ID: 1104709401

View in Genome Browser
Species Human (GRCh38)
Location 12:130974859-130974881
Sequence CAGGCAGACAAGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1205
Summary {0: 1, 1: 0, 2: 10, 3: 86, 4: 1108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104709401_1104709405 1 Left 1104709401 12:130974859-130974881 CCTCTCTGCTGCTTGTCTGCCTG 0: 1
1: 0
2: 10
3: 86
4: 1108
Right 1104709405 12:130974883-130974905 CTTCATTCTAGGAGCTACTGTGG 0: 1
1: 0
2: 0
3: 13
4: 140
1104709401_1104709407 15 Left 1104709401 12:130974859-130974881 CCTCTCTGCTGCTTGTCTGCCTG 0: 1
1: 0
2: 10
3: 86
4: 1108
Right 1104709407 12:130974897-130974919 CTACTGTGGGTCCTGTCTTTTGG 0: 1
1: 0
2: 0
3: 12
4: 168
1104709401_1104709408 22 Left 1104709401 12:130974859-130974881 CCTCTCTGCTGCTTGTCTGCCTG 0: 1
1: 0
2: 10
3: 86
4: 1108
Right 1104709408 12:130974904-130974926 GGGTCCTGTCTTTTGGCAAATGG 0: 1
1: 0
2: 1
3: 7
4: 130
1104709401_1104709406 2 Left 1104709401 12:130974859-130974881 CCTCTCTGCTGCTTGTCTGCCTG 0: 1
1: 0
2: 10
3: 86
4: 1108
Right 1104709406 12:130974884-130974906 TTCATTCTAGGAGCTACTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 122
1104709401_1104709402 -10 Left 1104709401 12:130974859-130974881 CCTCTCTGCTGCTTGTCTGCCTG 0: 1
1: 0
2: 10
3: 86
4: 1108
Right 1104709402 12:130974872-130974894 TGTCTGCCTGCCTTCATTCTAGG 0: 1
1: 0
2: 1
3: 47
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104709401 Original CRISPR CAGGCAGACAAGCAGCAGAG AGG (reversed) Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
900430018 1:2596955-2596977 CAGCCAGACAACCAGGACAGGGG - Intronic
901335739 1:8447551-8447573 CCAGCAGACCTGCAGCAGAGGGG - Intronic
901357236 1:8661540-8661562 CGGGAAGACAAGCAGCAGCTGGG + Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901668050 1:10837564-10837586 GAGGCAGACAGGGAGCAAAGAGG + Intergenic
901957714 1:12798323-12798345 CAGGAAGACCAGTGGCAGAGAGG + Intergenic
902141484 1:14360693-14360715 CCAGCAGACCTGCAGCAGAGTGG - Intergenic
903102904 1:21048632-21048654 CAGGAAGACACGCAGCACAGTGG + Intronic
903130020 1:21272946-21272968 CAGGCAGGGAAGAAGCAGGGAGG + Intronic
903345303 1:22680546-22680568 CAGCCAGGCATGAAGCAGAGGGG - Intergenic
903769251 1:25753677-25753699 TAGGCAGGCAAGCAGGAGGGGGG + Intronic
904116637 1:28167142-28167164 AAGGAAAACAATCAGCAGAGTGG + Intronic
904468127 1:30719760-30719782 GAAGCAGAGAAGCAGCAAAGCGG - Intronic
904489567 1:30850083-30850105 CAGGCAGGAAAACAGCACAGGGG + Intergenic
905368813 1:37471664-37471686 CAGGCATACGAGAGGCAGAGGGG + Intergenic
905825125 1:41021167-41021189 CAGGCAGAGAAGCTGCAATGGGG - Exonic
906063061 1:42960778-42960800 CAGACAGATGAGCAGGAGAGTGG - Intergenic
906320060 1:44810180-44810202 CAGGCAGAGAGGCAGCGGGGAGG - Intronic
906557962 1:46729228-46729250 CCAGCAGACGTGCAGCAGAGAGG + Intergenic
906603481 1:47148836-47148858 GAGGCAGACAGGCAGGAGATAGG - Exonic
906685716 1:47761829-47761851 AAGGCAGAAAAGAAGGAGAGAGG - Exonic
906739851 1:48172474-48172496 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
906842979 1:49160317-49160339 CCAGCAGACCTGCAGCAGAGGGG - Intronic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
908592975 1:65652869-65652891 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
909403404 1:75258912-75258934 CCAGCAGACCTGCAGCAGAGGGG + Intronic
909536324 1:76740903-76740925 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
910177309 1:84443958-84443980 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
910799637 1:91132112-91132134 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
910940718 1:92530674-92530696 CCAGCAGACCTGCAGCAGAGAGG + Intronic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911270764 1:95798111-95798133 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
911669601 1:100592767-100592789 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
911982854 1:104587262-104587284 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
912150622 1:106854136-106854158 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
912235443 1:107845183-107845205 CAGCCAGACCTGCAGCAGAGAGG + Intronic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
913158430 1:116123197-116123219 CAGGCAGACCGGCAGCCGAGAGG - Intronic
913233798 1:116763438-116763460 CAGTTAGAAAAGCAGCAGTGGGG - Intronic
913531662 1:119738141-119738163 CACCCACACAAGCTGCAGAGAGG - Intronic
914908548 1:151766562-151766584 AGGGTAGATAAGCAGCAGAGTGG + Intronic
915543417 1:156582709-156582731 CACACAAACAATCAGCAGAGGGG - Intronic
915981773 1:160424841-160424863 CAGGGAGAAGAGCAGCAGATGGG + Intronic
916359656 1:163953431-163953453 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
916362948 1:163991020-163991042 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
916459659 1:165010299-165010321 CAGGAATACAGGAAGCAGAGTGG - Intergenic
916614754 1:166428710-166428732 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
916625505 1:166551697-166551719 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
916918820 1:169439948-169439970 CAATCAGAAGAGCAGCAGAGTGG - Intronic
917158053 1:172025689-172025711 CCAGCAGACCTGCAGCAGAGGGG + Intronic
917163036 1:172079876-172079898 CCAGCAGACCTGCAGCAGAGGGG - Intronic
917357863 1:174144751-174144773 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
917505141 1:175620580-175620602 CAGAGAGAAAAGAAGCAGAGGGG + Intronic
917621574 1:176801735-176801757 CATGCATAGAAGCAGCAGAAGGG - Intronic
918095446 1:181330329-181330351 CAGGCAGAGAAGAAGGGGAGAGG - Intergenic
918167135 1:181961186-181961208 CCAGCAGACATGCAGCAAAGGGG - Intergenic
918501393 1:185200503-185200525 CCAGCAGACCTGCAGCAGAGGGG - Intronic
918765702 1:188480229-188480251 CAGGCAGTAAATCAGCTGAGTGG + Intergenic
918906700 1:190505644-190505666 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
920060936 1:203226472-203226494 CAAACAGATAAGTAGCAGAGAGG + Intronic
920271976 1:204772285-204772307 CAGGCAGGCAAGCCCCAAAGTGG + Intergenic
920625116 1:207589345-207589367 CCAGCAGACCTGCAGCAGAGGGG + Intronic
920917442 1:210269311-210269333 AAGGCAGAGAAGAAGCAGACAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921401277 1:214726936-214726958 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
921626290 1:217380549-217380571 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
921692571 1:218166497-218166519 ATGGCAGAAAAGCAGTAGAGTGG + Intergenic
921748268 1:218762964-218762986 CTGGCAGACTGGCAGCATAGAGG + Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922399480 1:225237824-225237846 CAGGCAGACAAGAATAAGACAGG - Intronic
922492540 1:226029734-226029756 CAAGCAGACAGGGAGCAGACTGG + Intergenic
922666643 1:227474786-227474808 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
923061139 1:230475883-230475905 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
923066859 1:230526518-230526540 CCAGCAGACCTGCAGCAGAGTGG - Intergenic
923081298 1:230658305-230658327 CCAGCAGACCTGCAGCAGAGGGG - Intronic
923690800 1:236191579-236191601 CCAGCAGACCTGCAGCAGAGGGG - Intronic
923853543 1:237821412-237821434 CCAGCAGACCTGCAGCAGAGGGG + Intronic
924253292 1:242157588-242157610 CCAGCAGACCTGCAGCAGAGGGG - Intronic
924296126 1:242587836-242587858 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
924631549 1:245745496-245745518 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
924852406 1:247843659-247843681 CAGCCTGAGAAGCAGCAGATGGG - Intergenic
1064847796 10:19675329-19675351 CAAGCAGACAAGCAGTTCAGAGG + Intronic
1065427529 10:25620391-25620413 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1065704894 10:28463803-28463825 CAGTCAGTCATGCAGCTGAGCGG - Intergenic
1065909084 10:30285816-30285838 CGGGGATACAAGCAGCTGAGTGG + Intergenic
1065997149 10:31069770-31069792 AAGGCAGAAAAGCAGCCCAGGGG + Intergenic
1066042824 10:31568057-31568079 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1066140724 10:32501593-32501615 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1066362850 10:34747985-34748007 CAGGCAGCCATGGAGCAGAGAGG + Intronic
1066698973 10:38106230-38106252 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1066993384 10:42538966-42538988 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
1067033627 10:42897741-42897763 CAGGCAGAGAAGCAGCCCCGCGG + Intergenic
1067050078 10:43010698-43010720 CAGGCAGAGAACCACCACAGGGG + Intergenic
1067101736 10:43339174-43339196 CAGGCACACAAGAGGCAGAAAGG + Intergenic
1067136227 10:43609336-43609358 CAGGCACACATGCAGGTGAGTGG + Exonic
1067332171 10:45332890-45332912 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1067436782 10:46284336-46284358 CAAGGAGACAAGAAGCAGAGAGG + Intergenic
1067689973 10:48495561-48495583 CAGGCAGTCTGGCTGCAGAGTGG + Intronic
1067717061 10:48697899-48697921 GAGGCAGACATGCAGCAAACAGG - Intronic
1067799493 10:49349323-49349345 CAGGCAGAAAGACAGCAGTGTGG + Intergenic
1068427272 10:56883222-56883244 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1068563105 10:58539386-58539408 AAGGCTGGCAAGCAGGAGAGAGG + Intronic
1068567708 10:58593627-58593649 CCAGCAGACTGGCAGCAGAGGGG + Intronic
1068727897 10:60323772-60323794 TAGGAAGACAAGCAGGAAAGAGG + Intronic
1069139828 10:64809702-64809724 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1069799024 10:71070854-71070876 CAGGCAGACAGGCACTAGAAGGG + Intergenic
1070632599 10:78097259-78097281 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1070709330 10:78667213-78667235 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1070755426 10:78989039-78989061 CAGCCAGGTCAGCAGCAGAGCGG + Intergenic
1070782322 10:79144898-79144920 GAGACAGACACACAGCAGAGAGG - Intronic
1071107284 10:82112970-82112992 CAGGAAGACCAGGAGCAGTGTGG - Intronic
1071190166 10:83090067-83090089 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1071272513 10:84020794-84020816 TCAGCAGACCAGCAGCAGAGGGG + Intergenic
1071522543 10:86340138-86340160 CAAGCAGCCAAGCAGCGGAATGG + Intronic
1072516152 10:96185562-96185584 CCAGCAGACCAGCAGCTGAGGGG - Intronic
1072719757 10:97773135-97773157 CACCCAGGCAAGCATCAGAGGGG + Intergenic
1072872402 10:99133625-99133647 CCAGCAGACCAGCAGCAGAGGGG + Intronic
1072909481 10:99487073-99487095 CAGGCATTCTAACAGCAGAGTGG - Intergenic
1073359837 10:102889592-102889614 CAGGCAGACAGGCAGGGGAAGGG - Intronic
1074491995 10:113946698-113946720 GAAGCTGACAAGCAGGAGAGGGG - Intergenic
1074985062 10:118651527-118651549 CCGGCAGACCTGCAGCAGAGGGG - Intergenic
1075011708 10:118876022-118876044 CAGTCAGACTGGCAGCAGAAAGG + Intergenic
1075048371 10:119164202-119164224 GAGGGAGAAAAGCAACAGAGAGG + Intronic
1075798207 10:125135791-125135813 CAGGCAGGAGAGCAGCACAGGGG - Intronic
1076102494 10:127794253-127794275 CCAGCAGAAAAGCAGCAGAGTGG + Intergenic
1076423555 10:130351420-130351442 GAGGCAGGCAGGGAGCAGAGAGG - Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076670049 10:132115408-132115430 CAGGCTGACAAGCGGCTGTGCGG - Intronic
1077102787 11:829571-829593 CAGGCAGAGAAACAGCAGAGCGG - Intronic
1077276038 11:1709041-1709063 CAGGGAAAGAACCAGCAGAGAGG + Intergenic
1077561939 11:3269665-3269687 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
1077567834 11:3315485-3315507 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
