ID: 1104708137

View in Genome Browser
Species Human (GRCh38)
Location 12:130963862-130963884
Sequence CTGCCAAATTACCCTTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104708137 Original CRISPR CTGCCAAATTACCCTTCAGA AGG Intronic
900770084 1:4534021-4534043 TTGCCAAATTTTCCTTCATAGGG - Intergenic
901346412 1:8547782-8547804 TTACCAAATTTCCCTTCAGCTGG - Intronic
902980700 1:20120878-20120900 TTGACAACTTACCCTACAGAAGG + Intergenic
903058941 1:20656008-20656030 CTGCCAAATTAGCATTCACTGGG - Intronic
903826656 1:26150514-26150536 CTTCCAAATTACCATGGAGATGG + Intergenic
903854995 1:26331810-26331832 TTGCCAAATTCCCCTCCATAGGG - Intronic
905176793 1:36141367-36141389 CTGACAAATCTCCATTCAGAAGG - Intronic
906189658 1:43888846-43888868 CTGCCAAATTCCCCTCCACAGGG - Intronic
907651456 1:56299076-56299098 CTCCCAAATTAGCCCTCACAGGG + Intergenic
908996288 1:70159664-70159686 CTGCTAAATTTCCTTTCAGTAGG - Intronic
909725318 1:78828114-78828136 AGGCCAAATAACTCTTCAGAAGG + Intergenic
910662064 1:89684532-89684554 CTTCCAAGTTCCACTTCAGAAGG - Intronic
911269966 1:95789102-95789124 CTGCCTAATTAGTCTACAGAGGG + Intergenic
913474058 1:119219698-119219720 ATGGCAAAATACCCTTCAGTTGG - Intergenic
913493338 1:119403629-119403651 CAGCCAAATTGTCCTTCAGTAGG + Intergenic
913503508 1:119494264-119494286 CAGCCAAATTGTCCTTCAGTAGG + Intergenic
915971288 1:160356912-160356934 CTGTCCCTTTACCCTTCAGATGG - Intronic
916725794 1:167522326-167522348 CTGCCAAATTATTTTTCACAAGG - Intergenic
917873659 1:179265598-179265620 CTGCCAAATTATTCTCCAAAGGG + Intergenic
917944794 1:179958252-179958274 ATGCCAAATTTCCTTCCAGAAGG - Intronic
917990766 1:180376248-180376270 TTGCCAAATTTCCCTCTAGAAGG - Intronic
920724582 1:208422012-208422034 TTGCCAAATTGCCCTCCAGAAGG - Intergenic
921569220 1:216758915-216758937 CAGCCAAATAACCCCTAAGAAGG + Intronic
921668754 1:217903512-217903534 CTGGCAAACTGCTCTTCAGAGGG - Intergenic
922176534 1:223202079-223202101 CAGCCAAATCAGCATTCAGAGGG + Intergenic
924389674 1:243539727-243539749 CTTACAAATAACCCTTAAGAAGG + Intronic
1062921693 10:1285203-1285225 CTGCCAAGAGACCCTTCAGCAGG - Intronic
1064524961 10:16245296-16245318 CAGCAAAATTATCCTTCAAAGGG + Intergenic
1065743366 10:28816325-28816347 CTGCCAAATCAATCTTCAAAAGG - Intergenic
1065793857 10:29288126-29288148 TTGCCAAATTGCCTTTCACATGG - Intergenic
1066398689 10:35052344-35052366 CTGCCCCATTGCCTTTCAGAAGG - Intronic
1067485017 10:46640370-46640392 TTGCCAAATATCCCTTCAAAAGG + Intergenic
1067609739 10:47701289-47701311 TTGCCAAATATCCCTTCAAAAGG - Intergenic
1067736258 10:48853460-48853482 CTACCAACTTACTCTCCAGATGG + Intronic
1067842601 10:49693369-49693391 CTGCCAAATTGCCCTCCAGAAGG + Intronic
1068794779 10:61067547-61067569 CTGACAAATTACCCGTAAGCAGG + Intergenic
1068865211 10:61887948-61887970 CTGCCAATTTGTCTTTCAGAAGG + Intergenic
1069970928 10:72168495-72168517 TTGCCAAATTTCCCTCCACAGGG - Intronic
1070102770 10:73403718-73403740 CTGCCCAATTCCCCTCCAGAGGG + Intronic
