ID: 1104703899

View in Genome Browser
Species Human (GRCh38)
Location 12:130928345-130928367
Sequence CTGCAGGCACAGCTGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104703899_1104703904 8 Left 1104703899 12:130928345-130928367 CCTGGATCCAGCTGTGCCTGCAG No data
Right 1104703904 12:130928376-130928398 ACCACTGGCCTTTCCTTCCACGG No data
1104703899_1104703902 -7 Left 1104703899 12:130928345-130928367 CCTGGATCCAGCTGTGCCTGCAG No data
Right 1104703902 12:130928361-130928383 CCTGCAGCCAGCATCACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104703899 Original CRISPR CTGCAGGCACAGCTGGATCC AGG (reversed) Intergenic
No off target data available for this crispr