTGTGGACGGAGCAGGGGGCAGG + Intronic
1164211160 19:23098499-23098521 CTGTGGACAGGGCTGAGGCAGGG - Intronic
1164310280 19:24040107-24040129 GTCTGGATAGGGCTGGGGCAGGG - Intronic
1164520732 19:28977168-28977190 CGGTGGACAGGCCAGCGGGACGG - Intergenic
1164652008 19:29897588-29897610 CTGTGGCCAGGTGTTGGGGAGGG - Intergenic
1164706921 19:30326547-30326569 CTGAGGAGAGGGCCAGGGGATGG + Intronic
1164823478 19:31267468-31267490 CTGGGGACACGGGTAGGGGAAGG - Intergenic
1164825268 19:31280460-31280482 TGGGGGACAGGGCTGGGGGCTGG - Intronic
1165060145 19:33201205-33201227 CTGTGGCCGAGGCTGGGGGGAGG + Intronic
1165127838 19:33613254-33613276 CTGAGGACAGGGACGGGGGACGG + Intergenic
1165351701 19:35279307-35279329 CTGTGCTAAGGGCTGGGGAAGGG - Exonic
1165394753 19:35558164-35558186 CTGTGGGCGGGGCTGGGTGGTGG + Intronic
1165723395 19:38095634-38095656 CTGGGGACAGGGCAGGGGCAGGG + Intronic
1165740389 19:38201921-38201943 CTGTGGACAGGACTGTGTGCAGG - Exonic
1165900715 19:39168039-39168061 GGGTGGTCAGGGCTGGGGGACGG - Intronic
1165930745 19:39356861-39356883 CTGGGGCCAGGGTCGGGGGACGG - Exonic
1166198128 19:41219738-41219760 CTGAGGGCAGGGGTGGGGGCTGG + Intronic
1166343113 19:42150418-42150440 GGGTGGAGAGGGCTGGGGGAGGG + Intronic
1166774289 19:45302984-45303006 TTGGGGACAGGGCAGGGGCAGGG + Exonic
1166806896 19:45492914-45492936 CTGGGGCCGAGGCTGGGGGAGGG + Intronic
1166892459 19:46001740-46001762 CTGTGGATGGGCCTGGGGGGTGG + Intronic
1166981467 19:46634479-46634501 CTGGGAACAGGGCTGGGCAAGGG - Intronic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
1167278816 19:48554431-48554453 CAGGGGACAGGGGTGGGGGTTGG - Intronic
1167763160 19:51462035-51462057 GTGTGGACAGTGCTGTGGGAGGG - Intergenic
924977506 2:191678-191700 CTGTGCACAGTGCTGGTGGGAGG - Intergenic
925018866 2:553201-553223 GTATGGGCAGGGCTGAGGGAGGG + Intergenic
925071940 2:976721-976743 CAGAGGACAGGGCTGGGGAGTGG - Intronic
925180781 2:1815685-1815707 CTGGGGGCAGGGCATGGGGAAGG - Intronic
925411743 2:3643573-3643595 CTCAGGACAGGGCTGGGAGGTGG - Intronic
925445599 2:3924104-3924126 CCATGGACTGGGGTGGGGGATGG + Intergenic
925750961 2:7090290-7090312 CTGAGGAAAGGCCTGGGGCAGGG + Intergenic
925868950 2:8252854-8252876 CTGAGGAGAGGCCTAGGGGAAGG - Intergenic
926120343 2:10238208-10238230 GTGTGGACAGCACTGGGGGTTGG + Intergenic
926224884 2:10960769-10960791 CTGCAGGCAGGGCTGGGTGAGGG + Intergenic
926703502 2:15819885-15819907 CTGTGGCTGGGGCTGTGGGAGGG + Intergenic
927154475 2:20213607-20213629 GGGCAGACAGGGCTGGGGGAGGG - Intronic
927553581 2:24017968-24017990 ACCTGGTCAGGGCTGGGGGAGGG - Intronic
927719134 2:25372083-25372105 CTGTAGACCGGGCTGGGGTAAGG + Intergenic
927767286 2:25822447-25822469 TTGTGAACAGGGCAGGGGGACGG - Intronic
927857715 2:26537673-26537695 CTGGGCTCAGGGCTGAGGGAGGG + Intronic
927966560 2:27273661-27273683 CTGTGGTCAGTGCAGGGAGAGGG - Intronic
928103666 2:28453766-28453788 CTGTGGACAGAGGTGGGCCAGGG + Intergenic
929456958 2:42072950-42072972 CTGGGCTCAGGGGTGGGGGAGGG - Intergenic
929558879 2:42943249-42943271 CTTGGGACAAGGCTGGGGCAAGG + Intergenic
930392059 2:50773706-50773728 GTTGGGACAGGGTTGGGGGATGG + Intronic
930748203 2:54906387-54906409 CTGTGGAGGGGCCTGGGGGAAGG + Intronic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932319282 2:70809215-70809237 ATGAGGACAGGGCTGGGAGAAGG + Exonic
932343653 2:70982142-70982164 CTAGGGAAAAGGCTGGGGGAGGG - Intronic
932420725 2:71599798-71599820 TGGTGAACAGGGGTGGGGGAAGG + Intronic
932619439 2:73257138-73257160 CTGAGGACAGGGCTGGTGCAGGG + Exonic
932625988 2:73296146-73296168 CTGGGGGCAGGGCTCGGGGGTGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933209091 2:79545298-79545320 CTATGGACAGGGAGTGGGGAAGG - Intronic
933271768 2:80240425-80240447 CTGTGGAGATGGCTGGAGGCAGG - Intronic
934299728 2:91769766-91769788 CTGTGGATTGGGGTGGGGCAGGG + Intergenic
934558917 2:95302177-95302199 CCGTGGACAGGGTGGGGGGTGGG + Intronic
934560466 2:95310538-95310560 CTGTGGTCAAGGGTGGGGGTGGG + Intronic
934574777 2:95392944-95392966 CTGGGGAAAGGGGTGAGGGATGG + Intergenic
934926266 2:98383600-98383622 CTGTGGACAGAAGTCGGGGAGGG + Intronic
934950128 2:98570474-98570496 CTGTGGTGAGGGCTGGGCCAGGG + Intronic
935080409 2:99787516-99787538 CTGTGGCAAGGGCTGGGAGCTGG - Intronic
935112936 2:100108519-100108541 CAGTGGACAGGCTGGGGGGAGGG - Intronic
935208954 2:100922118-100922140 CTGTGGCTATGGCTGGGGGTGGG + Intronic
935318585 2:101862282-101862304 CTGAGGCCAGGGCTGTGTGAGGG + Intronic
935621756 2:105136054-105136076 CTGTGGCCAGGGGTTAGGGAAGG - Intergenic
935757336 2:106286511-106286533 GTGTGGCCAGGGCCGGGGGTGGG + Intergenic
936064205 2:109318323-109318345 CTGGGGACCGGGCTGGGGGCCGG - Intronic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
937054217 2:118918027-118918049 CTGTGGCCAGGGGTGGTAGAAGG - Intergenic
937269229 2:120637379-120637401 CTGGGAACAGGGCTGAGTGATGG - Intergenic
937303702 2:120858358-120858380 CTATGGACATGGCGGGGGCATGG - Intronic
937345155 2:121120963-121120985 CTGTGGGGAGAACTGGGGGAGGG - Intergenic
937413685 2:121697699-121697721 CTGTGGACAGGGAGAGGGCAGGG + Intergenic