1070692166 10:78535032-78535054 TTGCCAAATTGCCCTCCATAGGG + Intergenic
1070869340 10:79736307-79736329 TTGCCAAGTTTCCCTTGAGAAGG + Intergenic
1071625333 10:87162897-87162919 TTGCCAAATATCCCTTCACAAGG - Intronic
1071658982 10:87479443-87479465 TTGCCAAGTTTCCCTTGAGAAGG - Intergenic
1072258276 10:93641790-93641812 CTGCCAAACTCTCCTTCAGCTGG + Intronic
1075373814 10:121961645-121961667 ATGCCAAATTGGCCTCCAGAAGG - Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1080959105 11:37137061-37137083 CTGACAAATTACCTTTTTGATGG - Intergenic
1086040678 11:82473577-82473599 CTGCCAAACTAGTTTTCAGATGG + Intergenic
1088128866 11:106462704-106462726 CTGCCAAATTTCCCTTCAGAAGG - Intergenic
1094016025 12:25865543-25865565 TTGCCGAATTGCTCTTCAGAAGG - Intergenic
1097904137 12:64902960-64902982 TTGCCAAATTACCCTGCAAAAGG + Intergenic
1100297573 12:93276924-93276946 ATGCCAAATTACCCTCCTTAGGG - Intergenic
1100445049 12:94652026-94652048 TAGCCTAATTATCCTTCAGAAGG + Intergenic
1100480683 12:94975521-94975543 CTGCCAAATTGCCCTCTAGAAGG - Intronic
1101146827 12:101848497-101848519 CTGCCAAATTACCTTTTAAAGGG + Intergenic
1101647462 12:106644705-106644727 TTGCAAAATTACCCATCAAATGG + Intronic
1104708137 12:130963862-130963884 CTGCCAAATTACCCTTCAGAAGG + Intronic
1105012793 12:132766780-132766802 CTGCAACATTCCCCCTCAGACGG + Intergenic
1106822362 13:33479299-33479321 CTATCAAATTCCCCTTCATAGGG - Intergenic
1106858111 13:33874735-33874757 CTGGAAAATGACCCTCCAGATGG + Intronic
1109570159 13:64177827-64177849 ATGCCAAATGATTCTTCAGAGGG - Intergenic
1113195415 13:107798248-107798270 ATGCAAAATTACTTTTCAGAGGG + Intronic
1114409836 14:22490246-22490268 CTGCCACATTTTTCTTCAGAGGG - Intergenic
1115826589 14:37284990-37285012 TTGCCAAATTGCTCTTCAGATGG + Intronic
1117455783 14:55895608-55895630 CTGCCAAATTAGCCCTCTGGTGG - Intergenic
1118032895 14:61835736-61835758 TTGCCAAATTTCCCTACAGAAGG + Intergenic
1120513691 14:85445623-85445645 CATCCAAATAATCCTTCAGAGGG - Intergenic
1121773840 14:96577142-96577164 CAGCCAAACTACCCATCAAATGG - Intergenic
1122509108 14:102251463-102251485 CTGCCACATTTCCCTCTAGAAGG + Intronic
1122579805 14:102764453-102764475 CTACAAAATTTCCCTGCAGATGG - Intergenic
1124545573 15:30623575-30623597 CTGCCAAATTCCCCTTCATAGGG - Intergenic
1124779091 15:32612974-32612996 CTGCCAAATTCCCCTTCATAGGG - Intergenic
1125969858 15:43903068-43903090 ATGCCAAAGGCCCCTTCAGATGG - Intronic
1127667045 15:61158066-61158088 TTACCAAATTCCCTTTCAGAAGG + Intronic
1127874874 15:63103480-63103502 TTGCCAAGTTACCCTTCTGGAGG - Intergenic
1128346814 15:66858996-66859018 TTGCCAAATTCCCCTGCAGAAGG + Intergenic
1129707161 15:77801085-77801107 TTGCCAAATTACCCTTCCAAAGG - Intronic
1130402396 15:83569577-83569599 TTCCCAACCTACCCTTCAGAAGG + Intronic
1132795563 16:1719947-1719969 CTGCTAAGTGACTCTTCAGAGGG - Intronic
1136099095 16:27980192-27980214 CTGCCAAGTTACCCTTGGCATGG + Intronic
