ID: 1104697913

View in Genome Browser
Species Human (GRCh38)
Location 12:130878583-130878605
Sequence TAACTGGTAGGACCGACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104697913_1104697917 24 Left 1104697913 12:130878583-130878605 CCTGAAGTCGGTCCTACCAGTTA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1104697917 12:130878630-130878652 CTCTGCTTTTTACCTTGAGTTGG 0: 1
1: 0
2: 1
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104697913 Original CRISPR TAACTGGTAGGACCGACTTC AGG (reversed) Intergenic
1071618161 10:87094925-87094947 TAACGGGGAGGACGGACTTCGGG + Intronic
1090975551 11:131677219-131677241 GAAGTGGCAGGACAGACTTCAGG - Intronic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1096200891 12:49681988-49682010 TAACTGGAATGACCTACTCCAGG + Intronic
1100171734 12:91983005-91983027 TAAGTGGTATGACGGCCTTCTGG - Intergenic
1104697913 12:130878583-130878605 TAACTGGTAGGACCGACTTCAGG - Intergenic
1119827297 14:77668065-77668087 TTATTGGTAAGACAGACTTCTGG - Intergenic
1131748271 15:95474180-95474202 TAACTATTAGAACCCACTTCGGG - Intergenic
1137995612 16:53207921-53207943 TAACTGGTAGCACCATCTGCTGG + Intronic
1144623235 17:16831562-16831584 TAACTGGCAGGACAGAGGTCAGG + Intergenic
1144883196 17:18441154-18441176 TAACTGGCAGGACAGAGGTCAGG - Intergenic
1145149034 17:20503232-20503254 TAACTGGCAGGACAGAGGTCAGG + Intergenic
1162417056 19:10544377-10544399 TAACTGGCAGGACCGGGGTCTGG - Intronic
939252341 2:139697971-139697993 TAAATGGTAGGTAAGACTTCAGG + Intergenic
940523117 2:154777005-154777027 AAACTGGTTGGAGAGACTTCTGG - Intronic
947386600 2:229596647-229596669 TACCTGGTGGGACTGACTCCTGG - Intronic
1170697003 20:18668174-18668196 TAACTGGTACTACAGACATCTGG - Intronic
975800962 4:78058579-78058601 TAACTGGTTGGAGCGTGTTCTGG + Intronic
979913644 4:126404011-126404033 TAACTGGTTGGACCCACTGCTGG + Intergenic
994711937 5:103276245-103276267 TGGCTGGTAGTACCTACTTCTGG - Exonic
1005254794 6:23989924-23989946 TAACTGCAAGGACCGCCTTCTGG - Intergenic
1016257026 6:142119402-142119424 TAACTGGTTGGACCAGCTCCTGG - Intergenic
1022794237 7:33719367-33719389 TAAGTGGGAGGACCCACATCTGG + Intergenic
1024307081 7:47938122-47938144 TAACTGGCTGGAACTACTTCTGG - Intronic
1028207583 7:88034267-88034289 TAAAGGGAAGGACCAACTTCTGG - Intronic
1037564158 8:20103383-20103405 TAACTGGAATGACCGACGTGGGG - Intergenic
1054812798 9:69447972-69447994 TCACTGGCAGGAGCGACTTGTGG + Intronic
1061162403 9:128902844-128902866 TCACTAGGAGGACTGACTTCTGG + Intronic
1061440461 9:130599804-130599826 AAACTGGTTGGACTGACTGCAGG - Intronic
1196965142 X:121047511-121047533 TAACGGGGAGGACGGACTTTGGG - Intergenic