937868627 2:126771960-126771982 CTCTGGAAAGGGCTGAGGGTCGG + Intergenic
937912856 2:127084498-127084520 CTGATGCCAGGGCTGGGGCAGGG - Intronic
938207710 2:129438310-129438332 CTGAGGCCAGGTCTGGGGCATGG - Intergenic
938770880 2:134499691-134499713 CAAGGGACAGGGCTGGGGAAGGG + Intronic
938940324 2:136164147-136164169 GGGTGGACAGGGTGGGGGGATGG - Intergenic
939630795 2:144524323-144524345 GCGGGGACAGGTCTGGGGGAGGG - Intronic
939800297 2:146699727-146699749 CTGCTGCCAGGGGTGGGGGAAGG - Intergenic
940693981 2:156956077-156956099 CTCTGCAGAGGGATGGGGGATGG + Intergenic
940739307 2:157488992-157489014 CCCTGCACAGAGCTGGGGGAGGG + Intergenic
940889279 2:159019213-159019235 AGGTGCACTGGGCTGGGGGAGGG + Intronic
941089643 2:161160246-161160268 GGCTGGGCAGGGCTGGGGGAGGG + Intronic
941169077 2:162115961-162115983 CTTTGGACAGGGCACAGGGAGGG + Intergenic
941941348 2:171041669-171041691 CTGGGGTGGGGGCTGGGGGATGG - Intronic
942223667 2:173795857-173795879 CTCAGGACAGGTCTGGAGGAAGG - Intergenic
942459504 2:176159569-176159591 GTGTGGCCCCGGCTGGGGGAGGG + Intronic
942604876 2:177679968-177679990 CTGGGGAGAGGGCTGCAGGAAGG + Intronic
942946410 2:181679077-181679099 GTGAGGACAGGACTGGGGGAGGG + Intronic
942970832 2:181956046-181956068 CTGTGGGCAGGGGTGGCGGCGGG - Intronic
943761253 2:191611892-191611914 GTGTGCACAGGGATGGCGGATGG + Intergenic
943853190 2:192754886-192754908 CCATGGACAGGGCAGGCGGATGG - Intergenic
945644681 2:212475936-212475958 GTGGGGAAAGGACTGGGGGAAGG - Intronic
945853164 2:215034411-215034433 GTGTGGAGAGGAATGGGGGAAGG + Intronic
946146395 2:217734416-217734438 CTGTGGTCAGGGTTGAGAGAGGG - Intronic
946149245 2:217753111-217753133 TCTTGGACAGGGCTGGGGGTGGG - Intronic
946150387 2:217762182-217762204 CCATGGACAAGGGTGGGGGATGG + Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946201025 2:218070876-218070898 CTGGGGAGAGGGATGGGGAAGGG - Intronic
946374584 2:219300287-219300309 CTCTGGACAGTGCTGGGGGAAGG + Intronic
946382466 2:219358481-219358503 CTGGGGAGGCGGCTGGGGGAGGG - Intergenic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
946765692 2:223037946-223037968 CCGTAAACATGGCTGGGGGAGGG - Intergenic
947009285 2:225547666-225547688 ATGTGGCCACTGCTGGGGGATGG + Intronic
947633130 2:231666422-231666444 CTGAGGACAAGGCAGGGAGAGGG - Intergenic
947793558 2:232880836-232880858 CTGAGGCCAGGGCCAGGGGAGGG + Intronic
948014865 2:234680256-234680278 CTGTGAACTTGGCTGGGGCATGG - Intergenic
948287294 2:236795748-236795770 TGGTGGACAGGGCTGGGCTAAGG + Intergenic
948398448 2:237664321-237664343 CTGTGGACAGGCCAGGCGGCAGG - Intronic
948465560 2:238150154-238150176 CAGTGGCCTGGGCTGGAGGAAGG - Intronic
948722725 2:239911738-239911760 CTGGGGGATGGGCTGGGGGAAGG - Intronic
948768063 2:240233552-240233574 TTGTGGGCAGGGCTGTGGGGAGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948946684 2:241224074-241224096 CTGGGGAGAGGGTTGGGGGCAGG - Intronic
949006972 2:241655215-241655237 CAGAGGTCAGGGCTGGGGGCGGG + Intronic
949008869 2:241667243-241667265 GTGTGGGCAGGGCCTGGGGATGG + Intronic
949055230 2:241924487-241924509 CTGTGGGAAGGGCTGGGGCCAGG + Intergenic
1168772991 20:428014-428036 GCGGGGACAGGCCTGGGGGAAGG - Intronic
1168836568 20:881561-881583 CAGAGGACAGGGCATGGGGAGGG + Intronic
1169039576 20:2482038-2482060 CTGTGGGCAGGGCTTGTGGGTGG - Exonic
1169145864 20:3252004-3252026 CTGTGGACTGGGCCTGGGCAAGG + Exonic
1169200677 20:3707753-3707775 ATGGGGACAGAGCTGGGGGCAGG - Intergenic
1169321205 20:4634655-4634677 CTGTGGACAGGGCCGCAGCAGGG - Intergenic
1169901758 20:10560235-10560257 CTGTAGACAGGGATGGGGCCAGG - Intronic
1169916290 20:10686944-10686966 CTGGGGGCAGAGCTGGGGGCGGG - Intergenic
1170155025 20:13261619-13261641 CTGTGGAAAGGACTGGGGCCAGG - Intronic
1170319313 20:15077917-15077939 CTTTGAGCTGGGCTGGGGGAGGG + Intronic
1170615252 20:17943505-17943527 CTGGGAACAGGGCTGGAGTATGG + Intronic
1171211023 20:23316972-23316994 CTGTGGACAGGGTCTGGGCAAGG - Intergenic
1171310973 20:24144295-24144317 CTGTGGACACTGCTGGCTGAGGG - Intergenic
1171392218 20:24808959-24808981 CTGGGGACAGGGTGGGGTGAGGG + Intergenic
1171959811 20:31485549-31485571 CTGGGGTCAGGGCTGGGTGTTGG + Intergenic
1172029760 20:31973630-31973652 CTGTGTAGAGGTCTTGGGGAGGG + Intronic
1172119551 20:32589720-32589742 CTGTGGTCAGAGCTGGGAGGGGG - Intronic
1172569546 20:35958781-35958803 CTGTGGTTAGGGATAGGGGAAGG - Intronic
1172662040 20:36574426-36574448 CTGGGCGCAGGGCTGGGGGGGGG + Intronic
1172874246 20:38154735-38154757 TTGGGGGGAGGGCTGGGGGAGGG - Intronic
1173147151 20:40534741-40534763 CTGAGGACAGGACTGGGGAGGGG - Intergenic
1173257303 20:41403826-41403848 CTGTCGACGGGGGTGGGGCAAGG - Exonic
1173366800 20:42393175-42393197 CAGGGGAGAAGGCTGGGGGAAGG + Intronic
1173590117 20:44218178-44218200 CTGTGGATGGGGCTGGAGGTGGG + Intergenic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1174055339 20:47794648-47794670 CTGTGGACAGTGTCTGGGGAGGG + Intergenic
1174789246 20:53462511-53462533 CTGAAGCCAGGGCTGGGGCAGGG - Intronic
1175147102 20:56905162-56905184 GTGTAGCCAGGGCTGGGGAAGGG - Intergenic