1136297879 16:29313962-29313984 CTGCCATGTGGCCCTTCAGAAGG - Intergenic
1138562402 16:57809717-57809739 TTGCCAGATTGCCCCTCAGAAGG + Intronic
1141611619 16:85184444-85184466 CTGCTAAATTATACTTAAGAAGG + Intronic
1143437538 17:6940278-6940300 CTGGCCAACTACCCTTCAGCTGG - Intronic
1143961047 17:10720131-10720153 CTCCCGAATTCCCCTCCAGATGG - Intronic
1144644992 17:16966645-16966667 TTGCCAAATTACCCTCCATGGGG - Intronic
1146217649 17:30991070-30991092 TTGCCAAATCACCCTCCAGTTGG + Intronic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1147843651 17:43389988-43390010 CTGCCATATTGCACTTCACAGGG - Intergenic
1148635965 17:49149811-49149833 TTGCCAAATTTCCCTCAAGAGGG + Intronic
1150074163 17:62178619-62178641 CTGTCAAATTGCACTGCAGATGG - Intergenic
1150614359 17:66757611-66757633 CTGCAAAATTGTCCTTCAAAAGG + Intronic
1151229615 17:72674613-72674635 TTGCCAAATTTCTCTCCAGAAGG + Intronic
1152995262 18:400510-400532 GGGTGAAATTACCCTTCAGAAGG - Intronic
1153015858 18:582259-582281 CAGCAATTTTACCCTTCAGAGGG + Intergenic
1155046640 18:22109026-22109048 CTGCCCTAATACCCTACAGATGG - Intergenic
1155610462 18:27661399-27661421 CTGCAAGATTACCCTCCAGCAGG + Intergenic
1155632976 18:27917025-27917047 TTGCCAAATTTCCCACCAGAAGG - Intergenic
1155817818 18:30336645-30336667 TTTCCATATTACCTTTCAGAAGG + Intergenic
1157235648 18:45962762-45962784 CTGCCAAATTATACTATAGATGG + Intronic
1162591865 19:11597415-11597437 CTGCCAACTGTCCATTCAGATGG + Exonic
1164847042 19:31441270-31441292 CTGCCAAATTGCCCTACACAGGG - Intergenic
1164857441 19:31535990-31536012 TAGCCAGATTACACTTCAGATGG + Intergenic
1166742117 19:45120941-45120963 TTGCCAAATTGCCTTTGAGACGG + Intronic
926113114 2:10195191-10195213 CTGTCACATGACCCCTCAGACGG - Intronic
927080423 2:19623646-19623668 CTGCCAAATTTCACTTCACAAGG + Intergenic
927234881 2:20863180-20863202 TTGCCAAATTCCCCTACATATGG - Intergenic
927445384 2:23156394-23156416 TTTCCAAATTCCCCTACAGATGG + Intergenic
927685194 2:25165792-25165814 CTGCCAAATTTCCCTTAACCAGG + Intronic
928024092 2:27725665-27725687 CTGCCAAATTTCCCTCCAAAGGG - Intergenic
929536079 2:42784800-42784822 TGGCCAAGTTGCCCTTCAGAAGG - Intronic
930892513 2:56407471-56407493 CTGCCATTTTCCTCTTCAGATGG + Intergenic
931604956 2:64042933-64042955 CTTCCAAATTACTCTTCCAAGGG + Intergenic
933508431 2:83208379-83208401 CTTCCAAAATAGCCTTCAGCTGG + Intergenic
935105263 2:100037001-100037023 TTGCCAAGTTTCCCTCCAGAAGG - Intronic
935640516 2:105285630-105285652 CTCTCAAATTACCTTTCAAAGGG + Intronic
937434074 2:121866029-121866051 CTACCAAATTGCCCTGCTGAAGG + Intergenic
937936122 2:127247014-127247036 CTGCCACATTACCCTTTACAGGG - Intergenic
939952018 2:148486864-148486886 CTATCAAATTACCCTCCAAAAGG - Intronic
941251583 2:163171834-163171856 CTGCAAAATAATACTTCAGAGGG - Intergenic
941785694 2:169496112-169496134 CTGCCAGATTACCCTTCTCTGGG + Intronic
942107775 2:172650228-172650250 CAGCCAAATTAAGCTTCATAAGG + Intergenic
943408571 2:187518391-187518413 CAGCCAAATTAAGCTTCATAAGG - Intronic