1078068037 11:8090651-8090673 CAGGCAGACACGGTGCAGAGAGG - Intronic
1078444352 11:11393079-11393101 CAGGCAGTCCAGCAGCGAAGTGG + Intronic
1078624565 11:12942378-12942400 CAGACAGACTAGCAGCAGGCGGG - Intronic
1078686085 11:13533922-13533944 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1078898113 11:15616045-15616067 CAAGCAGTGAAGGAGCAGAGAGG - Intergenic
1078998450 11:16728465-16728487 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1079244543 11:18743022-18743044 CAGAAAGACCAGCAGCAGACTGG + Exonic
1079309144 11:19349286-19349308 TTGGGAGAGAAGCAGCAGAGGGG - Intergenic
1079316627 11:19412810-19412832 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1080033498 11:27687661-27687683 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1080965525 11:37210363-37210385 CAAGCAGACCTGCAGAAGAGGGG - Intergenic
1081080118 11:38731366-38731388 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1081593025 11:44438206-44438228 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1081744156 11:45461409-45461431 CAGGCAGAGAAGCCCCAGAAGGG + Intergenic
1081806120 11:45891545-45891567 CAGGCAGCCCAGCAGCAGACGGG + Intronic
1082005890 11:47418753-47418775 AAGGCAGACAAGCAGCGGCAGGG + Exonic
1082670803 11:56034001-56034023 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1082881353 11:58041263-58041285 CAGGCAGACACCCAGCTTAGGGG - Intronic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083385420 11:62305908-62305930 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1083396610 11:62396888-62396910 CAGGCAGCCAAGGAGAAAAGAGG + Intergenic
1083410451 11:62488906-62488928 CAGGAAGACAGGGGGCAGAGGGG + Intronic
1083516120 11:63261069-63261091 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1083941860 11:65900233-65900255 CAGGCAGCCCAGCAGGTGAGTGG - Exonic
1084333635 11:68444817-68444839 CAGGCAGGGAGGCAGCAGAGAGG - Intronic
1084907271 11:72357819-72357841 GAGGCAGGCAATCATCAGAGTGG + Intronic
1086067769 11:82764808-82764830 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086129307 11:83383856-83383878 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1086300234 11:85420187-85420209 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1086312189 11:85548242-85548264 CCAGCAGACTTGCAGCAGAGGGG - Intronic
1086348976 11:85925505-85925527 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1086410824 11:86542039-86542061 CTAGCAGACCTGCAGCAGAGGGG + Intronic
1086505402 11:87498582-87498604 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1086532257 11:87800438-87800460 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1086608552 11:88725772-88725794 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1087094831 11:94308142-94308164 CAGGAAGTCAAGCAGAGGAGAGG - Intergenic
1087305867 11:96488021-96488043 CGAGCAGACCTGCAGCAGAGGGG + Intronic
1087318860 11:96635944-96635966 CAGGCAGTCCAGCAGCCCAGAGG - Intergenic
1087410571 11:97785832-97785854 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1087466617 11:98515706-98515728 AAGGGAGACCAGCAGGAGAGTGG + Intergenic
1087474996 11:98623496-98623518 CAGGCAGACAAGCAGGTCATGGG + Intergenic
1087484953 11:98748790-98748812 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1087588392 11:100152115-100152137 CAGGCAGCCAAGCCACAGGGTGG - Intronic
1087667896 11:101071210-101071232 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1087695202 11:101369060-101369082 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1087868359 11:103261583-103261605 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1087925239 11:103911362-103911384 CCAGCAGACCTGCAGCAGAGCGG + Intronic
1087962237 11:104366434-104366456 CAGGCAGTCAGGCAGCCCAGCGG + Intergenic
1088211840 11:107465790-107465812 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1088307345 11:108423796-108423818 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1088534843 11:110849547-110849569 CCAGCAGACTGGCAGCAGAGGGG - Intergenic
1088704230 11:112447575-112447597 CAGGAAGAGCAGTAGCAGAGTGG - Intergenic
1089331519 11:117692195-117692217 GAGGCGGCCAAGCAGCAGGGAGG - Intronic
1089911285 11:122103079-122103101 CATGCAGACAACCGGCAGCGTGG + Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090138648 11:124228354-124228376 CAGGCAGGCAGGCAGGCGAGCGG + Intergenic
1090397987 11:126431795-126431817 CAGGCAGACACGGAGAAGGGAGG + Intronic
1090446114 11:126766199-126766221 CAGGAAGACAAGGAGAAGAGAGG - Intronic
1091088537 11:132747258-132747280 GAGGCAGAAAAGCAGCTAAGAGG + Intronic
1091563644 12:1632297-1632319 CAGGCAGATAAGAAGACGAGGGG - Intronic
1091604861 12:1941745-1941767 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1091958864 12:4673107-4673129 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1092967228 12:13656038-13656060 CAGGCAGAGAAGCAAGAGAACGG - Intronic
1093335944 12:17905324-17905346 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1093530783 12:20160849-20160871 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1093751412 12:22804361-22804383 CAGGGATACAAGCTGCTGAGTGG - Intergenic
1093902715 12:24654308-24654330 CTAGCAGACCTGCAGCAGAGAGG - Intergenic
1094133504 12:27099938-27099960 GAGGCAGAGAAGCAGAAGAGAGG - Intergenic
1094144506 12:27214421-27214443 CAGGAGGACTAGCTGCAGAGAGG + Intergenic
1094732998 12:33200104-33200126 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1094755504 12:33463604-33463626 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1094757959 12:33493457-33493479 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1095230268 12:39731404-39731426 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1095249136 12:39958263-39958285 CAGCCAGACAGGCAGTAGAAAGG - Intronic
1095488594 12:42709069-42709091 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1095832246 12:46600838-46600860 CAAGCAGACCTGCAACAGAGGGG - Intergenic
1095917929 12:47498447-47498469 CCAGCAGACCAGCAGAAGAGAGG + Intergenic
1096443014 12:51662006-51662028 CAGGCAGAGCAGCAGCAGAAGGG - Intronic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1096894937 12:54812205-54812227 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1096941954 12:55356114-55356136 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
1096983710 12:55743330-55743352 CAGGAAGCCCAGCAGCAGCGGGG - Exonic
1097009695 12:55943669-55943691 CAATCAAACAAGCAGCAGTGAGG + Intronic
1097375707 12:58840640-58840662 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1097435461 12:59548638-59548660 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1097517268 12:60620644-60620666 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1097526725 12:60746324-60746346 CCAGCAGACATGCAGAAGAGGGG + Intergenic
1097737429 12:63197113-63197135 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1097898693 12:64852742-64852764 CCAGCAGACATGCAGCAGAGAGG - Intronic
1098053039 12:66473717-66473739 CTAGCAGACCTGCAGCAGAGGGG + Intronic
1098105897 12:67069049-67069071 CAGGCAGAGGAGCAGGAGAGAGG - Intergenic
1098151762 12:67554965-67554987 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1098183081 12:67869125-67869147 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1098697161 12:73573301-73573323 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1098704702 12:73672287-73672309 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1098906553 12:76169124-76169146 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1099030939 12:77524671-77524693 CCAGCAGACTGGCAGCAGAGGGG + Intergenic
1099053360 12:77808428-77808450 ACAGCAGACAGGCAGCAGAGGGG - Intergenic
1099344451 12:81480665-81480687 CAAGCAGACCTGCAGCAGAGGGG - Intronic
1099435163 12:82634416-82634438 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1099892328 12:88605214-88605236 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1100009525 12:89936856-89936878 CAGGCAGACAGGCAGCTAATGGG + Intergenic
1100136384 12:91557669-91557691 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1100437166 12:94582291-94582313 AACGCAGACAAGCAGCAGGCGGG - Exonic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1100996170 12:100303512-100303534 CCAACAGACATGCAGCAGAGGGG - Intronic
1101069750 12:101062137-101062159 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1101296188 12:103425572-103425594 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1101472568 12:105012738-105012760 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1101601149 12:106211709-106211731 CCAGCAGACTGGCAGCAGAGGGG - Intergenic
1102225343 12:111224450-111224472 CAGGCAGACACGGAGCAGAAGGG - Intronic
1102229534 12:111252962-111252984 GAGGCATAAAAGCAACAGAGGGG - Intronic
1102345471 12:112158458-112158480 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1102429990 12:112875638-112875660 CAAACAGAGATGCAGCAGAGAGG - Intronic
1102536839 12:113588078-113588100 GAAGAAGACAAGCAGCAGAAGGG + Intergenic
1102584312 12:113912437-113912459 CAAGAAAACAGGCAGCAGAGAGG + Intronic
1103638322 12:122327676-122327698 CTGGGAAACAAGCAGCACAGGGG + Intronic
1103950631 12:124549247-124549269 CAGGCAGGCACGCAGCTGAGGGG + Intronic
1104434497 12:128745008-128745030 AAGGGAGACAAGGAGTAGAGGGG + Intergenic
1104709401 12:130974859-130974881 CAGGCAGACAAGCAGCAGAGAGG - Intronic
1104898189 12:132174346-132174368 CAGGCAGAGCAGCAGTGGAGCGG + Intergenic
1105737276 13:23284862-23284884 CTAGCAGACCTGCAGCAGAGGGG - Intronic
1105978470 13:25494543-25494565 CAGGCAAACAAACAGAAAAGCGG - Intronic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106334980 13:28776148-28776170 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1106336486 13:28788443-28788465 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1107325730 13:39240279-39240301 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1107473359 13:40712122-40712144 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1107551372 13:41479559-41479581 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
1107648268 13:42517172-42517194 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1108029974 13:46219857-46219879 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1108153885 13:47564806-47564828 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1108236938 13:48417312-48417334 CCAGCAGACCTGCAGCAGAGGGG + Exonic
1108509723 13:51145765-51145787 CAGGAAGACTGGAAGCAGAGAGG - Intergenic
1108673935 13:52720558-52720580 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1109376924 13:61508126-61508148 CAGGCTGGCAAGCAGTACAGAGG - Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109615517 13:64828908-64828930 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1109635432 13:65109146-65109168 CCAGCAGACCGGCAGCAGAGGGG - Intergenic
1109741459 13:66560925-66560947 CAGGCAGAGGAGGCGCAGAGAGG - Intronic
1109891271 13:68617538-68617560 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
1112860920 13:103829272-103829294 CCAGCAGACCGGCAGCAGAGGGG - Intergenic
1113977632 13:114241405-114241427 CTGGCAGCAATGCAGCAGAGTGG - Intronic
1114133446 14:19819940-19819962 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1114559105 14:23578142-23578164 CGGGCAGACAGGCAGAAGGGAGG + Intronic