1175311433 20:58014430-58014452 CTGAGGTCAGGGCATGGGGATGG + Intergenic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175828852 20:61951157-61951179 GGGTGCCCAGGGCTGGGGGAGGG - Intergenic
1175846619 20:62063193-62063215 CTCTGGACAGGGCAGGGGTGGGG - Intronic
1175874795 20:62224254-62224276 CAGTGGCCAGGGCTCAGGGAAGG + Intergenic
1175917837 20:62435269-62435291 GTGTCGCCAGGGCTGAGGGAGGG - Intergenic
1176108407 20:63400092-63400114 CTGTGGACCGGGTGTGGGGACGG - Intergenic
1176182578 20:63757911-63757933 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182587 20:63757942-63757964 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182647 20:63758154-63758176 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176198376 20:63848234-63848256 CTGTGGACACTGCTGGCTGAGGG - Intergenic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176719525 21:10381683-10381705 CTGTGCACAGGGCCAGAGGAAGG + Intergenic
1177681121 21:24372766-24372788 TGGTTGCCAGGGCTGGGGGAAGG + Intergenic
1178940582 21:36901963-36901985 CTGTGGACAGCAGTGGGGGGCGG + Intronic
1178983452 21:37283905-37283927 CCATGGACAGGGCAGGGGAATGG - Intergenic
1179050811 21:37887292-37887314 ATGAGGATGGGGCTGGGGGAGGG - Intronic
1179167487 21:38946042-38946064 CTGAGGACTGGGCTCGTGGACGG - Intergenic
1179275140 21:39885385-39885407 CTGTGGTCAGAGCAGAGGGAGGG - Intronic
1179437673 21:41373531-41373553 CTGTGGACAGAGCAGCTGGAGGG - Intronic
1179524565 21:41967332-41967354 TAGGGGACAGGTCTGGGGGATGG - Intergenic
1179635947 21:42709296-42709318 CTGTTGGGAGGGTTGGGGGAGGG + Intronic
1179726508 21:43344140-43344162 GTGTGGGCAGGGCTGGAGGGGGG + Intergenic
1179727082 21:43346706-43346728 CACTGAACAGGGCTGGGAGATGG + Intergenic
1179810074 21:43864895-43864917 CTGGGGCCCGGGCTGGGGGAGGG - Intergenic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1179925911 21:44533943-44533965 CTCAGGACGGGGCTGGGGGTAGG + Intronic
1180019465 21:45112471-45112493 CTGGGGCCAGGGCTTGGGGTCGG + Intronic
1180044880 21:45300769-45300791 CGCTGCACAGCGCTGGGGGAGGG + Intergenic
1180060858 21:45384144-45384166 CTGGGGGCAGGGCCGGGGGGTGG + Intergenic
1180300758 22:11034657-11034679 CTGTGCACAGGGCCAGAGGAAGG + Intergenic
1180698692 22:17770125-17770147 CTGGGGTCAGGGCTGGGGTGGGG - Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1180996017 22:19965710-19965732 GTGTGGAGAGGGCTGTGGGGAGG + Intronic
1181085964 22:20439472-20439494 CCCTGGACAGGTCTGGGGGAAGG - Intronic
1181442918 22:22946886-22946908 GTGTAAACAGGGCTGGGGGCGGG - Intergenic
1181529985 22:23511888-23511910 CTGTGGACAGGGCTGCAGATGGG + Intergenic
1181556266 22:23673427-23673449 CTGTGGATTGGGGTGGGGCAGGG - Intergenic
1181697916 22:24603118-24603140 CTGGGGGCGGGGCGGGGGGAGGG - Intronic
1181698083 22:24603862-24603884 CTGTGGATTGGGGTGGGGCAGGG + Intronic
1181813839 22:25421635-25421657 GAGAGGACAGGGCTGGGGGAGGG - Intergenic
1181861011 22:25818163-25818185 CTCTGGAGTGGGCTGGGGGCAGG + Intronic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182129073 22:27837580-27837602 CTGTTGCTAGGCCTGGGGGAGGG + Intergenic
1182423131 22:30258057-30258079 CTGAGGGCTGGGCTCGGGGAGGG - Intergenic
1182557954 22:31139235-31139257 TTGTGTGCAGGGTTGGGGGAGGG - Intronic
1182878809 22:33715536-33715558 CTGTAGACAGTACTAGGGGATGG - Intronic
1183272388 22:36870322-36870344 CTGATGTCAGGGCTCGGGGACGG + Intronic
1183329501 22:37211883-37211905 CTGGGGACTGGGCAGGGAGAGGG - Exonic
1183369194 22:37423010-37423032 TTGTGGAAAGGGCAGGGGCAGGG - Intronic
1183380917 22:37490120-37490142 CTGTGGGCAGGGCTGAGCGTTGG + Intergenic
1183507241 22:38215885-38215907 GTGTGGACAGTGTTGGGGGAGGG - Exonic
1183830892 22:40417895-40417917 CTGTGGCCTGGGCTGAGAGAGGG + Intronic
1183931757 22:41239524-41239546 CTGTGGGCAGCGCTGGGCGGCGG + Exonic
1184022347 22:41829211-41829233 CTGAGGACAGTGATGGGGAAGGG - Intergenic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184240120 22:43207444-43207466 CAGGGGCCAGGGCTGGGGCAGGG + Intronic
1184288931 22:43487894-43487916 CTGTGGGCAGGGCGGTGGGGCGG + Intronic
1184552178 22:45210348-45210370 CTCTGCACAGTTCTGGGGGAGGG - Intronic
1184592433 22:45494045-45494067 CTGTGTACAGGTCTAGAGGAAGG - Intergenic
1184596552 22:45517456-45517478 CTGTAGCCTGGGCTGGGGCATGG + Intronic
1184642252 22:45878928-45878950 CTGTGGAATGGGCCGGGGCAGGG + Intergenic
1184679819 22:46064470-46064492 GTGTGGACCGGGCTGGGGTTTGG - Intronic
1184799615 22:46751693-46751715 CTGGCAACAGAGCTGGGGGAAGG + Intergenic
1184883447 22:47327059-47327081 CTGCAGACCGGGGTGGGGGATGG + Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185080485 22:48707050-48707072 CCTTGGACAGGGCAGGGGGCAGG - Intronic
1185249092 22:49790172-49790194 CTGTGGTCCCGGCTGGGGGAGGG - Intronic
1185318654 22:50190223-50190245 CAGGGGCCAGGGCTGGGGGCTGG + Intronic
1185324185 22:50217639-50217661 CTGAGGACAGGGCAGGGTGGGGG - Intergenic
1185392272 22:50569016-50569038 CTGTGGTCTGAGCTGGGGGAGGG + Exonic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
950167959 3:10815990-10816012 CAGTGGGCAGGGCCGCGGGAAGG + Intergenic
950448441 3:13051982-13052004 CTCTGGAAAAGGCTAGGGGAGGG - Intronic