943779813 2:191810783-191810805 ATGCCAAATTACCCTCTAGAAGG + Intergenic
944158811 2:196637772-196637794 CTTCCAAAGTATCCTTCATATGG - Intergenic
944208057 2:197178074-197178096 CTGCCAAACTGCCCTCCAAAGGG + Intronic
945669620 2:212787002-212787024 CAGCCAAATTAAGCTTCATAAGG + Intergenic
945979666 2:216298926-216298948 CTGCCAAATCGGCCTTCAGGAGG + Intronic
947248402 2:228075643-228075665 ATGCCGGATTACTCTTCAGAAGG + Intronic
948546912 2:238739142-238739164 CTGCCAAGTTACACTTGAGTAGG - Intergenic
1169157614 20:3346231-3346253 TTGCCAAAGTCCCCTTCAGAAGG - Intronic
1169283967 20:4291801-4291823 TTGCCAAATTATCTTCCAGAAGG + Intergenic
1170354342 20:15475809-15475831 CATCAGAATTACCCTTCAGATGG - Intronic
1171328548 20:24317739-24317761 CTTCAAAATGCCCCTTCAGATGG + Intergenic
1171961162 20:31495769-31495791 CTGCCAAATTGCCCTCCAAAGGG + Intergenic
1173004498 20:39129409-39129431 CTGACAACTTACCCTCAAGAAGG + Intergenic
1173364683 20:42374126-42374148 CTGCCACATTTCCCTGCAGCTGG - Intronic
1175097175 20:56550624-56550646 TTGCCAAATTTCCCTTTAAAAGG + Intergenic
1177966426 21:27733448-27733470 CTGCCAAATTACTATTCAGAAGG - Intergenic
1178624881 21:34206257-34206279 TTGCCAAATTAGCCTTTACAGGG + Intergenic
1178738027 21:35170490-35170512 CTGCCAACTTAGCCTTGTGATGG - Intronic
1179224569 21:39442447-39442469 CAGCCAGAGTAACCTTCAGAAGG - Intronic
1179820097 21:43931740-43931762 CTGCCAAAATCCCCTTCTGGTGG - Intronic
1181993423 22:26855855-26855877 GTGCCAAATTACCTTAAAGAAGG + Intergenic
1184914578 22:47560712-47560734 CTTCCATATGACCCTTGAGATGG + Intergenic
1184930670 22:47678903-47678925 CTGTCAAATTACCCAACCGAGGG + Intergenic
949529732 3:4943710-4943732 TTGCCAAATTCCCCTTCACTGGG + Intergenic
949558847 3:5184465-5184487 TTGCCAAATGACCCTTCACACGG + Intergenic
950124725 3:10504460-10504482 CTGCTCACTTACCCTTCTGAAGG + Intronic
950321422 3:12058145-12058167 CTACCAAATCAACCTCCAGATGG - Intronic
950931649 3:16795404-16795426 CTGACAAATTCCCCTCCATAGGG - Intergenic
951402567 3:22251670-22251692 TTGCCAAATGACCCTTTAAATGG + Intronic
954640667 3:52095914-52095936 CTGCCAACCTACGCTCCAGAGGG + Intronic
955164119 3:56493861-56493883 CTGCCAAATTGCCCTCTAAAAGG + Intergenic
955343635 3:58144673-58144695 TTGCCAAATTGCCCTTCAGAGGG + Intronic
959438243 3:106344084-106344106 TTGCCAAATCACCTTCCAGAAGG - Intergenic
959860865 3:111213165-111213187 CTGCCACCTTATCCTCCAGATGG + Intronic
961516532 3:127441014-127441036 CTGCCAAATTTCCCTTCATTAGG - Intergenic
961868533 3:129971975-129971997 CAGCCATCTTACCCTTCAGGAGG + Intergenic
963017676 3:140841167-140841189 CTGCAAAGTTACCCTTGAGTGGG + Intergenic
963818042 3:149855734-149855756 CTGCCAAATTACCTTTGCAAAGG + Intronic
966937611 3:184722929-184722951 ATACCAAATTGCCCTTCATAAGG + Intergenic
967778969 3:193415059-193415081 TTGCCAAATTGCCCTGCAGAAGG - Intronic
969160426 4:5252988-5253010 CTGCCAACTTACTCTTCCTAAGG + Intronic
972800527 4:42471000-42471022 CTGCCAAATTTTAGTTCAGAAGG - Intronic
