ID: 1104702595

View in Genome Browser
Species Human (GRCh38)
Location 12:130918490-130918512
Sequence GTGCAACGCGGGTCAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104702595_1104702603 -8 Left 1104702595 12:130918490-130918512 CCCCTCCCTGACCCGCGTTGCAC No data
Right 1104702603 12:130918505-130918527 CGTTGCACTCGTCAGGAACGTGG No data
1104702595_1104702607 30 Left 1104702595 12:130918490-130918512 CCCCTCCCTGACCCGCGTTGCAC No data
Right 1104702607 12:130918543-130918565 TTAATTCCCACCGCGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104702595 Original CRISPR GTGCAACGCGGGTCAGGGAG GGG (reversed) Intergenic