950454874 3:13086699-13086721 CTGTGCAGAGAGCTGAGGGAGGG - Intergenic
950469805 3:13177566-13177588 CTGTCCACAGGGATGGGGAATGG - Intergenic
950625735 3:14245345-14245367 CTGGGGACGGGGGTGGAGGAGGG - Intergenic
950629101 3:14269777-14269799 CTAGGGATAGGGTTGGGGGAAGG - Intergenic
950656206 3:14438461-14438483 CTGTGGAAAGGGCGGGGCAAGGG + Intronic
951688520 3:25371311-25371333 ATGTGGACAAGGCTTGGGGGAGG + Intronic
952386683 3:32846645-32846667 CTGGGGACAGGGGTGGGTGCAGG - Intronic
952534840 3:34298371-34298393 TTGTGGGCAGGGGTGAGGGAAGG - Intergenic
952706136 3:36380225-36380247 CCCTGGAAAGGGCTGGGGGAAGG - Intergenic
953038750 3:39236558-39236580 CTGGGGACAGGGATGGGAGGAGG - Intergenic
953100367 3:39819713-39819735 AGGTGGACATGGTTGGGGGATGG + Intronic
953129098 3:40120934-40120956 CAGTTGTCAGGACTGGGGGATGG - Intronic
953166114 3:40466246-40466268 GTGTGGATTGGGTTGGGGGATGG + Intergenic
953187808 3:40654608-40654630 CTGTGGGGAGAGCTGGGGAAAGG + Intergenic
953329821 3:42043501-42043523 CTGCTCACAGGGCTGGGGGTAGG - Intronic
953751327 3:45610630-45610652 CTGTTGGCAGAGCTGGGGGGTGG - Intronic
953915070 3:46913892-46913914 CTGTGGACAGGGTTGGAGCCAGG + Intergenic
954153716 3:48673155-48673177 CAGAGGCCAGGGCTGGGGGTAGG + Intergenic
954303665 3:49714370-49714392 CTGTGGGCAAGGCTGGGGAGGGG - Intronic
954636378 3:52073109-52073131 CTGAGGGCAGAGCTGGGGGTGGG - Intergenic
955060295 3:55487465-55487487 CTGTGGCCCGGGGCGGGGGAAGG + Exonic
955140908 3:56268833-56268855 GTGTGGAAAGGTCTGGGAGAAGG - Intronic
955479140 3:59371515-59371537 CTTTGGAGAGGGGTGGGGAATGG - Intergenic
955681950 3:61511604-61511626 CTGTGGACAGCTCTGGGAGGGGG + Intergenic
955947057 3:64205493-64205515 CTGGGGACAGGGTTGGTGGCAGG + Intronic
956724504 3:72145940-72145962 CAGTGGGCAGGGCTGAGGGATGG + Intergenic
957507296 3:81138711-81138733 CTATGTACAGTGCTGGGGAATGG - Intergenic
957827050 3:85461231-85461253 GTGTTGAGATGGCTGGGGGAGGG - Intronic
959181652 3:102987685-102987707 CCACGGACAGGGGTGGGGGATGG + Intergenic
960054979 3:113270778-113270800 CTGTGGAAAGGGCAGGGCCAGGG - Intronic
960173523 3:114490878-114490900 GTGAGGACAGGGCAGAGGGAAGG + Intronic
960964417 3:123094871-123094893 ATGGGGACAGGGCTTGGGGTTGG + Intronic
961026641 3:123564229-123564251 CAGTGGACAGGGCTGGAGTCTGG + Intronic
961146603 3:124599029-124599051 CTGGGGACAGGGGTGGGGTGGGG + Intronic
961213783 3:125144451-125144473 CTGTGGGCTGGGCTGGGGCCAGG - Intronic
961314355 3:126024410-126024432 CTGTGGACCAGGCTGGGTCATGG + Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961531321 3:127542155-127542177 CTCTGGTCAGGGCTGTGGAAGGG - Intergenic
961658659 3:128456992-128457014 CCCTGGAGGGGGCTGGGGGAGGG - Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
961873390 3:130003549-130003571 CTGTGGACCGGGCGTGGTGATGG + Intergenic
962110770 3:132444219-132444241 CCATGGACAGGGCAGGGGGATGG - Intronic
962249840 3:133829163-133829185 CTGAGGCCAGGGCTGGGAGCTGG - Intronic
962270075 3:133971124-133971146 CTGTGGCCAGGCCGAGGGGAGGG - Intronic
962865796 3:139447266-139447288 CTCTGGAGATTGCTGGGGGAAGG + Intergenic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
963054806 3:141177434-141177456 CTGGGGGCAGGGTTGGGTGAAGG - Intergenic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
963088024 3:141456236-141456258 CTGTGGATGGGGCTGGGGTAGGG - Intergenic
963935044 3:151043577-151043599 CACTGCACAGGGTTGGGGGATGG + Intergenic
964443729 3:156739080-156739102 GTGTGGACAAGTCTGGAGGATGG - Intergenic
965627046 3:170691692-170691714 GTGTGGACAGGGCTTGGATAGGG - Intronic
966834750 3:184040554-184040576 TTGTGGACATGCCTGGAGGACGG - Intergenic
966861933 3:184235324-184235346 GTGTGGGCAGGCCTGGGGGTTGG + Intronic
966878154 3:184335289-184335311 CTGTTGCCTGGGCAGGGGGAAGG + Exonic
968337843 3:197928979-197929001 CTGGCCACAGGGCTGGGGAAGGG - Intronic
968555513 4:1244695-1244717 ATGGGGACAGGGCAGGGTGAGGG - Intronic
968615826 4:1577342-1577364 CTGTGCTCAGGGCTCAGGGATGG + Intergenic
968622701 4:1610897-1610919 CTGCGGACAGGGCTGGTCCAGGG - Intergenic
968642715 4:1722341-1722363 CTGGGTACAGGGCAGGGGAAGGG - Intronic
968703340 4:2066904-2066926 CTGGGGCCAGAGCTGGGCGAAGG + Exonic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
968945529 4:3661573-3661595 CTGAGGACAAGGCTGGTGGTGGG - Intergenic
968975830 4:3821638-3821660 CTGTGGGCAGGTCTGGCTGATGG + Intergenic
969088136 4:4671689-4671711 CTGTCAACTGGGCTGGGAGAGGG + Intergenic
969121319 4:4913485-4913507 CTGAGGACAGGCCCTGGGGAAGG + Intergenic
969172760 4:5377031-5377053 CTGTGGGGAGAGCTGGGGGCAGG - Intronic
969345394 4:6566769-6566791 TTGTGGCTAGGGTTGGGGGAGGG - Intergenic
969398755 4:6939731-6939753 CTGAGGAGAGGGGTGGGGGTGGG + Intronic
969493223 4:7511677-7511699 GTGGGGACAGGGCTGGGTGAAGG + Intronic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969511369 4:7619929-7619951 CTGGGGACAGGGCAGGGGCAGGG - Intronic
969570008 4:8002668-8002690 CTGTAGACAGGTCTGGAGGCAGG - Intronic
969572643 4:8018886-8018908 CTGTGGAAAGGGCGGGGTGGAGG + Intronic
969597337 4:8156890-8156912 CTGGGGACAGGGCTGGGCAGGGG + Intronic
969660850 4:8526603-8526625 CTGAGGCCTGGGCTGCGGGAGGG - Intergenic