976092738 4:81474118-81474140 CTGCCAAATTTCCCTTCTCTGGG + Intronic
976851893 4:89557294-89557316 TGGCCAAATTACCCTACAGGAGG - Intergenic
977004090 4:91543553-91543575 CAGCCAAATTAAGCTTCATAAGG - Intronic
977248337 4:94660193-94660215 CGGCCAAATTACACTTTTGAAGG + Intronic
978228662 4:106370191-106370213 CTGCCAAATTTCTCTTAGGAAGG + Intergenic
979520631 4:121662443-121662465 TTGCCAAACTACCCTCCAGAGGG + Intergenic
979562599 4:122117214-122117236 TTGCCAAATTCCCCTCCATAAGG - Intergenic
981090262 4:140724980-140725002 TTGCCAAATTCCCCTTCCTAGGG - Intronic
981545915 4:145893003-145893025 CTGCCAATTTAGCCATCAGGGGG + Intronic
982296015 4:153830133-153830155 CTACCAAATTGCTCTCCAGAAGG + Intergenic
983579659 4:169294905-169294927 CTGTGAAATTATCCTTCAAAAGG + Intergenic
985807428 5:2057257-2057279 CTGCCAAATCACCTTCCAGCTGG - Intergenic
989161566 5:38396236-38396258 CTGCCAGATTATCCCACAGAAGG + Intronic
991144980 5:63290681-63290703 TTGCCAAGTTACCATCCAGAAGG + Intergenic
991252354 5:64577575-64577597 TTGCAAAATCAGCCTTCAGAAGG - Intronic
992122506 5:73609133-73609155 TTGCCAAATTTTCCTGCAGAAGG + Intergenic
992833023 5:80613848-80613870 TTGCCAAATTTCCCTTCACAGGG + Intergenic
993525224 5:88956867-88956889 ATGCCAAATTAGACTTCAGTTGG - Intergenic
997189663 5:131919298-131919320 TTGCCAAATTTTCCTCCAGAAGG - Intronic
998470038 5:142376424-142376446 TTGCCAAATTTCCCTCCAAAAGG - Intergenic
998842084 5:146265014-146265036 CTGCCAAATTTCCTTTCATGAGG - Intronic
999527307 5:152421665-152421687 CAGCCAAATTACCCTCCATTTGG - Intronic
999778741 5:154831750-154831772 CTGCCAAATTGCCCTCTAGAAGG - Intronic
1000135150 5:158340854-158340876 TTGCAAAACTACCCTTCACATGG + Intergenic
1004794865 6:19070317-19070339 CTGCCAATTTTCCCATCAGCAGG + Intergenic
1004900516 6:20189214-20189236 ATCCCAATTTATCCTTCAGAAGG - Intronic
1004950921 6:20671088-20671110 CTGCCTAGTTACCCTCCAAAAGG + Intronic
1005015330 6:21369957-21369979 CTTCCAAAACACCCTTCAAAAGG - Intergenic
1006729268 6:36223893-36223915 CTGCCAAATTACATTCCATAAGG + Intronic
1011567084 6:88687356-88687378 TTGCCAAATTTCCCTCCAGACGG - Intronic
1011570936 6:88733856-88733878 CAGCAAAATTAACCTTCAAAAGG + Intronic
1015765908 6:136716247-136716269 TTCCCAAATTGCGCTTCAGAAGG + Intronic
1015889321 6:137954005-137954027 TTGCCACATTGCCCTCCAGAGGG - Intergenic
1018274492 6:162116105-162116127 CTGACACATTACCCTTGAGCAGG + Intronic
1020353279 7:7247781-7247803 CAGCCAAATTAACCTTGTGAAGG - Exonic
1022155351 7:27655933-27655955 TTGCCAAATTACCATCCAAAAGG - Intronic
1023426129 7:40038541-40038563 TTGCCAAATTTCTCTTCAGAGGG + Intronic
1024921401 7:54559560-54559582 CTGACAAATTTTCCTTCACAAGG - Intronic
1028309063 7:89306977-89306999 TTGCCAAATTACCCTCTAAAAGG + Intronic
1028987528 7:97019960-97019982 TAGACAAATTACCCTTCAAAGGG - Intergenic
1030160322 7:106501509-106501531 TTGCCAAATTAATCTTCATATGG - Intergenic
1030303749 7:108000421-108000443 CTGTACAATTGCCCTTCAGAAGG - Intronic
