ID: 1104702596

View in Genome Browser
Species Human (GRCh38)
Location 12:130918491-130918513
Sequence AGTGCAACGCGGGTCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104702596_1104702607 29 Left 1104702596 12:130918491-130918513 CCCTCCCTGACCCGCGTTGCACT No data
Right 1104702607 12:130918543-130918565 TTAATTCCCACCGCGCCCTGTGG No data
1104702596_1104702603 -9 Left 1104702596 12:130918491-130918513 CCCTCCCTGACCCGCGTTGCACT No data
Right 1104702603 12:130918505-130918527 CGTTGCACTCGTCAGGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104702596 Original CRISPR AGTGCAACGCGGGTCAGGGA GGG (reversed) Intergenic