969703816 4:8781550-8781572 TTGTGGATGGGGCTGGCGGAAGG - Intergenic
969796477 4:9531865-9531887 CTGTGGACCGGGCGTGGTGATGG - Intergenic
969998182 4:11336519-11336541 CTGTGGATAGAATTGGGGGAGGG - Intergenic
970199175 4:13585120-13585142 TTTTGGACAGGGCAGGGTGAGGG + Intronic
971191889 4:24436415-24436437 CTGTGACCAGGGCTATGGGATGG - Intergenic
972817061 4:42656661-42656683 CTGGGGGCAGCGCGGGGGGAAGG + Intronic
975332910 4:73139614-73139636 CAGTTGGCAGGGCTGGGGCAAGG - Exonic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
981005546 4:139871425-139871447 CTGTGGGCAGGGGTGGGGACAGG - Intronic
981015735 4:139972214-139972236 TTGTGGAGAGTGGTGGGGGAAGG - Intronic
983923381 4:173370997-173371019 CAGTGGACAGTGCTGAGGGCCGG - Exonic
984806789 4:183758540-183758562 CTGGGGACGGGGCGTGGGGAAGG + Intergenic
985034615 4:185825683-185825705 CTGTGCACAGGCCTGTGGGAGGG + Intronic
985404999 4:189629047-189629069 CAGGGGAGAGGGATGGGGGAAGG + Intergenic
985595181 5:784759-784781 CTGGGGGCGGGGCTGGGGGCGGG - Intergenic
985697128 5:1346924-1346946 CTCTCAACAGGGCAGGGGGACGG - Intergenic
986301493 5:6481673-6481695 ATGTGGGCAAGGCTGGGGGAAGG - Intronic
986733941 5:10654311-10654333 CTGTGCACAGGGGTGGGGCTCGG + Intergenic
987955249 5:24730211-24730233 TTGTTGAAAGGGCGGGGGGAGGG + Intergenic
989137194 5:38167213-38167235 CTGTGGTGAGGCCTGGGGGAGGG + Intergenic
989149247 5:38282483-38282505 CTGTGGGGAGGGCTGTGGGAAGG + Intronic
990252656 5:53932368-53932390 CTGTTGGCAGGGCTAGGGGCTGG - Intronic
991647400 5:68815036-68815058 CTGTGGCCTTGGCAGGGGGAGGG - Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992095359 5:73357804-73357826 CAGTGGACGGGCCTGGGGGTTGG - Intergenic
992223586 5:74596928-74596950 CTGTGTTCAGGGCTTTGGGAAGG - Intergenic
992418055 5:76572018-76572040 CAGGGAACAGGGCTGGGGGAGGG - Intronic
993110141 5:83646693-83646715 CTGTGGTGAGGGGTGAGGGAAGG + Intronic
993216306 5:85027127-85027149 AAGTGGACATGGCTGGGTGAAGG + Intergenic
993970839 5:94418465-94418487 GTGGGGGCAGGGGTGGGGGAGGG - Intronic
995523394 5:113031682-113031704 GTGTGGATAGGAGTGGGGGAGGG - Intronic
997498932 5:134355967-134355989 CTATGGACCAGGCTGGGGGATGG + Intronic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998462058 5:142317127-142317149 CTGTGGTCAGGGCTGGAGAGAGG + Intronic
999010596 5:148034425-148034447 CTGTGGACAAGGGTTGGGGGGGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999153698 5:149442995-149443017 CTGTGGCCAGCTCTGGGGAATGG + Intergenic
999232238 5:150068538-150068560 CTCTGGACAGGGTTTGGGGCTGG - Intronic
999241981 5:150133084-150133106 CTGGGGACAGGGCCTGGAGAAGG + Intronic
1000055484 5:157602521-157602543 CTGTGGCAAGGGGTGGGAGACGG + Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001269896 5:170303103-170303125 CTGTGTCCAGGCCTGGGGGCAGG - Intergenic
1001318860 5:170663873-170663895 GTGTACACAGGGCTGGAGGAGGG - Intronic
1001523713 5:172414012-172414034 CTGAGGACAGGTCTAGGGGATGG - Intronic
1001629005 5:173160644-173160666 GTGTCGGCAGGGCTGGGTGAGGG + Intronic
1001751395 5:174134220-174134242 GTGAGGACAGGACAGGGGGATGG + Intronic
1001939347 5:175729587-175729609 CGGTGGGCGGGGCTGGGGAAAGG - Intergenic
1001959763 5:175872692-175872714 GTGGGGACGGGGCGGGGGGAGGG + Intronic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002194528 5:177494882-177494904 CTGGGGTCAGGGGAGGGGGAGGG + Intronic
1002303984 5:178272817-178272839 GTGGGGTCAGGCCTGGGGGAAGG - Intronic
1002305974 5:178283221-178283243 CAGAGGCGAGGGCTGGGGGATGG - Intronic
1002518526 5:179776703-179776725 CCGGGGACAGGGGTGGGAGACGG - Exonic
1002562235 5:180090382-180090404 CTGAGGCCAGACCTGGGGGAGGG + Intergenic
1002587142 5:180256385-180256407 ATGTGGGCAGGGGTGGGGCAGGG + Intronic
1002684402 5:180996688-180996710 TTGTGGTCAGGTCTGGGAGAGGG - Intronic
1002712727 5:181204871-181204893 CTGCGGACAGGGCAGTGGGAAGG + Exonic
1002785133 6:394095-394117 CTGTGGGCAGAGCAGGGGAAGGG + Intronic
1002786326 6:403170-403192 CCCTGGCCAGGGCTTGGGGATGG - Intronic
1004074732 6:12334623-12334645 CTGTGGCCAGAGCTGAGGGGAGG - Intergenic
1004455531 6:15788315-15788337 CTGTGGACAGTGACGGGGGCTGG - Intergenic
1005037539 6:21570406-21570428 ATGTGGCCACTGCTGGGGGATGG + Intergenic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005582645 6:27249101-27249123 CTGGGGCCAAGGCTGCGGGATGG - Exonic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006088794 6:31615758-31615780 GTGGAGACAGGGCTGGGGGTAGG + Intronic
1006334875 6:33415250-33415272 CTCTGGTTAGGGCTGGGGGATGG - Exonic
1006372997 6:33656878-33656900 CTGTGGACTGGGCTGGAGAGAGG + Intronic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1006503972 6:34476402-34476424 GTGTGGGGAGGGCTGGGGAAGGG - Intronic
1006504085 6:34476771-34476793 CCCTGGACAGGGCCGGGGGCGGG + Intronic
1007089993 6:39178038-39178060 CTGGGGACTGGGGTTGGGGAAGG + Intergenic
1007207347 6:40163588-40163610 CTGTGACCAGGTCTTGGGGATGG - Intergenic
1007225620 6:40311740-40311762 TTGTGGCAAGGGCTGTGGGAGGG - Intergenic
1007315342 6:40983787-40983809 CTCTGGACTGGGATGGGGGCAGG - Intergenic