1114626360 14:24132591-24132613 CAGGAAGACAAGGCGCAGTGGGG - Exonic
1114844995 14:26309799-26309821 CCAGCAGACTTGCAGCAGAGGGG + Intergenic
1114870017 14:26645058-26645080 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1114879303 14:26764095-26764117 CAGGCATATAAACAGCAGAAGGG - Intergenic
1115162241 14:30409713-30409735 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1115690918 14:35843436-35843458 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1115720990 14:36161476-36161498 CCAGCAGACCTGCAGCAGAGTGG - Intergenic
1115842637 14:37489704-37489726 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1116591465 14:46781190-46781212 CTGGCAGACACCCATCAGAGAGG + Intergenic
1116760905 14:49012360-49012382 TGGGAAAACAAGCAGCAGAGAGG - Intergenic
1117104372 14:52383038-52383060 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1117616977 14:57544321-57544343 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1117649976 14:57893677-57893699 CAGCCATACCAGCAACAGAGGGG + Intronic
1117655566 14:57952172-57952194 CGAGCAGACCTGCAGCAGAGGGG + Intronic
1117710800 14:58526445-58526467 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1117821961 14:59658621-59658643 CCAGCAGACTTGCAGCAGAGGGG + Intronic
1117839638 14:59846269-59846291 GAGGGACACAAGCAGCAGATGGG - Intronic
1117930437 14:60836492-60836514 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1118117483 14:62796852-62796874 CAGGAAGACTGGAAGCAGAGAGG + Intronic
1118498553 14:66333631-66333653 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1118544815 14:66874140-66874162 CCAGCAGACCTGCAGCAGAGAGG + Intronic
1118747206 14:68782797-68782819 CAGGCAGGCAAGCAGCCCACAGG + Intergenic
1118891019 14:69908956-69908978 GAGGCAGAGAAGAAGAAGAGAGG - Intronic
1119018373 14:71084102-71084124 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1119036212 14:71231977-71231999 CACGCCGACCAGCTGCAGAGAGG + Intergenic
1119288446 14:73475124-73475146 CAGCCAGACCAACAGCAAAGTGG - Intergenic
1121140675 14:91539053-91539075 CAGGCAGAAAGGCATCAGTGTGG - Intergenic
1121179783 14:91920195-91920217 CAGGCAGACAAGCCACAAATGGG - Intronic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1122066017 14:99174974-99174996 CTGGCCGACAAGCAGAAGCGCGG - Exonic
1122158359 14:99764701-99764723 CAGGCACAGAAGCAGCAGGGTGG + Intronic
1122804162 14:104248251-104248273 CAAACAGACAAGCATCTGAGTGG + Intergenic
1122832127 14:104403588-104403610 CAGGCAGGCATGCAGCAGGGTGG - Intergenic
1123429145 15:20200087-20200109 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1124271071 15:28281405-28281427 CAGGCTAGTAAGCAGCAGAGAGG - Intronic
1125288619 15:38120611-38120633 CCAGCAGACCTGCAGCAGAGTGG + Intergenic
1125314098 15:38412606-38412628 AAGGCTGACATCCAGCAGAGGGG - Intergenic
1125329903 15:38572847-38572869 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1125574332 15:40745032-40745054 CAGGCCGACGAGCTGCACAGGGG - Exonic
1126264831 15:46741901-46741923 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1126720179 15:51569715-51569737 CTAGCAGACCTGCAGCAGAGGGG + Intronic
1127317776 15:57814374-57814396 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1127373833 15:58363790-58363812 CCAGCAGACCAGCAGCAGAAGGG + Intronic
1127519296 15:59727485-59727507 CAGGCAGACAGGCAGAGGAGTGG - Intergenic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1127917952 15:63470881-63470903 CAGGCAGGCAAGCAGCGTAGTGG + Intergenic
1128365409 15:66996830-66996852 CATGCAGACAAGTACCAGATGGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128552887 15:68609606-68609628 CTGGGAGACCAGCAGCAAAGAGG - Intronic
1128883784 15:71266345-71266367 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1129198914 15:73987010-73987032 GAGGCAGGAAAGCAGCACAGAGG + Intronic
1129499043 15:76018582-76018604 CCAGCAGACCTGCAGCAGAGAGG - Intronic
1129507853 15:76098334-76098356 CTAGCAGACCAGCAGCAGAGGGG - Intronic
1129525967 15:76214595-76214617 CAGGCAGACTGGCTTCAGAGTGG - Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130724121 15:86420352-86420374 CAAGCAGACCTGCAGCAGAGGGG + Intronic
1131150573 15:90044994-90045016 CAGGCAGACTAACAGAAGAAAGG - Intronic
1131764937 15:95665519-95665541 CTGGCAGACCAGCAGCACACTGG - Intergenic
1132415816 15:101618185-101618207 CAAGGAGACAGGCAGCAAAGCGG - Intergenic
1132529624 16:439785-439807 CAGGAAGACATGAAGCAGGGAGG + Intronic
1134435458 16:14252466-14252488 CAAGCAGACACGCAGCACACAGG + Exonic
1135156807 16:20059628-20059650 CAAGGAGACAAGCAGCAGGCAGG - Intronic
1135173104 16:20203923-20203945 CAGGCATAGAGGCTGCAGAGAGG - Intergenic
1135826016 16:25729509-25729531 CAGGCAGAACAGCAATAGAGAGG + Intronic
1136079919 16:27845129-27845151 CAGGCAGGCAGGCAGCAGAGAGG - Intronic
1136855175 16:33649645-33649667 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1137692917 16:50441675-50441697 GAGGCAGACAGGCCGCAGAAAGG + Intergenic
1137819260 16:51427996-51428018 CAGGCAATCAAGCAGCAGGCAGG - Intergenic
1138279625 16:55762839-55762861 CAGGCATGCAAGCAGGAGCGAGG - Intergenic
1138504778 16:57472790-57472812 AAGGCTGGCAAGCAGCACAGAGG + Exonic
1138887020 16:61091652-61091674 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1138905891 16:61332666-61332688 CATGCAAACTAGCACCAGAGTGG - Intergenic
1139269855 16:65671827-65671849 CAGGCAGAGGAGCAGAAGTGAGG - Intergenic
1140145244 16:72300482-72300504 ACTGCTGACAAGCAGCAGAGTGG - Intergenic
1140165347 16:72544388-72544410 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1140256109 16:73337676-73337698 GAGCAAGTCAAGCAGCAGAGAGG - Intergenic
1140461727 16:75145566-75145588 CAAACAGAAGAGCAGCAGAGGGG + Intergenic
1141206800 16:81939107-81939129 CAGGCAGGCAAACAGCACTGGGG - Intronic
1141246012 16:82308662-82308684 CCAGCAGACATGCAGCAGAGGGG - Intergenic
1141321410 16:83012960-83012982 CACAAAGACAATCAGCAGAGTGG - Intronic
1141523618 16:84597732-84597754 AAGGCAGACAGGCAGCAAGGAGG - Intronic
1141898403 16:86973657-86973679 CCGACAGAGAAGCAGCAGAAGGG + Intergenic
1142314479 16:89334940-89334962 CAGACAGTCAAGCAGCAGAGTGG + Intronic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203116757 16_KI270728v1_random:1498129-1498151 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1143517945 17:7429361-7429383 CCTGCAGACAAGCAGCCCAGCGG + Intergenic
1143854470 17:9838511-9838533 CAGGTAGACAGTGAGCAGAGAGG - Intronic
1144077487 17:11732481-11732503 CAGACGGACAAGCAGTGGAGAGG - Intronic
1144150025 17:12434393-12434415 CAGGTGGGCAAGCATCAGAGTGG + Intergenic
1144517442 17:15928438-15928460 CAGGCACACATGGAGCAGGGAGG + Intergenic
1146266951 17:31459095-31459117 GAGGCAGAAAGTCAGCAGAGAGG - Intronic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146489445 17:33269679-33269701 CAGGCAGGCAGGCAGGAGGGAGG - Intronic
1146588579 17:34106491-34106513 CATGCAGACATACAGGAGAGGGG - Intronic
1146746223 17:35333173-35333195 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1146766284 17:35524610-35524632 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1146926015 17:36745966-36745988 CAGGCAGACAGGCAAGAGCGTGG + Intergenic
1147251232 17:39153640-39153662 CTGGCAGACGAGGAGCAGTGAGG - Intronic
1147401172 17:40180864-40180886 CAGACAGACAAGGTGCAGGGAGG - Intronic
1147914778 17:43879753-43879775 CAGGCTGGGAAGGAGCAGAGTGG + Intronic
1148038403 17:44686493-44686515 CAGGAAAAGGAGCAGCAGAGAGG + Intronic
1148158003 17:45434282-45434304 CCAGCCGCCAAGCAGCAGAGTGG - Intronic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149222992 17:54436738-54436760 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1149297524 17:55273931-55273953 TGGGCAGACAGGCAGGAGAGAGG - Intronic
1149577591 17:57725170-57725192 CAGGGAGACTGCCAGCAGAGAGG - Intergenic
1150124264 17:62626713-62626735 CAGGCAGGGAATCCGCAGAGAGG + Intergenic
1150389604 17:64782551-64782573 CCAGCCGCCAAGCAGCAGAGTGG - Intergenic
1150545887 17:66156270-66156292 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1151040535 17:70855351-70855373 CAGACAGACAAGGAACACAGTGG + Intergenic
1151114590 17:71721056-71721078 GAGCCAGACAAGCTACAGAGAGG + Intergenic
1151226821 17:72654199-72654221 CTGGCAGAGCAGCAGAAGAGGGG - Intronic
1151326372 17:73382255-73382277 CAAACAGACTAGCAGGAGAGGGG - Intronic
1151354259 17:73549182-73549204 CAGGCAGAGAAGCCGGAGTGAGG + Intronic
1151450653 17:74196522-74196544 CAGACACACAGGCAGCAGCGGGG + Intergenic
1151699363 17:75734788-75734810 AAGGCAGACAAGTGGCACAGAGG + Intronic
1152070086 17:78130050-78130072 CAGGTAGAGAGGGAGCAGAGAGG + Intronic
1152455999 17:80416524-80416546 CAGCCAGGGAAGGAGCAGAGGGG - Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152624763 17:81383167-81383189 CAGACAGCCAAGCAGCCAAGGGG - Intergenic
1153059279 18:979347-979369 CCAGCAGATATGCAGCAGAGGGG - Intergenic
1153078363 18:1192152-1192174 CATGCAGACAACCAGGAGAGTGG - Intergenic
1153702731 18:7712245-7712267 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1153707476 18:7760873-7760895 AAGGCAACCAAGCAGCAGAATGG - Intronic
1153717751 18:7868451-7868473 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1154054229 18:10995793-10995815 CAAGCAGAGAATCAGCATAGTGG - Intronic
1154312573 18:13278759-13278781 AAGGAAGACAAGCGGGAGAGAGG - Intronic
1155080709 18:22407365-22407387 TAGGCAGAGAAGCACCTGAGAGG + Intergenic
1155177145 18:23310705-23310727 CAGACAGACAAGCAGAAGGAAGG + Intronic
1155182947 18:23363778-23363800 AAGGCAGACAACCAGCAGTATGG + Intronic
1155665082 18:28298774-28298796 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1155828899 18:30486640-30486662 CAGGCAAAGAAGTAGCAGAAAGG + Intergenic
1155857235 18:30849526-30849548 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1156013095 18:32516419-32516441 TGGGCAGACCAGCAGAAGAGAGG + Intergenic
1156188273 18:34689398-34689420 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1156582460 18:38393457-38393479 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1156684408 18:39627368-39627390 CAAGCAGCAGAGCAGCAGAGTGG - Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157264917 18:46210421-46210443 AAGCCAGAGAAGGAGCAGAGTGG + Intronic
1157884728 18:51355652-51355674 TAGAAAGACAAGCAGAAGAGAGG - Intergenic
1157885681 18:51364158-51364180 GAGGCAGAGAGGCAGCAGAGTGG - Intergenic
1158233950 18:55291664-55291686 CAGACAGAGAAGCAGCTGATTGG - Intronic
1159113774 18:64089996-64090018 CAGGCACACAATAGGCAGAGGGG + Intergenic
1159569542 18:70096551-70096573 CCAGCAGACCAGCAGCAGAGGGG - Intronic
1160014927 18:75133297-75133319 CGTGCAGACAAGGAGCAGAGAGG - Intergenic
1160782719 19:884969-884991 CAGCCAGACCAGCAGCATCGTGG - Exonic
1161503953 19:4633932-4633954 CAGGGAGATAAGGAGCAGAGAGG + Intergenic
1161745429 19:6056762-6056784 CAGGAAGAAAAACAGAAGAGAGG - Intronic
1162908327 19:13836386-13836408 CAGGCAGACAGGCGGCAGCAGGG + Intergenic
1162936550 19:13984271-13984293 GAGGCAGGCAAGGAGCAAAGAGG - Intronic
1163093589 19:15038763-15038785 CAGGCAGAGAAACAGCACTGTGG + Intergenic
1163262883 19:16201848-16201870 CAGGCAGAGAGGCGTCAGAGGGG + Intronic
1163791048 19:19306271-19306293 CAGCCAGAAAAGCAGCAGCCTGG + Intronic
1163798788 19:19352795-19352817 CAGGGACACAGGGAGCAGAGGGG - Intronic
1164516307 19:28939131-28939153 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1164821665 19:31255696-31255718 CAGGCAGAGCAGCAGCAGAGGGG + Intergenic