1031935510 7:127731642-127731664 CTGCCAAGTTACCCTTCTTCCGG + Intronic
1032351429 7:131167266-131167288 CTGCCAAATTGCTTTTCAAAGGG - Intronic
1035256666 7:157633606-157633628 CTGAGAGTTTACCCTTCAGAGGG - Intronic
1035995043 8:4536815-4536837 CGGCCAAATTTCCTTTCACAAGG + Intronic
1036030891 8:4971445-4971467 CTGCCAGCTTTCCTTTCAGAAGG - Intronic
1036052895 8:5219772-5219794 CAGAAAAATAACCCTTCAGAAGG - Intergenic
1037287475 8:17316917-17316939 CTGCCAAATTGCTCTTGAAAAGG + Intronic
1037397444 8:18458063-18458085 CTGCCAAATGGCCCTTCATAAGG + Intergenic
1038558542 8:28547076-28547098 ATTCCAAGTTACCCTTGAGAGGG - Intronic
1038729694 8:30115927-30115949 CTACCAAATTACATTTTAGAAGG - Intronic
1038947109 8:32373326-32373348 TTGCCAAATTGCTCTTCAAAAGG - Intronic
1040129562 8:43778945-43778967 CTTCCAAATGTCCCTTCACATGG - Intergenic
1040426421 8:47291831-47291853 CTGACAAATTTCTATTCAGATGG + Intronic
1040988872 8:53327930-53327952 CTCACAAATTACACTTCATAGGG - Intergenic
1041574769 8:59381339-59381361 CTGCCAGATTTCCCTTCTGTGGG + Intergenic
1041983332 8:63889646-63889668 CTGCCAAATTGTCCTTTACAGGG - Intergenic
1044363033 8:91310436-91310458 CTGCCAAATCACCCTTCTACAGG - Intronic
1044704095 8:94992055-94992077 TTGCCAAATTGCCCTCCAAAGGG + Intronic
1044754680 8:95448659-95448681 CTGCCAAATTCCCCTTCATGGGG + Intergenic
1044830949 8:96248145-96248167 TTGCCAAATTGTCCTTCATAGGG - Intronic
1046235185 8:111415162-111415184 CTGCCAAATTAAGCTTAATAAGG - Intergenic
1047626482 8:126661232-126661254 CTGCAAAAATACTCTTCATAGGG - Intergenic
1048814779 8:138322298-138322320 CTGCCAACTTGCCCTTAAGTAGG - Intronic
1050053509 9:1627684-1627706 CTGCCAAATTGTGCTTCAGTAGG - Intergenic
1050574426 9:6978497-6978519 CTAACAAACTACCCTTCAGGAGG - Intronic
1053277587 9:36794996-36795018 CTGCCCAATTTCCTTCCAGATGG + Intergenic
1055559685 9:77510616-77510638 CTGCCACAGTACCCATCTGAGGG - Intronic
1056302431 9:85256400-85256422 CAGCCAAATGAACCTTCACAAGG - Intergenic
1061812355 9:133169673-133169695 GTGCCAACTCACCCTCCAGAAGG - Intergenic
1186966962 X:14797996-14798018 CTGACAAATTGCCCATCACAGGG - Intergenic
1187082421 X:16005348-16005370 GTGTCAAATTTCCCTTCAGTAGG - Intergenic
1187246467 X:17557183-17557205 CTGCCAAGGTAACCATCAGAGGG - Intronic
1187437069 X:19281527-19281549 TTGCCAAATTACCCTCCACAGGG - Intergenic
1187559432 X:20387696-20387718 CTGCCAAACTACTTTTCATAGGG - Intergenic
1190822132 X:53983563-53983585 GTGCCAAATTTCCCTCCAAAAGG - Intronic
1191268069 X:58423486-58423508 CTGCCAAATATCCCTTCACAGGG + Intergenic
1192577065 X:72251461-72251483 CTGCCAAATTGCCCTACATAAGG + Intronic
1195715596 X:107815481-107815503 CTGGCAAAGTACACTCCAGATGG + Intergenic
1196015256 X:110932776-110932798 TTGTCAAATTGCCCTTCAAAAGG - Intergenic
1197880567 X:131162660-131162682 CAGCCAAATTAAGCTTCATAAGG - Intergenic
1199588766 X:149445536-149445558 TTGCCAAATTTCACTTCATATGG - Intergenic
1199824757 X:151488085-151488107 CTGCCATATTAGCCTTAAAAAGG + Intergenic