1007726214 6:43917406-43917428 CTGGGGACCGGGCAGGGGGTGGG - Intergenic
1007738583 6:43997578-43997600 CTTTGGACTAGGCTGGGGGTGGG - Intergenic
1007961115 6:45960493-45960515 CTGTGGTGTGGGCTGGGGGTGGG + Intronic
1008227424 6:48937188-48937210 CTGTGGCCACTTCTGGGGGATGG + Intergenic
1008565258 6:52761956-52761978 GTGAGCACAGGGCTGGGGGTAGG - Intronic
1008630433 6:53359182-53359204 CTGCGGTCAAGACTGGGGGAAGG - Intergenic
1008657531 6:53631002-53631024 TGGTGGACAGGGCTGTAGGAAGG - Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009985677 6:70778908-70778930 CAGTGGACAGGACTGAGGAATGG - Intronic
1010928210 6:81769188-81769210 CTTTGGGCAGAGCTGAGGGAGGG - Intergenic
1011277150 6:85642729-85642751 TTGTGGAGTGAGCTGGGGGAGGG - Intronic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1013486889 6:110605875-110605897 CAGAGGACAAGGCTGGAGGAAGG + Intergenic
1014418290 6:121211142-121211164 CTGTGGGCGGGGCGGAGGGAGGG + Intronic
1015707494 6:136104035-136104057 CTGAGGACAGGGCTCCGGAATGG - Intronic
1015798254 6:137034558-137034580 CTGTGAGGAGTGCTGGGGGAGGG - Intronic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1016995952 6:149962693-149962715 CCATGTACAGGGCTGGGGGCAGG - Intergenic
1017005333 6:150025022-150025044 CTGGGGTCAGGACTGGGTGAAGG - Intronic
1017012230 6:150070477-150070499 CCATGTACAGGGCTGGGGGCAGG + Intergenic
1017131119 6:151108974-151108996 CTGAGGCCAGCCCTGGGGGATGG + Intergenic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018191016 6:161308990-161309012 CTGAGGACTGGGCTGGGCCATGG - Intergenic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1018613633 6:165664432-165664454 CTGTGGACTTTACTGGGGGAGGG - Intronic
1018733863 6:166673021-166673043 CTCTGGGGAGGGCTGGGAGAGGG - Intronic
1019101381 6:169633270-169633292 AGGTGGACGGGGGTGGGGGAGGG + Intronic
1019101638 6:169635420-169635442 CTGAAGACAAGGCTGAGGGAGGG + Intronic
1019147646 6:169985283-169985305 CTGTGGAGAGGCCAGGGTGAGGG + Intergenic
1019257522 7:61660-61682 CAGTGGAAAGGACTCGGGGACGG - Intergenic
1019358684 7:594107-594129 CTGGGGAGAGTCCTGGGGGATGG - Intronic
1019494596 7:1331958-1331980 CTGGGGACCTGGCTGGGGGCAGG - Intergenic
1019502256 7:1370121-1370143 CTTTGGACAGGGCAGTGGGGAGG + Intergenic
1019575930 7:1737650-1737672 CAGAGGACAGGGCTGCGGGGAGG - Intronic
1019648636 7:2144397-2144419 CTTTGGAGAGGGCTGGTGGCGGG - Intronic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1019736645 7:2653172-2653194 ACGCGGAAAGGGCTGGGGGAGGG - Intronic
1019795309 7:3044039-3044061 GTGGGGACAGGGCCGGGGGTGGG + Intergenic
1020261432 7:6532595-6532617 CTGAGGACAGGGCTTGGGGAGGG - Intronic
1020278526 7:6638196-6638218 GTGTGGGCAGGTCTGGGGGCCGG + Intronic
1022248919 7:28587541-28587563 AGGTGGACTGGGCTGGGGGTGGG + Intronic
1022558249 7:31322603-31322625 CTCTGGACAGTGCAGGGTGAGGG - Intergenic
1022965210 7:35465953-35465975 CTGGGGGCTGGGCTGGGGGCAGG + Intergenic
1023491048 7:40742395-40742417 CCATGGACGGGGATGGGGGATGG + Intronic
1023718493 7:43068657-43068679 CTGGGGACAGGAGTGGGGAAAGG - Intergenic
1023794839 7:43782977-43782999 CATTGGACAGGGCAGGGGCAGGG + Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024191811 7:47019778-47019800 CTGTGGCCAGGGCTGGGGCTGGG - Intergenic
1024407219 7:48995615-48995637 GTGTTGACAGGGCTGGTGCAGGG - Intergenic
1024643240 7:51349238-51349260 CTGAGGACAGAGCTGTGGAAAGG - Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025209531 7:57012969-57012991 TTGTGGGCAGGGCTGGGTGGTGG - Intergenic
1025662417 7:63563881-63563903 TTGTGGGCAGGGCTGGGTGGTGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026012251 7:66645642-66645664 CTGTAGACATGACTGGGGAAGGG - Intronic
1026523838 7:71137612-71137634 ATGTGGAGAGGGGTGGGGGCTGG + Intronic
1026602004 7:71784924-71784946 GTGTGAACAGGGCTGGGAGTTGG + Exonic
1026899334 7:74028286-74028308 CTGTGGGCAGCGCTGGGGACAGG - Intronic
1027361663 7:77416176-77416198 CTGCGGAGAGGGGTGGGGGCGGG - Intronic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1027933188 7:84566809-84566831 CTGGGGACAGGGTTGGTAGATGG - Intergenic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1028332482 7:89611673-89611695 CTGGGGGTGGGGCTGGGGGAGGG + Intergenic
1028456156 7:91040151-91040173 CTGCAGACAGGGCAGGTGGAAGG - Intronic
1029196614 7:98810041-98810063 CTGTGGACAGCCGTGGGGTATGG - Intergenic
1029465421 7:100721711-100721733 CTGTGGAATGTGCTGGGGAAGGG - Intronic
1029494765 7:100890812-100890834 CACTGGACAGGGCAGGAGGAGGG - Exonic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029994043 7:104989174-104989196 CAATGGACAGGGCAAGGGGATGG + Intergenic
1030079220 7:105762890-105762912 CTGTGAGCAGGGCTGTGGGGAGG + Intronic
1030098627 7:105924014-105924036 CTGAGGACTGGGCTGAGGGTAGG + Intronic
1030303954 7:108001722-108001744 CTCTGCACAGGGCTGCGGGAAGG + Exonic
1031009694 7:116513005-116513027 CGGCATACAGGGCTGGGGGAGGG - Intergenic
1031376799 7:121036270-121036292 TTGGGGAAAAGGCTGGGGGATGG - Intronic
1031403941 7:121360591-121360613 GGGAGGTCAGGGCTGGGGGATGG + Intronic
1031493903 7:122423158-122423180 CTATGGCCAGAGCTGGAGGAAGG - Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032396244 7:131592076-131592098 CTGTGGCCAGGGCTGAGGGAAGG + Intergenic
