ID: 1104693940

View in Genome Browser
Species Human (GRCh38)
Location 12:130849121-130849143
Sequence GAGGGTCACGAATATGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104693940_1104693946 9 Left 1104693940 12:130849121-130849143 CCCTGCCCATATTCGTGACCCTC No data
Right 1104693946 12:130849153-130849175 AACCAAAAAGTATCTGAGACAGG 0: 88
1: 201
2: 243
3: 239
4: 598
1104693940_1104693948 25 Left 1104693940 12:130849121-130849143 CCCTGCCCATATTCGTGACCCTC No data
Right 1104693948 12:130849169-130849191 AGACAGGTCTCAATCAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104693940 Original CRISPR GAGGGTCACGAATATGGGCA GGG (reversed) Intergenic
No off target data available for this crispr