1164956624 19:32392181-32392203 CAGGCAGGCAGGCAGACGAGGGG + Intergenic
1165327848 19:35124677-35124699 CATGCGCACAAGCAGCAGAGGGG + Exonic
1165415695 19:35692076-35692098 CAGTCAGACCGGCAGCAGCGTGG + Intergenic
1166995773 19:46719118-46719140 CAGGCCCACAAGGAGCAGGGAGG - Intergenic
1167293560 19:48636941-48636963 CGGGCCGCCCAGCAGCAGAGGGG + Exonic
1167428622 19:49442188-49442210 CAGGGAGAGAAGCAACAGGGAGG - Intronic
1168426380 19:56242480-56242502 CAGGGAGACAATCAGCAGAGGGG - Intronic
1168431234 19:56282465-56282487 TTGGCAGACAAGCAGCAGGAAGG - Intronic
1168665553 19:58202284-58202306 CTGGAAGGGAAGCAGCAGAGAGG + Intronic
925245207 2:2376684-2376706 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
925302332 2:2826253-2826275 CAGGCAGACACGCAGCAGGCTGG + Intergenic
925692453 2:6538566-6538588 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
925941853 2:8828215-8828237 CAGACAGAAAAGTAGCACAGAGG - Intronic
926107556 2:10161938-10161960 CAGGCAGAAAACCGGGAGAGGGG + Intronic
926107912 2:10163741-10163763 CAGGCAGAAAACCAGGAGAGGGG - Intronic
926533641 2:14082968-14082990 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
926625469 2:15086207-15086229 CAGGAAGACCAGTTGCAGAGAGG + Intergenic
926672426 2:15588682-15588704 CAGGCAGAGAAACAGCAGCCAGG - Intergenic
926943875 2:18167445-18167467 CCAGCAGACCTGCAGCAGAGGGG - Intronic
927159435 2:20243291-20243313 CTGGCAGAGCAGCAGTAGAGAGG - Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927998478 2:27503543-27503565 CATTCCGACAAGTAGCAGAGCGG + Exonic
928139507 2:28716111-28716133 CAGATAGACAAGGGGCAGAGGGG + Intergenic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929333424 2:40712179-40712201 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
929441824 2:41971002-41971024 TGGGCAGTGAAGCAGCAGAGTGG - Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929868424 2:45737546-45737568 GAGGCAGAAAAGGAGCCGAGAGG - Intronic
929960677 2:46494035-46494057 CAGTCAGACAAAGAGCAGTGGGG + Intronic
930223240 2:48767098-48767120 CCAGCAGACCTGCAGCAGAGGGG - Intronic
931030486 2:58169293-58169315 CCAGCAGACCTGCAGCAGAGGGG + Intronic
931060727 2:58526355-58526377 GGGGCACACAAGCAGCAAAGGGG + Intergenic
931074064 2:58689377-58689399 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
931151331 2:59577109-59577131 TAGGCAGGCAAGAAGCAGACTGG + Intergenic
932051912 2:68406081-68406103 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
932087496 2:68775037-68775059 GAGCCAGAGAAGCAGCCGAGGGG - Intronic
932135166 2:69222586-69222608 CAGGCAGAATAACAGCAGACCGG + Intronic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
932646672 2:73510468-73510490 CCAGCAGACCTGCAGCAGAGGGG - Intronic
933355730 2:81206892-81206914 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
933603285 2:84354836-84354858 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
934963819 2:98702314-98702336 GAGGCAGGCAAGCAGCACGGAGG + Intronic
935010844 2:99134840-99134862 CCAGCAGACCTGCAGCAGAGGGG - Intronic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
935982934 2:108644381-108644403 CCAGCAGACCTGCAGCAGAGGGG + Intronic
936448227 2:112614214-112614236 CCAGCAGACTGGCAGCAGAGGGG - Intergenic
936769431 2:115894353-115894375 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
936785957 2:116094574-116094596 CAGGCAGACAAGCAGCCTTCAGG + Intergenic
936807855 2:116358748-116358770 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
937143237 2:119619473-119619495 CCAGCAGACCTGCAGCAGAGGGG + Intronic
937230576 2:120396062-120396084 CAGGCAGACAGGCAGGGGTGGGG + Intergenic
937539055 2:122925963-122925985 CAGGGGTACAAGCAGCTGAGTGG - Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937755632 2:125534740-125534762 CAGGGAGACCAGCAGAATAGAGG + Intergenic
937872430 2:126795782-126795804 CAGGTAGGGAAGGAGCAGAGGGG - Intergenic
938221256 2:129569719-129569741 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
938509519 2:131925939-131925961 GAAGCAGACAAGCAGACGAGAGG + Intergenic
939033371 2:137102275-137102297 CCAGCAGACCTGCAGCAGAGGGG + Intronic
939381936 2:141447667-141447689 CCAGCAGACCTGCAGCAGAGGGG - Intronic
939876592 2:147585712-147585734 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
940084169 2:149839368-149839390 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
940237646 2:151528141-151528163 CAGGCAGTCTGGCTGCAGAGGGG + Intronic
940370654 2:152896763-152896785 CCAGCAGACCCGCAGCAGAGCGG + Intergenic
940758044 2:157705349-157705371 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
940788913 2:158011377-158011399 GAGCCAGAAAAGAAGCAGAGGGG - Intronic
940821499 2:158360559-158360581 CTAGCAGACCTGCAGCAGAGGGG + Intronic
940925273 2:159356863-159356885 CCAGCAGACCTGCAGCAGAGGGG + Intronic
940946616 2:159624569-159624591 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
940964611 2:159822854-159822876 CCAGCAGACCAGCAGCAGAGGGG + Intronic
941715319 2:168757315-168757337 CAGGCAGACATACAGCAAATAGG + Intronic
942010766 2:171760766-171760788 CTAGCAGACCTGCAGCAGAGAGG - Intergenic
942364027 2:175203828-175203850 CAGGCAGAAAAGCTGCATTGTGG - Intergenic
942402913 2:175622404-175622426 AATGCAGACAATCAGCAGACAGG - Intergenic
942407323 2:175669201-175669223 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
942411148 2:175709996-175710018 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
942722336 2:178966504-178966526 CCAGCAGACCTGCAGCAGAGGGG + Intronic
943153586 2:184145428-184145450 AGGGCAGGCAAGAAGCAGAGGGG - Intergenic
943552382 2:189356987-189357009 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
943660599 2:190555054-190555076 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
943836932 2:192525360-192525382 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
944094703 2:195953188-195953210 CCAGCAGACCTGCAGCAGAGGGG - Intronic
944169335 2:196757866-196757888 CCAGCAGACCTGCAGCAGAGGGG - Intronic
944347498 2:198685678-198685700 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
944421674 2:199537235-199537257 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
944993065 2:205260199-205260221 CAGGTAAAAAAGCAGCACAGTGG + Intronic
945022785 2:205590839-205590861 CAAGCAGACCGGAAGCAGAGAGG - Intronic
945628153 2:212237332-212237354 CCAGCAGACCTGCAGCAGAGGGG - Intronic
945945312 2:215989280-215989302 CCAGCAGACCTGCAGCAGAGAGG + Intronic
946054979 2:216893173-216893195 CAGGCAGACACGTTGTAGAGAGG - Intergenic
946103147 2:217344420-217344442 CAGGCATACCAGAAGAAGAGAGG + Intronic
946307286 2:218863375-218863397 CAGCCAGGCTAGAAGCAGAGAGG + Intronic
947217147 2:227759817-227759839 CAGAAAGAGAAGCAGCGGAGGGG - Intergenic
947225749 2:227838940-227838962 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
947688417 2:232112200-232112222 CTGGCAAGCAAGCAGCAGAGTGG - Intronic
947704723 2:232264957-232264979 CAGGGAGACAAGAGGCAGAGCGG + Intronic
947745701 2:232506338-232506360 CAGGGAGAGAAGAAGCAGAAAGG + Intergenic
948101209 2:235374711-235374733 AAGGAAGAAAAGTAGCAGAGAGG - Intergenic
948541197 2:238692401-238692423 CAGGCACCCAGGCAGAAGAGCGG + Intergenic
948785406 2:240349885-240349907 CAGGCAGAGATGCCGCAGACTGG + Intergenic
948786025 2:240353390-240353412 CTGGCAGACCACGAGCAGAGTGG + Intergenic
1168833587 20:861283-861305 CAGGCAGTCAAGGTGCAGAGAGG + Intergenic
1169165858 20:3423464-3423486 TAGGAAAACGAGCAGCAGAGTGG - Intergenic
1169176745 20:3522802-3522824 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1169319942 20:4624576-4624598 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1169396948 20:5240996-5241018 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1169437952 20:5610596-5610618 CAGGCAGCCCAGCAGAAGCGCGG + Intronic
1169645422 20:7804017-7804039 CAGGCAGACGAGGCGCCGAGAGG + Intergenic
1169646291 20:7813760-7813782 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1170134022 20:13053279-13053301 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1170167787 20:13380329-13380351 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1170350372 20:15434231-15434253 CAAGCAGACAATCCACAGAGTGG + Intronic
1170454715 20:16520915-16520937 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1170727228 20:18941102-18941124 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1170915885 20:20625037-20625059 CAGGCAGAAAAGCAAGAGGGAGG - Intronic
1171391861 20:24806797-24806819 CAGGCAGACACTCAGCAAAAAGG + Intergenic
1173560139 20:43998694-43998716 CAGGCCAACAAAAAGCAGAGTGG - Intronic
1173888351 20:46481283-46481305 CAGTCAGAGAGGCAACAGAGGGG + Intergenic
1174639588 20:52032001-52032023 CAGCAAGAAAAACAGCAGAGGGG - Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1175801420 20:61803067-61803089 CAGGCAGGCAATTAGCAGTGGGG - Intronic
1176719569 21:10382162-10382184 CTGGGAGACTAGCAGAAGAGAGG + Intergenic
1176783965 21:13232623-13232645 GAAGCAGACAAGCAGACGAGAGG - Intergenic
1176976528 21:15327309-15327331 CAGGACAACAAGCTGCAGAGAGG + Intergenic
1177092084 21:16781800-16781822 CCGGTAGACCTGCAGCAGAGAGG + Intergenic
1177184082 21:17774995-17775017 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1177316187 21:19464191-19464213 CAGGCAGACAGGAAGCAAAAGGG + Intergenic
1177722102 21:24920124-24920146 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1177982012 21:27926456-27926478 GAAGCAGACAAGCAGACGAGAGG - Intergenic
1178039793 21:28627786-28627808 CAGGCAGAAAAAGAGCAGGGAGG - Intergenic
1178460162 21:32795702-32795724 TAGGCAGACAAGCAGCAATTAGG + Intronic
1178669870 21:34580914-34580936 CAGGCAGGCAGGCAACACAGGGG + Intronic
1178675225 21:34625813-34625835 AAGCCAGACAGGCATCAGAGGGG - Intergenic
1178812234 21:35894770-35894792 GAGGCATCCAAGAAGCAGAGAGG - Intronic
1178864336 21:36315926-36315948 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1179425767 21:41277040-41277062 TTGGCACACAAGCAGGAGAGAGG - Intronic
1180089812 21:45528105-45528127 CAGGCAGGCCGGCAGCAGGGAGG + Intronic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1181328912 22:22074174-22074196 AAGGCAGCCAAGCAGGAGAAGGG - Intergenic
1182367413 22:29788457-29788479 AAGGCAGAGCAGCATCAGAGGGG + Intergenic
1182472091 22:30554923-30554945 CAGGCAGGCAAGCCGCTGGGCGG + Exonic
1182526591 22:30924209-30924231 CAGGCAGAAATGGAACAGAGTGG + Intergenic
1182718017 22:32375657-32375679 AAGGCAGCCAAACAGGAGAGGGG - Intronic
1182883866 22:33756702-33756724 GGGGCTGACAAGGAGCAGAGCGG + Intronic
1183021391 22:35030202-35030224 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1183491623 22:38119959-38119981 CAGAAAGACAAGCCACAGAGTGG + Intronic
1183687469 22:39369481-39369503 CAGGCAGAGGACCAGCAGGGAGG - Intronic
1184986281 22:48137782-48137804 CATGCAGCCCAGCAGCAAAGGGG - Intergenic
1185251007 22:49801745-49801767 CAGGCAGCGATGAAGCAGAGGGG + Intronic
1185269220 22:49921099-49921121 CAGGCAGCCTAGGTGCAGAGCGG - Intronic
1185392673 22:50571087-50571109 CAGGCAGACAGGAGGCAGAGGGG + Intronic
949286438 3:2411628-2411650 CAGGCAGGCAGGCAGCAGGCAGG - Intronic
949420424 3:3859291-3859313 CAGGCAGAAAAGGAGCAAGGTGG - Intronic
949583463 3:5413406-5413428 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
949683307 3:6540741-6540763 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