1032459058 7:132095814-132095836 TCCTGGACAGGGCTGGGGAAAGG + Intergenic
1032598225 7:133264028-133264050 CTGTGGACAATGCTTGGAGAAGG + Intronic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1034392854 7:150800199-150800221 CTGTGGACAGGACGGGGTGGGGG + Intronic
1034439735 7:151080649-151080671 CTGCGGGGAGGGCTGCGGGAGGG - Intronic
1034446537 7:151116687-151116709 CTCTGGCCTGGGCTTGGGGAGGG + Intronic
1034536474 7:151728817-151728839 CTGTGGACGGGGCTGGGCGCTGG - Intronic
1034998230 7:155591773-155591795 CTATGGAGAGAGCTTGGGGAAGG - Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1036526542 8:9540232-9540254 CAATGGACTGGGCTGGAGGAGGG + Intergenic
1036765731 8:11548238-11548260 CTGGGGCCAGGGCTGGGGGCAGG - Intronic
1037069508 8:14626302-14626324 CTGTTGAGGGGGTTGGGGGAGGG - Intronic
1037241892 8:16786683-16786705 CCGTGGACAGGGGATGGGGATGG - Intergenic
1037764466 8:21763763-21763785 TTGAGGACAGGGTAGGGGGACGG - Intronic
1038433194 8:27516127-27516149 CTGTGGACGGTGGTGGGGCACGG - Intronic
1038539936 8:28384003-28384025 CTGTTTACAGGGCAGGGTGAAGG - Intronic
1038633009 8:29263135-29263157 GTGGGGACCGGGCTGGGGGCGGG + Intergenic
1039027622 8:33275095-33275117 CAGTGGGAAGGGCTGGGTGATGG - Intergenic
1041384164 8:57280492-57280514 GTGGGGGCTGGGCTGGGGGAAGG + Intergenic
1042816509 8:72883131-72883153 TTGAGAACATGGCTGGGGGAGGG + Intronic
1043463755 8:80486142-80486164 GTGGGGGCCGGGCTGGGGGAGGG - Intronic
1043515655 8:80992380-80992402 GTTTGGACAGGGCTGGCTGACGG + Intronic
1044256038 8:90062887-90062909 TTATTGCCAGGGCTGGGGGAAGG + Intronic
1044866369 8:96574887-96574909 CCGAGGGCAGGGGTGGGGGATGG + Intronic
1045018258 8:98018347-98018369 CTGTGGAAAGGGCTGATGGCTGG - Intronic
1045324305 8:101106304-101106326 GGTTGGACAGGGTTGGGGGATGG + Intergenic
1045485659 8:102628879-102628901 CCTTGGACAGACCTGGGGGAAGG + Intergenic
1045917173 8:107485983-107486005 CTGTTAACAGGCCTGTGGGAGGG + Intronic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1046778859 8:118193798-118193820 CAGTGGAGGGGGCTGTGGGAGGG + Intronic
1047176911 8:122550372-122550394 CTGGGGACATGGCTAGGTGAAGG - Intergenic
1047177233 8:122553446-122553468 CTATGGACCAGGGTGGGGGAAGG + Intergenic
1047319349 8:123765023-123765045 CTGTGCAAAGGTCTGGGGAAAGG + Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1048035262 8:130671996-130672018 GTGTGGAAAGATCTGGGGGAAGG + Intergenic
1048800307 8:138188687-138188709 CAGTGGGCAGGGCTGCAGGAAGG - Intronic
1048822993 8:138396836-138396858 CTGGGGATAGGTCTAGGGGAAGG - Intronic
1049011573 8:139890993-139891015 CCGTGGACAGGGTAGGGGAATGG - Intronic
1049044124 8:140136197-140136219 CAGAGGAGAGGGCTGTGGGAAGG + Intronic
1049276181 8:141721189-141721211 GTGTGGACACAGCTGGGGGGAGG - Intergenic
1049320521 8:141993815-141993837 TTGGGGGAAGGGCTGGGGGAGGG - Intergenic
1049346940 8:142144136-142144158 CTGTGGCCAGGGAAGGGGGTGGG + Intergenic
1049408490 8:142462075-142462097 CTGGGGGCAGGACTGGAGGAGGG + Intronic
1049412696 8:142480415-142480437 CTGTGGGGAGGTGTGGGGGACGG + Intronic
1049453331 8:142674676-142674698 CTTGGGGCATGGCTGGGGGAAGG - Intronic
1049576370 8:143391750-143391772 CTGTGGCCTTGGCTGGAGGAGGG - Intergenic
1049628287 8:143636438-143636460 CTGGGCTCAGGGCGGGGGGAAGG - Intronic
1049679839 8:143913216-143913238 ACGTGGACAGGGCTGGGGAAGGG + Intergenic
1049725522 8:144143889-144143911 CTCTGGACTGGGCAGGGGGAGGG + Intergenic
1050161770 9:2726959-2726981 CCATGGACGGGGTTGGGGGAGGG - Intronic
1051029166 9:12653872-12653894 CTGAGTACAGGGTTGGGGCAGGG - Intergenic
1052282596 9:26750276-26750298 CGGTTGCCAGGGCAGGGGGAAGG - Intergenic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1052903636 9:33816619-33816641 CTGTGGGCTGGCCTGCGGGAAGG + Intergenic
1053054544 9:34986771-34986793 CCGTGGGCAGGGGTGGGGGTGGG - Intergenic
1053122147 9:35555451-35555473 CTGTGGGCTGCTCTGGGGGAGGG - Exonic
1053195024 9:36110789-36110811 ATGTGGAGAGGGGTGGGGGCCGG + Intronic
1053396278 9:37777322-37777344 CTGTGGCCTGGGATGGGGAAGGG - Intronic
1055630499 9:78218844-78218866 ATGTGGACAGGCATTGGGGAAGG + Intergenic
1055646521 9:78366821-78366843 CTCTGCAGAGGGCAGGGGGAGGG + Intergenic
1056172162 9:83996834-83996856 ATGTGGCCAGAGCAGGGGGAGGG + Intronic
1056417235 9:86388499-86388521 CTGTGTCCAGGGCTAGGAGAGGG - Intergenic
1057184552 9:93049647-93049669 GTGGGGACAGGGCTGGGGCAGGG + Intergenic
1057546514 9:96022945-96022967 CTGTTGGCAGGGGTGAGGGACGG - Intergenic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1059318052 9:113443994-113444016 CAGTGGACAGGTCTGAGGGTAGG - Intergenic
1059468786 9:114487825-114487847 ATGTGGACAGGGCTGGGTGGAGG + Intronic
1059483060 9:114607220-114607242 CTGAGGACAGGGTTAGGGGCAGG + Intergenic
1060110378 9:120902492-120902514 CTGTGGGCAGGGCGGGGGGTGGG + Exonic
1060199957 9:121646517-121646539 CTCTGGGCAGGGGTGGGGGTGGG - Intronic
1060258549 9:122053682-122053704 CAGGGAGCAGGGCTGGGGGAAGG + Intronic
1060368364 9:123043601-123043623 CTGTTGACAGGGTGAGGGGAAGG + Intronic
