ID: 1104702603

View in Genome Browser
Species Human (GRCh38)
Location 12:130918505-130918527
Sequence CGTTGCACTCGTCAGGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104702596_1104702603 -9 Left 1104702596 12:130918491-130918513 CCCTCCCTGACCCGCGTTGCACT No data
Right 1104702603 12:130918505-130918527 CGTTGCACTCGTCAGGAACGTGG No data
1104702597_1104702603 -10 Left 1104702597 12:130918492-130918514 CCTCCCTGACCCGCGTTGCACTC No data
Right 1104702603 12:130918505-130918527 CGTTGCACTCGTCAGGAACGTGG No data
1104702595_1104702603 -8 Left 1104702595 12:130918490-130918512 CCCCTCCCTGACCCGCGTTGCAC No data
Right 1104702603 12:130918505-130918527 CGTTGCACTCGTCAGGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104702603 Original CRISPR CGTTGCACTCGTCAGGAACG TGG Intergenic