949846195 3:8372787-8372809 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
950059495 3:10058199-10058221 AAGGGAGACAAGCACAAGAGTGG - Intronic
950561884 3:13735656-13735678 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
950614259 3:14146701-14146723 AAGGCAAACAGGCAGCACAGAGG + Intronic
950619594 3:14194027-14194049 CCAGCAGACTGGCAGCAGAGGGG - Intronic
950630671 3:14279719-14279741 CAGGCTGGCATGCAGGAGAGAGG + Intergenic
950889196 3:16387916-16387938 CAGGAAGAAAACCAGCAGAAAGG - Intronic
950925018 3:16731559-16731581 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
951044337 3:18021602-18021624 CAGGTAGACCAGCAGCTGAAGGG + Intronic
951088935 3:18549398-18549420 CAAAAAGACAAGCAGCAGACTGG - Intergenic
951311005 3:21125749-21125771 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
951324363 3:21284991-21285013 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
951503559 3:23417303-23417325 CCAGCAGACCTGCAGCAGAGGGG - Intronic
951629012 3:24698720-24698742 CCAGCAGACTGGCAGCAGAGGGG - Intergenic
951777152 3:26323325-26323347 CCAGCAGACCTGCAGCAGAGTGG - Intergenic
951795385 3:26533250-26533272 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
952098514 3:29984665-29984687 CCAGCAGACCTGCAGCAGAGGGG - Intronic
952571733 3:34725918-34725940 CAGGCAGAAAGGCAGGAGTGGGG - Intergenic
953433458 3:42858408-42858430 CCAGCAGACCTGCAGCAGAGGGG + Intronic
953712962 3:45290549-45290571 CAAGCCGAGAAGCAGCAGAGTGG + Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954531188 3:51321212-51321234 CCAGCAGACCTGCAGCAGAGGGG + Intronic
954933996 3:54309914-54309936 CAAGCAGAGAGGAAGCAGAGAGG - Intronic
955175003 3:56605524-56605546 CCAGCAGACCTGCAGCAGAGGGG - Intronic
955228933 3:57082198-57082220 CAGGCAGAAAAGCAATGGAGAGG + Intergenic
955447911 3:59033084-59033106 CCAGCAGACCTGCAGCAGAGGGG + Intronic
955521460 3:59779400-59779422 CAGGCAGACAACCACCACAAAGG - Intronic
956157235 3:66311745-66311767 CCAGCAGACCTGCAGCAGAGGGG - Intronic
956398021 3:68846773-68846795 CCAGCAGACCTGCAGCAGAGGGG - Intronic
956460737 3:69469283-69469305 CAGCTAGAGAAGAAGCAGAGAGG + Intronic
957489549 3:80906019-80906041 CCAGCAGACCAGCAGAAGAGGGG + Intergenic
957845142 3:85722068-85722090 CAGGAAGACGAGCTGCAGAAAGG - Intronic
958257364 3:91340651-91340673 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
958261159 3:91383008-91383030 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
958434423 3:94080168-94080190 CCAGCAGACCTGCAGCAGAGGGG - Intronic
958622120 3:96575524-96575546 CTAGCAGACAGGTAGCAGAGGGG - Intergenic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958694464 3:97510442-97510464 CCAGCAGACCTGCAGCAGAGGGG - Intronic
958793689 3:98682759-98682781 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
959074648 3:101736581-101736603 CCAGCAGACCTGCAGCAGAGGGG + Intronic
959091706 3:101910721-101910743 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
959092965 3:101924300-101924322 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
959146519 3:102552381-102552403 CACGCAGACCAGCAGCATCGTGG + Intergenic
959375502 3:105584215-105584237 CGGGGATACAAGCTGCAGAGTGG + Intergenic
959735082 3:109648775-109648797 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
960378032 3:116927548-116927570 CCAGCAGACCTGCAGCAGAGGGG - Intronic
960491530 3:118321865-118321887 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
961576073 3:127837555-127837577 CAGCCAGAGAAGCAGGTGAGTGG + Intergenic
961998138 3:131268524-131268546 CCAGCAGACCTGCAGCAGAGGGG - Intronic
962027812 3:131567096-131567118 CAGTCAGACAACCAGCACATGGG - Intronic
962124943 3:132607017-132607039 CCAGCAGACCTGCAGCAGAGGGG + Intronic
962557129 3:136565027-136565049 CAGGCAGGCAGGCAGAAGGGAGG + Intronic
962642259 3:137400077-137400099 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
962765812 3:138561277-138561299 CCAGCAGACCTGCAGCAGAGGGG + Intronic
962808183 3:138941409-138941431 CAGCCAGACAAGCAGAATATGGG - Intergenic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963898771 3:150713030-150713052 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
964053197 3:152420503-152420525 CCAGCAGACCTGCAGCAGAGGGG + Intronic
964332698 3:155621147-155621169 CCAGCAGACCTGCAGCAGAGGGG + Intronic
964648986 3:158990823-158990845 CTAGCAGACCTGCAGCAGAGGGG - Intronic
964930231 3:162011040-162011062 AAGCCAGAGAAGCGGCAGAGTGG + Intergenic
965017245 3:163173911-163173933 CCTGCAGACATGCAGCAGAAGGG - Intergenic
965880567 3:173383041-173383063 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966855012 3:184187882-184187904 CAGCCAGGCAGGCAGCAGAAAGG + Exonic
967181391 3:186908791-186908813 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
967562562 3:190934272-190934294 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
968311687 3:197688852-197688874 CAGAAAGACGAGCAGCTGAGTGG + Intronic
968885024 4:3324262-3324284 CAGGAAGACAACCAGCTCAGTGG + Intronic
968899065 4:3422345-3422367 CAGCGAGACAAGCAGCCGTGAGG - Intronic
968976974 4:3827247-3827269 CAGGCAGACATGGAGTGGAGGGG + Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
969304678 4:6318813-6318835 CACGCAGGGAAGCAGCAAAGCGG - Intergenic
969591246 4:8123029-8123051 CAGGAAGAGCAGCAGCAGATAGG - Intronic
969719780 4:8887167-8887189 CAGGCAAAGAAGCAACAGAGAGG - Intergenic
969728274 4:8938768-8938790 CAGGCAGACATGGAGCAGAGGGG + Intergenic
969970923 4:11047508-11047530 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
970264249 4:14263794-14263816 CTTGAAGACAAGCAGCATAGTGG - Intergenic
970355295 4:15245228-15245250 CAGGCAGATAAGCATCTGTGAGG - Intergenic
970510043 4:16772897-16772919 TAGGCAGACAAACAGAACAGTGG + Intronic
970641256 4:18068953-18068975 CAGGAAGACAACCAGAAGAATGG + Intergenic
970727281 4:19061028-19061050 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
971120385 4:23697876-23697898 AAGGCAGGCAGGCAACAGAGAGG - Intergenic
971267120 4:25105577-25105599 GAGGCAGACAAGGAGCCGGGTGG - Intergenic
971429954 4:26555768-26555790 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
971647780 4:29230508-29230530 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
971673505 4:29594952-29594974 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
971679139 4:29674030-29674052 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
971869125 4:32213082-32213104 CATGAAGGCAAGCAGCATAGTGG - Intergenic
971883347 4:32410251-32410273 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
972165647 4:36280882-36280904 CAGGCAGATGGGCAGCAGTGGGG + Intergenic
972582603 4:40407806-40407828 CAGTCAGAGAAGCAGGAGGGTGG - Intergenic
972743171 4:41908761-41908783 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
972755667 4:42042962-42042984 CCAGCAGACCTGCAGCAGAGAGG + Intronic
972982769 4:44726118-44726140 CAGGCAAACGCGCAGCTGAGGGG - Intronic
973661024 4:53106104-53106126 CTAGCAGACCTGCAGCAGAGGGG + Intronic
973715120 4:53669070-53669092 CCAGCAGACCTGCAGCAGAGGGG - Intronic
974106138 4:57472128-57472150 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
974280126 4:59781020-59781042 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
974453199 4:62093595-62093617 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
974975471 4:68886182-68886204 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
975149303 4:71004212-71004234 CCAGCAGACTTGCAGCAGAGGGG - Intronic
975424872 4:74214462-74214484 CCAGCAGACCTGCAGCAGAGGGG - Intronic
975466238 4:74713214-74713236 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
975484076 4:74915423-74915445 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
975638890 4:76478865-76478887 CTAGCAGACCTGCAGCAGAGGGG + Intronic
975707801 4:77128274-77128296 CAGGGATACAAGCTGCTGAGAGG - Intergenic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976065647 4:81184381-81184403 CCAGCAGACCTGCAGCAGAGGGG + Intronic
976092818 4:81474551-81474573 CCAGCAAACCAGCAGCAGAGGGG + Intronic
976121622 4:81789746-81789768 CAGGCAGACAGCAAGCAGAATGG + Intronic
976193712 4:82513325-82513347 CCAGCAGACCTGCAGCAGAGGGG + Intronic
976363160 4:84203501-84203523 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
976370906 4:84286819-84286841 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
976395015 4:84545842-84545864 CCAGCAGACATGCAGCAGAGGGG + Intergenic
976438402 4:85044534-85044556 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
976445876 4:85129377-85129399 CAAGCAGACCTGCAGCAGAGAGG - Intergenic
976636620 4:87292678-87292700 CAGGGGGACAAGCGGCAGAGGGG + Intergenic
976655821 4:87488347-87488369 CCAGCAGACCTGCAGCAGAGGGG - Intronic
976716042 4:88123063-88123085 CCAGCAGACCTGCAGCAGAGAGG + Intronic
976903417 4:90207751-90207773 CCAGCAGACCTGCAGCAGAGGGG - Intronic
977403936 4:96572131-96572153 CAGGCAGAAAAGCAACAGTCTGG + Intergenic
977467646 4:97402606-97402628 CCAGCAGACCTGCAGCAGAGGGG - Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
977500364 4:97829261-97829283 CCAGCAGACCTGCAGCAGAGTGG + Intronic
977655280 4:99514308-99514330 CAAACAGACAACCTGCAGAGTGG + Intronic
977671499 4:99699957-99699979 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
977774522 4:100901333-100901355 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
977793035 4:101129631-101129653 CCAGCAGACCTGCAGCAGAGGGG + Intronic
977871530 4:102096144-102096166 TTGGGAGAGAAGCAGCAGAGAGG - Intergenic
977986285 4:103386269-103386291 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
977994567 4:103485648-103485670 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
978105907 4:104901595-104901617 CAGGCAGAGGAGCAGAGGAGTGG + Intergenic
978157911 4:105510428-105510450 AAGGCAGACAGGCAGGAGAGTGG - Intergenic
978278228 4:106977993-106978015 CCAGCAGACCTGCAGCAGAGAGG - Intronic
978477162 4:109144149-109144171 CCAGCAGACCTGCAGCAGAGGGG - Intronic
978699670 4:111627705-111627727 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
978838916 4:113186286-113186308 CCAGCAGACCTGCAGCAGAGGGG + Intronic
979115373 4:116815983-116816005 CCAGCAGACCAGCAGAAGAGGGG + Intergenic
979417557 4:120461545-120461567 CTGGCAGACCTGCAGCAGAGGGG + Intergenic
979457707 4:120944961-120944983 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
979461517 4:120989948-120989970 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
979588146 4:122445565-122445587 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
980157536 4:129125781-129125803 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
980176649 4:129354174-129354196 CAGGCAGATAAGCAGCAGGAAGG + Intergenic
980513394 4:133822990-133823012 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
980540256 4:134184382-134184404 CAGAAAGACAAGCAACAGACTGG + Intergenic
980797363 4:137701587-137701609 CTAGCACAGAAGCAGCAGAGTGG + Intergenic
981273279 4:142868599-142868621 CCTGCAGACCTGCAGCAGAGGGG + Intergenic
981553637 4:145967655-145967677 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
981749967 4:148083427-148083449 CCAGCAGACCTGCAGCAGAGGGG + Intronic
981859748 4:149340803-149340825 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
982018766 4:151182478-151182500 CAGGCCCCCAGGCAGCAGAGTGG + Intronic
982060168 4:151597282-151597304 CCAGCAGACCTGCAGCAGAGGGG - Intronic
982794435 4:159628979-159629001 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
982820088 4:159934333-159934355 CAGGCAAACAGGCTCCAGAGTGG - Intergenic
982825838 4:160002546-160002568 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
983064762 4:163195440-163195462 CATGCAGATAAGCAGCACGGAGG - Intergenic
983492038 4:168399460-168399482 CAGGCATGCTAGCTGCAGAGGGG - Intronic
983788153 4:171759947-171759969 CCAGCAGACTAGCAGCAGAGGGG + Intergenic
983939379 4:173524601-173524623 CAGCCAGACACCCAGCAGACCGG - Intergenic
983949349 4:173621822-173621844 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
984032298 4:174619031-174619053 CCAGCAGACGGGCAGCAGAGGGG + Intergenic
984618746 4:181927913-181927935 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
984903061 4:184601565-184601587 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
985523124 5:388482-388504 CTGGGAGAAAAGCAGCAGTGGGG - Intronic
985727108 5:1522386-1522408 CAGGCAGAGCGGCGGCAGAGGGG + Intronic
985884197 5:2663776-2663798 CAGGGAGAGAGGCAGCAGAAAGG - Intergenic
986005910 5:3669179-3669201 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
986179085 5:5376600-5376622 CAAGAAGACAAGCAGCAAGGTGG + Intergenic
986313701 5:6572479-6572501 CAGGCAGACAAGCTGCAAAGAGG - Intergenic
986322973 5:6648977-6648999 CAGGCAGACCTGCAGCAGAGGGG - Intronic
986757697 5:10853553-10853575 CAGGCAGACAGGATGCCGAGAGG - Intergenic
987923978 5:24317221-24317243 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988197059 5:28017328-28017350 CAAGCAAGCAAGCAGCAGGGAGG + Intergenic
988554670 5:32225655-32225677 GATGGGGACAAGCAGCAGAGTGG + Intergenic
988772483 5:34447044-34447066 CCAGCAGACCAGCAGCACAGGGG - Intergenic
988961427 5:36375162-36375184 GAGGGAGACAAGCATGAGAGAGG + Intergenic
989364045 5:40635345-40635367 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
989624003 5:43412303-43412325 CAGGCAGGAATGCAGCAGAGAGG - Exonic
989825432 5:45848657-45848679 CCAGCAGACATGCAGCAGAGAGG + Intergenic
990045555 5:51426214-51426236 CAGGCAAACAAGAAGCATAAAGG - Intergenic
990164241 5:52977164-52977186 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
990183666 5:53190601-53190623 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
990382421 5:55230844-55230866 CAGGCACACAAGCAGAAGTGGGG - Intergenic
990424949 5:55678042-55678064 AAGGCAGAAAAGTAGAAGAGAGG + Intronic
990837907 5:60042682-60042704 CCAGCAGACCTGCAGCAGAGAGG + Intronic
990965896 5:61447555-61447577 TAGGCAGTCAGGCAGCAGCGTGG + Intronic
991017366 5:61946187-61946209 CAGGCAGGCAGGCAGCAGCCGGG - Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991223673 5:64243976-64243998 CCAGCAGACCTGCAGCAGAGGGG + Intronic
991236795 5:64407792-64407814 CAAACAGACAGGCAGCAAAGGGG + Intergenic
991283136 5:64939370-64939392 CGTGCAGACCTGCAGCAGAGGGG - Intronic
992077971 5:73207956-73207978 CTAGCAGACCTGCAGCAGAGAGG + Intergenic
992287385 5:75249013-75249035 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
993165954 5:84355539-84355561 CCAGCAGACCTGCAGCAGAGGGG - Intronic
993381758 5:87217147-87217169 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
993698554 5:91091771-91091793 CAAGCAGTCAAGCAGAAGAAAGG + Intronic
993891789 5:93483333-93483355 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
993911657 5:93690927-93690949 CCAGCAGACCTGCAGCAGAGGGG + Intronic
994137861 5:96308710-96308732 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
994609630 5:102019458-102019480 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
994622379 5:102178833-102178855 CCAGCAGACCAACAGCAGAGGGG - Intergenic
995815820 5:116166729-116166751 CCAGCAGACTTGCAGCAGAGGGG + Intronic
996234419 5:121108591-121108613 CCGGCGGACCAGCAGCAGAGAGG - Intergenic
996427808 5:123334600-123334622 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
996536768 5:124585653-124585675 CAAGCAGACGAACAGCAGAACGG - Intergenic
996953199 5:129152731-129152753 CCAGCAGACATGCAGCAGAGGGG - Intergenic
996987395 5:129584149-129584171 CCAGCAGACCTGCAGCAGAGGGG - Intronic
997013666 5:129905711-129905733 CTGGCAGAGAAGCAGCGGAGGGG - Intronic
997235428 5:132269569-132269591 CAGGCAGACCAGCAGTTGGGTGG - Intronic
997260499 5:132462485-132462507 CCAGCAGGGAAGCAGCAGAGAGG - Exonic
997416233 5:133731001-133731023 CAAGCAGATCAGCATCAGAGCGG - Intergenic
998054528 5:139063068-139063090 CAGGCAGACAAGAAGCAGGGAGG + Intronic
998522949 5:142817194-142817216 CAGGCAGAGAAGCAGATGGGAGG + Intronic
998751988 5:145333023-145333045 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
998768315 5:145512871-145512893 CCAGCAGACCTGCAGCAGAGAGG + Intronic
998934293 5:147217251-147217273 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
998972672 5:147610437-147610459 CCAGCAGACTTGCAGCAGAGGGG - Intronic
999322164 5:150622314-150622336 CATGGAGACAGGCAGTAGAGAGG - Intronic
999984033 5:156985330-156985352 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1000406584 5:160893929-160893951 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1000582123 5:163047894-163047916 CCAGCAGACCGGCAGCAGAGGGG - Intergenic
1000590134 5:163147617-163147639 CCAGCAGACCAGCAGAAGAGAGG + Intergenic
1000838318 5:166183584-166183606 CAGGAAGACAAAAAGGAGAGAGG - Intergenic
1000860320 5:166449782-166449804 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1001346292 5:170902776-170902798 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1001362561 5:171102853-171102875 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1001965967 5:175910186-175910208 CAGGGATACCAGGAGCAGAGGGG - Intergenic
1002250979 5:177929014-177929036 CAGGGATACCAGGAGCAGAGGGG + Intergenic
1002530748 5:179843087-179843109 CAAGCAGGCAAGCAGAAGTGTGG + Intronic
1002856156 6:1039931-1039953 CAGGCATCCAGGCACCAGAGAGG + Intergenic
1003416787 6:5917100-5917122 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1004099408 6:12593492-12593514 CAAGCAGACCAGTAGGAGAGAGG + Intergenic
1004147837 6:13085664-13085686 CAGGCAGACAAAAAGAAGTGAGG + Intronic
1004253041 6:14037886-14037908 CAAGCTGTCAAGCAACAGAGGGG - Intergenic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004586935 6:17011855-17011877 TAGGCAGAGAACCAGGAGAGTGG - Intergenic
1004742750 6:18477860-18477882 CAGACAGAGTGGCAGCAGAGGGG - Intergenic
1005274293 6:24199397-24199419 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1005592310 6:27341441-27341463 AAGGAAGCCAAGCAGCAGTGTGG + Intergenic
1005682250 6:28218645-28218667 TAGGCAGAGAATCAGCACAGGGG + Intergenic
1006143092 6:31942812-31942834 AAGGCAGACAGGTAGCAGTGGGG + Intronic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006376724 6:33675688-33675710 CAGGAAGACAAGCAGCATGCTGG + Exonic
1006392288 6:33765587-33765609 CAGCCAGAGCCGCAGCAGAGAGG - Intergenic
1006417058 6:33910880-33910902 CAGGCAGGCAGGCAGCAGGTAGG - Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1007353737 6:41294726-41294748 CATGCACACATGCAGCAGCGGGG - Intergenic
1007833209 6:44654640-44654662 CAGGCAGAGCAGCGGCAGGGAGG - Intergenic
1007858245 6:44879813-44879835 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1008575354 6:52855804-52855826 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1008737308 6:54561291-54561313 CAGGAAGTCAAGGAGCAAAGTGG + Intergenic
1008865520 6:56204870-56204892 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1008997941 6:57680372-57680394 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1009182610 6:60536232-60536254 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1009290203 6:61870760-61870782 CCAGCAGACGTGCAGCAGAGGGG + Intronic
1009607279 6:65888209-65888231 CAGGCAGGCTAGCAGAAGTGGGG + Intergenic
1009652164 6:66489951-66489973 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1009727765 6:67557608-67557630 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1009776967 6:68217879-68217901 CCAGCAGACCGGCAGCAGAGGGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009945260 6:70335881-70335903 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1010006339 6:70998897-70998919 CCAGCAGACTGGCAGCAGAGGGG + Intergenic
1010039042 6:71360573-71360595 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1010134517 6:72535045-72535067 CTGGCAGACAGGCATCAGATAGG - Intergenic
1010446903 6:75959133-75959155 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1010459564 6:76098433-76098455 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1010587986 6:77678248-77678270 CAGGCCGAATAGCAGCAGAAGGG - Intergenic
1010659997 6:78558388-78558410 CAAGCAGACAACCAGCAGAATGG - Intergenic
1010681695 6:78806892-78806914 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1011120194 6:83943348-83943370 CCAGCAGACTTGCAGCAGAGGGG + Intronic
1011174204 6:84541701-84541723 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1011199750 6:84822806-84822828 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
1011318595 6:86065046-86065068 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1011332657 6:86227618-86227640 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1011472233 6:87719287-87719309 CAGGCTGACAGGGAGCTGAGTGG + Intergenic
1011611814 6:89159305-89159327 AAGCCAGACAATCAGGAGAGAGG + Intronic
1012815629 6:104018766-104018788 CAGTCAGAGAAGCAGCATGGAGG - Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013200618 6:107891811-107891833 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1013625551 6:111934221-111934243 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1013638944 6:112054377-112054399 CAGGCCAGCAAGCAGAAGAGTGG - Exonic
1013682697 6:112542233-112542255 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1013901798 6:115165907-115165929 CCAGCAGACCGGCAGCAGAGGGG - Intergenic
1014225200 6:118839676-118839698 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1014430898 6:121369114-121369136 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1014569142 6:122987077-122987099 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1014922534 6:127229375-127229397 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1014968077 6:127781648-127781670 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1015125031 6:129744743-129744765 TAGGGAGAGAAGCTGCAGAGTGG - Intergenic
1015155844 6:130095463-130095485 CAGTCAGACAAGCAACAAAAAGG - Intronic
1015288527 6:131511290-131511312 TGGGCAGACAAGCAGAAGAGTGG + Intergenic
1015290276 6:131531437-131531459 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1015471957 6:133615472-133615494 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1015500869 6:133931574-133931596 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1015883179 6:137890642-137890664 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1016483392 6:144507518-144507540 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1016542272 6:145178835-145178857 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1016590986 6:145742820-145742842 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1016638444 6:146322153-146322175 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1016855920 6:148670855-148670877 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1016863919 6:148747588-148747610 CAGGCAGAAGACCAGCAGGGTGG - Exonic
1016902496 6:149116199-149116221 CAGGAACTCAGGCAGCAGAGAGG + Intergenic
1016985793 6:149895012-149895034 CCAGCAGACTGGCAGCAGAGGGG - Intronic
1017197311 6:151716091-151716113 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1017571520 6:155749474-155749496 CCGGCAGACCTGCAGCAGAGGGG + Intergenic
1018094424 6:160373260-160373282 CCAGCAGACTTGCAGCAGAGGGG - Intronic
1018497073 6:164359527-164359549 CAGGAATACAAGCAGCTGAGTGG - Intergenic
1018616622 6:165692558-165692580 CACGAAGACCAGCAGGAGAGAGG - Intronic
1018688031 6:166318746-166318768 GAGGGTGACAAGGAGCAGAGGGG - Intergenic
1019314370 7:377632-377654 CAGGCACAAAAGAAGCCGAGGGG + Intergenic
1020143508 7:5625127-5625149 GAGGCTCACAAGCAGCAGAGTGG + Intronic
1020334788 7:7054654-7054676 CAGGAAGAGAATCAGGAGAGTGG + Intergenic
1020338884 7:7088529-7088551 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1020358168 7:7300563-7300585 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1020367131 7:7393214-7393236 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1020428725 7:8097027-8097049 CCAGCAGACTGGCAGCAGAGGGG + Intergenic
1020519488 7:9168623-9168645 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1020629836 7:10626257-10626279 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1020636071 7:10696774-10696796 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1021023544 7:15635434-15635456 TAAGCAGATAAGGAGCAGAGAGG - Intronic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021484053 7:21147408-21147430 CCAACAGACCAGCAGCAGAGGGG + Intergenic
1021556845 7:21928189-21928211 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1021805736 7:24353025-24353047 CCAGCAGACCAGCAGCTGAGAGG + Intergenic
1021987498 7:26111101-26111123 CAGTCAGCAAAGCAGCAGAGTGG + Intergenic
1022045136 7:26616829-26616851 CAGGCAGAAAAGAAGTAGTGTGG + Intergenic
1022058741 7:26769707-26769729 CCGGCAGACCTGCAGAAGAGAGG - Intronic
1022182860 7:27939351-27939373 CAGGCTGAGAAGCAGCACTGTGG + Intronic
1022704243 7:32787860-32787882 CAGGGAGACCAGAGGCAGAGGGG + Intergenic
1022884539 7:34628994-34629016 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1022908425 7:34877602-34877624 CAGGGAGACCAGAGGCAGAGGGG + Intronic
1023511523 7:40958919-40958941 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1023699914 7:42882793-42882815 CAGGCATACCAGCTGCAGTGGGG + Intergenic
1024153066 7:46591850-46591872 CCAGCAGACTGGCAGCAGAGGGG + Intergenic
1024372813 7:48606471-48606493 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1024946886 7:54817357-54817379 CAGGAAGACGAGAAGCAGGGAGG - Intergenic
1024950414 7:54855278-54855300 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1025787986 7:64660790-64660812 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1026360970 7:69600127-69600149 CGGGCAGACAGGCAGCAGGAGGG + Intronic
1026765026 7:73154997-73155019 CCGGCAGAGCAGCAGCCGAGGGG - Intergenic
1027342148 7:77221041-77221063 CAGGAACACAAGCAAGAGAGAGG + Intronic
1027455281 7:78383560-78383582 AAAGAAAACAAGCAGCAGAGTGG - Intronic
1027790496 7:82634266-82634288 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1027910611 7:84245607-84245629 CTAGCAGACCTGCAGCAGAGGGG - Intronic
1028142283 7:87287663-87287685 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1028144406 7:87305240-87305262 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1028327120 7:89540848-89540870 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1028337424 7:89674424-89674446 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1028523741 7:91759966-91759988 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1028659533 7:93253605-93253627 AAGGCAGAGCAGCAGCAGTGGGG + Intronic
1028782803 7:94756886-94756908 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1028991363 7:97051776-97051798 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1029122593 7:98278821-98278843 CAGGGACACAAGTAGCAGACAGG - Intronic
1029151691 7:98484770-98484792 CAGGCAGACCACCAGGGGAGGGG - Intergenic
1029153713 7:98499940-98499962 TATGCAGACAAGCGGCAGAGAGG - Intergenic
1029507830 7:100973141-100973163 AGGGCAGACCAGCATCAGAGAGG + Intronic
1029622653 7:101699634-101699656 CAGGCAGACAGAAAGCAGACTGG + Intergenic
1029690406 7:102177593-102177615 CAGGCAGGGGAACAGCAGAGTGG - Intronic
1029817083 7:103107138-103107160 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1030081976 7:105786157-105786179 CAAGCTGACAAGCAGCAATGGGG - Intronic
1030140932 7:106303739-106303761 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1030159646 7:106493779-106493801 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1030245265 7:107378156-107378178 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1030258044 7:107533061-107533083 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1030403680 7:109084116-109084138 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1030534134 7:110744634-110744656 CCAGCAGACCTGCAGCAGAGAGG + Intronic
1031198758 7:118650395-118650417 CAGGCACAAAGGCGGCAGAGTGG + Intergenic
1031570841 7:123357224-123357246 CATGGAGACAAGCAGCAGCTGGG + Intergenic
1032463239 7:132127053-132127075 GAGGAAGACAAGAAACAGAGTGG - Exonic
1033679491 7:143580178-143580200 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1033680141 7:143585278-143585300 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1033691695 7:143744164-143744186 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1033692345 7:143749265-143749287 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1033997481 7:147368973-147368995 AAGGCAGAGAAGTAGCAGAAAGG + Intronic
1034399835 7:150854939-150854961 CAGACAGACAGGTAGCAGAGAGG - Intronic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034469099 7:151246285-151246307 CAGGGACACAGGGAGCAGAGTGG - Intronic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1034666660 7:152823642-152823664 CAAGCAGACAAACTGCACAGGGG - Intronic
1035068994 7:156127281-156127303 CAGGAAGAACAGGAGCAGAGAGG + Intergenic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035710859 8:1712767-1712789 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1037049667 8:14356087-14356109 CAGCCACACAAACACCAGAGTGG + Intronic
1037074457 8:14696638-14696660 AAGCCAGATAAGCAGAAGAGAGG - Intronic
1037258173 8:16979070-16979092 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1037608844 8:20459456-20459478 CAGGCAGGCAGGGAGGAGAGGGG + Intergenic
1037664636 8:20957171-20957193 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1037804529 8:22051628-22051650 CTGGCAGACAGAGAGCAGAGCGG - Intronic
1038211682 8:25523928-25523950 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1038513227 8:28160542-28160564 GAGGCAGAGGAGCAGGAGAGGGG + Intronic
1039283076 8:36007298-36007320 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1039284655 8:36027235-36027257 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1039660004 8:39450829-39450851 CAAGCAGACCAGCAGATGAGGGG + Intergenic
1039750550 8:40474376-40474398 CAGGCAGCAAGGCAGCAGTGTGG + Intergenic
1040076886 8:43246327-43246349 CTGGCAGAGGAGGAGCAGAGCGG + Intergenic
1040341390 8:46442907-46442929 CAGGCAGGCAAGGGGCAGAAAGG - Intergenic
1040342643 8:46448667-46448689 CAGGCAGAGGGGAAGCAGAGAGG - Intergenic
1040355099 8:46609311-46609333 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1040473755 8:47759361-47759383 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1040780005 8:51095856-51095878 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1040942939 8:52851925-52851947 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1040976656 8:53200952-53200974 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1041017640 8:53607729-53607751 CAGGCAAACATGCAGCATGGTGG + Intergenic
1041050918 8:53933000-53933022 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1041856420 8:62460639-62460661 CAGCCTGGCAAGCATCAGAGAGG + Intronic
1041874659 8:62674275-62674297 CTGGCAGACAGGCAGCAGGCAGG - Intronic
1042070708 8:64930673-64930695 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1042111035 8:65380832-65380854 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1042478910 8:69281082-69281104 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1043047882 8:75351078-75351100 CAAACAGACAAGCCACAGAGTGG + Intergenic
1043748817 8:83909445-83909467 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044267832 8:90204055-90204077 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1044962379 8:97543151-97543173 CAGGTGGACCAGCTGCAGAGAGG + Intergenic
1044987501 8:97768272-97768294 CTGGCAGAAAAGGAGCAGTGTGG + Intergenic
1045783784 8:105897859-105897881 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1046067877 8:109218266-109218288 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1046106607 8:109673419-109673441 CCGGCAGACCTGCAACAGAGGGG + Intronic
1046295970 8:112219003-112219025 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1046886915 8:119377252-119377274 CCAGCAGACTGGCAGCAGAGGGG + Intergenic
1047604216 8:126458145-126458167 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1047697753 8:127419678-127419700 CAGGCAGGCAGAAAGCAGAGTGG + Exonic
1048422686 8:134292868-134292890 CAGGAGGACATGCAGCTGAGAGG + Intergenic
1048467151 8:134674880-134674902 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1048931571 8:139319445-139319467 CAGGCAGGTAAGCAGGTGAGTGG + Intergenic
1049065752 8:140312419-140312441 CAGGCAAACAAGATGCAGAAAGG - Intronic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1049369975 8:142259737-142259759 CAGGCAGGGAAGTAGCAGAACGG - Intronic
1049769556 8:144373591-144373613 CTGGAAGACAACCAGGAGAGTGG - Intronic
1050060143 9:1699975-1699997 CTGGCAGCCAAGCAGGAGAATGG - Intergenic
1050120119 9:2299382-2299404 CAGCCACACAAGCTGCAGTGTGG - Intergenic
1050201238 9:3148264-3148286 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1050234281 9:3562143-3562165 CCAGCAGACATGCAGAAGAGGGG - Intergenic
1050300396 9:4252866-4252888 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1050368925 9:4901337-4901359 CCAGCAGACCTGCAGCAGAGTGG - Intergenic
1050404583 9:5293897-5293919 CCAGCAGACTGGCAGCAGAGGGG + Intergenic
1050943057 9:11485005-11485027 CCAGCAGACATGTAGCAGAGGGG - Intergenic
1051212609 9:14760630-14760652 CAGACAAACAAGCTTCAGAGAGG + Intronic
1051230571 9:14950614-14950636 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1051356210 9:16241724-16241746 CAGGGAGATGAGCCGCAGAGTGG + Intronic
1051548821 9:18306080-18306102 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1051670364 9:19504325-19504347 CCAGCAGACCTGCAGCAGAGTGG - Intergenic
1052125035 9:24764651-24764673 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1052336280 9:27323864-27323886 CCGGCAGACCTGCAACAGAGGGG - Intergenic
1052366095 9:27614187-27614209 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1052382233 9:27784459-27784481 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1052505185 9:29344248-29344270 CAGGCAGACATGTATAAGAGTGG - Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052882564 9:33612694-33612716 CAGGAAGAAAAGCAGCAGGAAGG - Intergenic
1053154695 9:35768793-35768815 CAGGTAGATAAGCAGGAGAGGGG + Intergenic
1053271126 9:36750205-36750227 CTGGCAGAAATGCAGCAGAAAGG - Intergenic
1053310046 9:37012156-37012178 CAGGCAGCCAGGCAGCAGAACGG + Intronic
1053684345 9:40507365-40507387 CTGGGACACATGCAGCAGAGGGG + Intergenic
1053739423 9:41124382-41124404 CTGGCAGACCAGGAGCAGGGGGG + Intergenic
1054279380 9:63117588-63117610 CTGGGACACATGCAGCAGAGGGG - Intergenic
1054297439 9:63342829-63342851 CTGGGACACATGCAGCAGAGGGG + Intergenic
1054395457 9:64647337-64647359 CTGGGACACATGCAGCAGAGGGG + Intergenic
1054430103 9:65152537-65152559 CTGGGACACATGCAGCAGAGGGG + Intergenic
1054500280 9:65868995-65869017 CTGGGACACATGCAGCAGAGGGG - Intergenic
1054688928 9:68306940-68306962 CTGGCAGACCAGGAGCAGGGGGG - Intergenic
1055125605 9:72716014-72716036 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1055156112 9:73065273-73065295 CAAGGATACAAGCAGCTGAGTGG + Intronic
1055571883 9:77624657-77624679 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1056003421 9:82242256-82242278 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1056085750 9:83147962-83147984 CAAGCAGATGAGCAGAAGAGCGG - Intergenic
1056385044 9:86090002-86090024 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1056503761 9:87236783-87236805 TATTCCGACAAGCAGCAGAGTGG - Intergenic
1056678480 9:88696826-88696848 GAGGCTGACAGGCAGCAAAGAGG - Intergenic
1056788469 9:89610099-89610121 CAGGCAGGCAAGGATCAGTGGGG - Intergenic
1056842321 9:90008415-90008437 CAGGCAGACAGGAAGCACACAGG + Intergenic
1057192181 9:93094427-93094449 CAGGCACACAAGCAGATGAGAGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057763773 9:97898255-97898277 AAGGCAGAGAAGGAGCAGAAAGG + Intergenic
1057858877 9:98624249-98624271 CAGGAAGGCAAGCAGCAGACAGG + Intronic
1058393297 9:104521061-104521083 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1058492451 9:105516577-105516599 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1059336664 9:113573367-113573389 GAGGAAGGCAAGGAGCAGAGGGG + Intronic
1059407524 9:114110692-114110714 CAGGTAGGCAAGTGGCAGAGCGG + Intergenic
1059415188 9:114157807-114157829 GAGAAAAACAAGCAGCAGAGTGG - Intronic
1060312486 9:122475098-122475120 CAGGCAGACAAGGAGCAGCCTGG + Intergenic
1061267387 9:129514644-129514666 CAGGAAGGCCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1062193074 9:135257585-135257607 CAGGGAGGCTGGCAGCAGAGTGG - Intergenic
1185643586 X:1601324-1601346 CAGGCGGGCCAGCAGCAGGGAGG + Exonic
1185911260 X:3982904-3982926 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1186056492 X:5654869-5654891 TAGGCAGAAGAGCAGCAGAGTGG - Intergenic
1186075280 X:5871674-5871696 CAGGCAGAAAAGAAGGAGAAGGG + Intronic
1186277764 X:7958250-7958272 CAGGCAAACAAACAACACAGGGG - Intergenic
1186599697 X:11024052-11024074 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1186929239 X:14370079-14370101 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1187384280 X:18833198-18833220 CAAGGATACAAGCAGCTGAGTGG + Intergenic
1188201791 X:27300403-27300425 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1188296465 X:28456071-28456093 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1188893190 X:35635628-35635650 CCAGCAGACCTGCAGCAGAGAGG - Intergenic
1189189733 X:39089693-39089715 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1189210707 X:39279957-39279979 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1189590743 X:42507902-42507924 TTGGCAGACCTGCAGCAGAGGGG + Intergenic
1189937871 X:46088006-46088028 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1190341351 X:49299262-49299284 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1190774941 X:53545075-53545097 CAGGCAGGCCATCAGGAGAGAGG + Exonic
1191039401 X:56063417-56063439 CCAGCAGACTTGCAGCAGAGGGG - Intergenic
1191088621 X:56596918-56596940 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1191113843 X:56831836-56831858 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1191133190 X:57037295-57037317 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1191139010 X:57095530-57095552 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1191153350 X:57243634-57243656 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1191168439 X:57417483-57417505 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1191206807 X:57842965-57842987 CAAGCAGACCTGCAGCAGAGGGG + Intergenic
1191244583 X:58215939-58215961 CAGGCATTCAAACGGCAGAGAGG + Intergenic
1191705211 X:64086501-64086523 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1191762518 X:64661447-64661469 CCAGCAGACTGGCAGCAGAGGGG - Intergenic
1191787849 X:64935710-64935732 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1191795764 X:65019421-65019443 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1191818985 X:65281856-65281878 AAAGGAGACAATCAGCAGAGTGG + Intergenic
1191824948 X:65354345-65354367 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1191872842 X:65764645-65764667 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1191962592 X:66719496-66719518 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1191974605 X:66858326-66858348 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1191984937 X:66969360-66969382 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
1192020672 X:67387173-67387195 CCAGCAGGCCAGCAGCAGAGGGG + Intergenic
1192032426 X:67528501-67528523 AAGGCAGACAAGCAAGAAAGGGG + Intergenic
1192128879 X:68529729-68529751 TAAGCAGACCTGCAGCAGAGGGG - Intronic
1192637075 X:72830381-72830403 CCAGCAGACCTGCAGCAGAGAGG - Intronic
1192644639 X:72890433-72890455 CCAGCAGACCTGCAGCAGAGAGG + Intronic
1192694842 X:73402252-73402274 CAAGCAGACTGGAAGCAGAGGGG + Intergenic
1192858193 X:75036875-75036897 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1192964277 X:76160199-76160221 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1192977557 X:76302669-76302691 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1192984372 X:76380592-76380614 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1193001638 X:76568919-76568941 CCAGCAGACGTGCAGCAGAGGGG + Intergenic
1193075282 X:77348375-77348397 CCAGCAGACCAGCAGCAGAGAGG + Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193121015 X:77823135-77823157 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1193355889 X:80520452-80520474 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1193389271 X:80906993-80907015 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1193394578 X:80968490-80968512 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1193646878 X:84080259-84080281 CAGGCAGACCTGCAGCAGAGGGG + Intronic
1193736766 X:85166329-85166351 CAAACAGACAACCAACAGAGTGG + Intergenic
1193830110 X:86279417-86279439 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1194098677 X:89675004-89675026 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1194118890 X:89937055-89937077 CCAGCAGACTGGCAGCAGAGGGG - Intergenic
1194139962 X:90196844-90196866 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1194158630 X:90423311-90423333 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1194203647 X:90984418-90984440 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1194229080 X:91299812-91299834 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1194420035 X:93661595-93661617 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1194576243 X:95618171-95618193 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1194798285 X:98240091-98240113 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1194805375 X:98320470-98320492 CAAACAGACAACCTGCAGAGTGG - Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195179045 X:102339338-102339360 CAGGCTGAACAGCTGCAGAGAGG - Intergenic
1195232906 X:102869434-102869456 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1195414328 X:104603214-104603236 CCAGCAGACCGGCAGCAGAGGGG + Intronic
1195451726 X:105021477-105021499 CAGTGAGGCAAACAGCAGAGCGG - Intronic
1195774718 X:108390970-108390992 CCAGCAGACCTGCAGCAGAGGGG - Intronic
1195833633 X:109088512-109088534 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1195842849 X:109192902-109192924 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1196000754 X:110783023-110783045 AAGGCAGACAAGGAGCTGAATGG + Intronic
1196273070 X:113735258-113735280 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1196312485 X:114184369-114184391 CTAGCAGACCTGCAGCAGAGGGG + Intergenic
1196353232 X:114757859-114757881 CAGGCTGGCAAGAAGTAGAGAGG - Intronic
1196367717 X:114942473-114942495 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1196571384 X:117269252-117269274 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1196589328 X:117467439-117467461 CCAGCAGACTGGCAGCAGAGAGG - Intergenic
1197142297 X:123130533-123130555 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1197157330 X:123284134-123284156 CCAGCAGACTGGCAGCAGAGGGG + Intronic
1197191192 X:123649202-123649224 CCAGCAGACCTGCAGCAGAGGGG + Intronic
1197718909 X:129731362-129731384 ATGGCAGACATGCTGCAGAGAGG + Intergenic
1197778266 X:130135040-130135062 AAGACAGACAAGAAGGAGAGAGG - Intronic
1197880653 X:131163663-131163685 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1197906359 X:131429152-131429174 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1197927012 X:131657068-131657090 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1198002166 X:132450922-132450944 CCAACAGACATGCAGCAGAGAGG - Intronic
1198262780 X:134980698-134980720 CAGACAGACAACCCACAGAGTGG - Intergenic
1198863510 X:141096056-141096078 CAGGCAGACAAGAAGGGAAGGGG + Intergenic
1198899179 X:141491331-141491353 CAGGCAGACAAGAAGGGAAGGGG - Intergenic
1199294685 X:146143779-146143801 CAGGCACAAAAGTAGCAGAGAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199436714 X:147820261-147820283 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1199469713 X:148181294-148181316 CCAGCAGACCTGCAGCAGAGGGG - Intergenic
1200058524 X:153473849-153473871 CTGGCAGCTTAGCAGCAGAGAGG - Intronic
1200388392 X:155917560-155917582 CCAGCAGACCTGCAGCAGAGAGG - Intronic
1200451699 Y:3336379-3336401 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1200471765 Y:3594609-3594631 CCAGCAGACTGGCAGCAGAGGGG - Intergenic
1200504946 Y:4000279-4000301 CCAGCAGACCTGCAGCAGAGGGG + Intergenic
1200549479 Y:4559857-4559879 CCAGCAGACCTGCAGCAGAGAGG + Intergenic
1200827226 Y:7657990-7658012 CAGGGAGACCAGGAGAAGAGGGG + Intergenic
1200954520 Y:8930398-8930420 CAGGGAGACCAGGAGAAGAGGGG - Intergenic
1201688703 Y:16737337-16737359 CTAGCAGACCTGCAGCAGAGGGG - Intergenic
1201705198 Y:16928881-16928903 CCGGCAGATCTGCAGCAGAGGGG + Intergenic
1201939760 Y:19447284-19447306 CAGGAAGAATAGCTGCAGAGTGG - Intergenic
1201961841 Y:19689754-19689776 CCAGCAGACCTGCAGCAGAGTGG - Intergenic
1202124604 Y:21557021-21557043 CAGGAAGACCAGGAGAAGAGGGG - Intergenic
1202154404 Y:21872359-21872381 CAGGAAGACCAGGAGAAGAGGGG + Intergenic
1202195377 Y:22295060-22295082 CAGGGAGACCAGGAGAAGAGGGG + Intergenic