1060896037 9:127218223-127218245 CTGAGGGCAGAGCTGTGGGAAGG + Intronic
1060925217 9:127451245-127451267 TTGTGGCCGGGGCTGCGGGATGG - Intronic
1061064376 9:128268297-128268319 CTGGGGACCGGGCCGGGGGAAGG - Intronic
1061083494 9:128386035-128386057 CTCTGGATAGGCCTGGGGGTGGG - Intronic
1061250384 9:129422991-129423013 CTGTGGACAGGGCTGCAGGCGGG - Intergenic
1061320121 9:129823486-129823508 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320203 9:129823694-129823716 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061402584 9:130376475-130376497 CTGAGAGCAGAGCTGGGGGATGG - Intronic
1061445388 9:130634499-130634521 CAGCTGGCAGGGCTGGGGGAAGG - Intronic
1061741612 9:132710701-132710723 ATGGTGACAGGGCTGGGGGCTGG - Intergenic
1061892191 9:133628570-133628592 AGGTGCCCAGGGCTGGGGGAGGG + Intergenic
1061950233 9:133931981-133932003 CTGAGCACAGGTCTGCGGGAGGG - Intronic
1062149602 9:135010869-135010891 TCGTGGACAGGGCAGGTGGAGGG - Intergenic
1062212870 9:135373967-135373989 CTGAGGCCAGGGCTGGGGAATGG + Intergenic
1062226433 9:135455061-135455083 CTGTGCTCAGGGTTGTGGGATGG - Intergenic
1062243631 9:135552474-135552496 CTGTGTCCAGGGTCGGGGGAGGG - Intergenic
1062244932 9:135561427-135561449 CTGTGTCCAGGGCAGGGGTATGG - Intergenic
1062274954 9:135726181-135726203 CTGGGGGCTGGGCTGGGGCAGGG + Intronic
1062284507 9:135767153-135767175 CTCTGGACATGGCAGGGGGAGGG - Intronic
1062315909 9:135966953-135966975 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315922 9:135966988-135967010 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315971 9:135967128-135967150 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062395591 9:136351368-136351390 CTGTGGACAGGGCAGGTGTCTGG - Intronic
1062523322 9:136968597-136968619 CTGTGAGCAGGCCTGAGGGAGGG + Intergenic
1062585494 9:137247611-137247633 CTGGGGCCAGGGCTGCAGGAGGG - Intronic
1062656053 9:137605180-137605202 CGGGGGGCAGGGCTGGGGGCGGG - Intergenic
1062681259 9:137782720-137782742 CAGTCAACGGGGCTGGGGGAGGG - Intronic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1203768183 EBV:37235-37257 CCGGGGACAGAGCAGGGGGAGGG + Intergenic
1185811122 X:3111622-3111644 CTGCAGACTGGGGTGGGGGATGG + Intronic
1186357364 X:8801539-8801561 CTGTGGACTGGGGTGGGTGGTGG + Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1187276017 X:17817195-17817217 CTGTGCACAGTGCTGGGGGCAGG + Intronic
1187318323 X:18219141-18219163 CTGTGGCAAGTGCTGGGCGATGG - Intronic
1187415757 X:19092133-19092155 CTGTGGATTGGGCTGGCAGAGGG - Intronic
1188263374 X:28042175-28042197 CTGGGGACAGGGGTTGGGGGTGG + Intergenic
1188621835 X:32235031-32235053 CCGTGGACCGGGTTGGAGGATGG + Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189257852 X:39654280-39654302 TTGTGCCCAGGGCTGGGGGATGG + Intergenic
1189391120 X:40577700-40577722 CTATGGAAAGGTGTGGGGGAGGG - Intergenic
1189670632 X:43404680-43404702 CTGTGCAAAGGGCTGAGGAAGGG + Intergenic
1190137055 X:47807029-47807051 TCGTGGAAAGGGCTGGGGGCAGG + Intergenic
1190212761 X:48460953-48460975 CTGGGGCTAGGGCTGGGGGGAGG - Intronic
1190274433 X:48891277-48891299 CTGGGGACGGTGCCGGGGGAGGG - Intergenic
1190440455 X:50470499-50470521 CTCTGGACAGGGCTCTGGTATGG + Exonic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190935283 X:54994105-54994127 AGGTGGACAGGGCTGGGACAGGG + Intronic
1191060076 X:56285839-56285861 CTGGGGTCAGGGGTAGGGGAGGG + Intronic
1192038104 X:67587884-67587906 CGGGGGACAGGACTGGGGAAGGG - Intronic
1192188799 X:68978293-68978315 CGGTGGACGGGGGTGGGGGAGGG - Intergenic
1192237412 X:69304735-69304757 CTGCGGACAGGAATGGGGGAAGG - Intergenic
1192714888 X:73628650-73628672 CTGTTGTCAGGGTTGGGGGAGGG + Intronic
1192726060 X:73753170-73753192 CTGCTGCCAGGGATGGGGGAGGG + Intergenic
1193755979 X:85408950-85408972 CAGTGGACTGGGTAGGGGGAGGG - Intergenic
1194840221 X:98731469-98731491 CTGGGCACAGGATTGGGGGAAGG - Intergenic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195423283 X:104699162-104699184 CTGTGGACTTGGTGGGGGGATGG + Intronic
1196421686 X:115528722-115528744 CTGTGTGCAGGGGTGGGGGCGGG + Intergenic
1196857524 X:119998445-119998467 CTGTTGACCAGGCTGGAGGAGGG + Intergenic
1197334702 X:125198861-125198883 CAGTGGGCAGGGGTGGGGGCAGG + Intergenic
1197387232 X:125816376-125816398 CTGTGTACAGGGGTTGGGGGTGG - Intergenic
1197699557 X:129588568-129588590 CTGTTGACAGGGCAGGGAGAAGG + Intronic
1197967331 X:132079007-132079029 ATTTGGTTAGGGCTGGGGGAGGG + Intronic
1198119578 X:133578871-133578893 CTATGGAGAGGGATGGGGGTTGG + Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1199466374 X:148142117-148142139 ACATGGACAGGGTTGGGGGATGG + Intergenic
1199600572 X:149539335-149539357 CTGTGGGTGGAGCTGGGGGAGGG - Intergenic
1199744889 X:150766218-150766240 CTGGGGGCGGGGCGGGGGGAGGG + Intergenic
1199860790 X:151798921-151798943 CTGTGGAGAGGGGTGGAGGGAGG + Intergenic
1200096547 X:153667256-153667278 ATGTGGACAGGTCTTGGTGATGG - Intergenic
1200102367 X:153694458-153694480 CTGAGGGCTGGGCTGGGGGATGG + Intronic
1200152006 X:153955767-153955789 GTGAGGACAGGGCAAGGGGAAGG + Intronic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic