ID: 1104709535

View in Genome Browser
Species Human (GRCh38)
Location 12:130975939-130975961
Sequence AAACATTCACAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 443}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104709535 Original CRISPR AAACATTCACAGAGGGAGGA AGG (reversed) Intronic
900011123 1:109695-109717 AAAAACACACATAGGGAGGAGGG + Intergenic
901473559 1:9473886-9473908 AGGCATTCACAGAGGGGAGACGG - Intergenic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
903821387 1:26105233-26105255 AAACATACACAAAGGTAGAATGG + Intergenic
904112524 1:28137453-28137475 AAACTTACACAAAGGGAAGAGGG - Intergenic
905260240 1:36712154-36712176 TAAGAATCACAGAAGGAGGAAGG - Intergenic
907008830 1:50943770-50943792 AAACATTCAAAGGTAGAGGAAGG + Intronic
908038132 1:60078094-60078116 TAACATCCACAGAGGAAGTAAGG - Intergenic
908901354 1:68959937-68959959 AAACATACACAGAGGGAGGCTGG - Intergenic
910039116 1:82826429-82826451 AAACAATTACAGGAGGAGGAAGG + Intergenic
911360177 1:96866063-96866085 AAACATATACAGAAGGAAGATGG - Intergenic
911380077 1:97103647-97103669 CAACATTCACATAGTGATGAGGG + Intronic
911791598 1:102023023-102023045 AAAGATACAGAGAGGTAGGAAGG - Intergenic
912526925 1:110290386-110290408 ACACAGACACACAGGGAGGAAGG + Intergenic
912588537 1:110789305-110789327 AAACAATAAGAGAGGGAGAAAGG + Intergenic
913692888 1:121296253-121296275 ACACATGCACAGAGAGGGGATGG + Intronic
915398569 1:155605560-155605582 GAACTTTCAGAGTGGGAGGATGG + Intergenic
915399569 1:155612338-155612360 AAACAGTCACACAGTGGGGAGGG + Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918605434 1:186419418-186419440 AAACTTTAACAGAGGCATGATGG + Exonic
918817404 1:189206498-189206520 ACACATACACACAGGGAAGATGG - Intergenic
919203661 1:194392283-194392305 AAACATTCAAAGAGGAAGAGAGG + Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919378609 1:196825627-196825649 TAACATGCACAGAAGAAGGATGG + Exonic
919390807 1:196983035-196983057 TAACATGCACAGAAGAAGGATGG + Exonic
919506589 1:198406449-198406471 GAAGATTCTCAGAGGGTGGAGGG + Intergenic
919579348 1:199352122-199352144 AGACTTGCACAGAGGGAGGTGGG - Intergenic
919611034 1:199745798-199745820 AAAGATGCACACAGGGAGGCAGG + Intergenic
920021564 1:202960405-202960427 AAAGATTCAGAAAGGGAGGAAGG - Intergenic
920026952 1:203006079-203006101 AAACTATCGCAGAGGCAGGAAGG - Intergenic
920092420 1:203464111-203464133 AAAGAGCCAGAGAGGGAGGAAGG + Intergenic
921124735 1:212167344-212167366 GAATATCCACAGAGGGATGAAGG - Intergenic
921167663 1:212518565-212518587 AACCATTAGCTGAGGGAGGAGGG + Intergenic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
921384817 1:214558019-214558041 CAACCTTCACTGGGGGAGGAAGG + Intergenic
921772505 1:219058765-219058787 AAACAATCACAGAGTGAAAAGGG + Intergenic
922153340 1:223022980-223023002 AGACACTCACACAGGCAGGAAGG + Intergenic
922259567 1:223925696-223925718 AAAAACACACATAGGGAGGAGGG + Intergenic
923323707 1:232861440-232861462 GAACATTCGCAAAGGCAGGATGG + Intergenic
923689619 1:236179467-236179489 AAACAATCTCAGAGGGACAATGG - Intronic
923749266 1:236732390-236732412 AAATATTCACAGAGGGGAAAAGG - Intronic
924015386 1:239715635-239715657 AAACAGATAAAGAGGGAGGAAGG + Intronic
924038159 1:239956742-239956764 TAACATCCACATAGAGAGGATGG + Intergenic
924340730 1:243028252-243028274 AAAAACACACATAGGGAGGAGGG + Intergenic
1062895665 10:1101369-1101391 AGACACTCCCAGAGGGATGAAGG - Intronic
1063922534 10:10946432-10946454 AAACATCCAAAGAGGGAAAAAGG - Intergenic
1064101861 10:12471038-12471060 AAAAAGACACAAAGGGAGGAAGG - Intronic
1064134622 10:12740090-12740112 AAAGATTCACAGAAGGAAGGTGG - Intronic
1064796250 10:19014831-19014853 ACACAGACACAGAGGGAAGAAGG + Intergenic
1065497393 10:26343306-26343328 ACACACACACACAGGGAGGATGG + Intergenic
1065617066 10:27537986-27538008 AAACTGTCACACAGGGAAGAAGG + Exonic
1066175560 10:32900973-32900995 AAAAATTCAGAGAGTTAGGAAGG - Exonic
1066735747 10:38477154-38477176 AAAAACACACATAGGGAGGAGGG - Intergenic
1066748354 10:38626141-38626163 CACCATTCAGAAAGGGAGGAGGG - Intergenic
1067089599 10:43259860-43259882 AACCACTCACAAAGGCAGGAAGG + Intronic
1067557246 10:47281475-47281497 AGAGATTCACAGAGAAAGGATGG + Intergenic
1067651023 10:48155423-48155445 AAACTGTCACACTGGGAGGAAGG - Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1067714947 10:48683648-48683670 GAACTTCCACAGAGGCAGGAAGG - Intergenic
1067735995 10:48851294-48851316 AAGCATCCACATATGGAGGAGGG - Intronic
1068836800 10:61564271-61564293 TATCATTCACATAGGGAGGCAGG - Intergenic
1069091669 10:64206808-64206830 AAACATGAACAGAGTGAGAAAGG - Intergenic
1069531167 10:69220630-69220652 AAAGACTCACTGAGGGAAGAGGG + Intronic
1070683185 10:78463277-78463299 TGACATTCACACAGTGAGGATGG + Intergenic
1073123576 10:101136208-101136230 AGACATTCGCAGAGAGAGGGAGG + Intronic
1074718188 10:116240003-116240025 AGCAATTCACAGAGGGAGAAAGG + Intronic
1074876658 10:117618889-117618911 ACACAGACACAGAGGGAAGAAGG + Intergenic
1074920462 10:118003453-118003475 AAACATTTACAGAGCCAGGAAGG - Intergenic
1076414553 10:130276445-130276467 AGACATTCTCAGAGGGAGGGAGG + Intergenic
1077283185 11:1754583-1754605 GAAGAGTCACAGAGGGATGAGGG + Intronic
1078941782 11:16014284-16014306 AAACATTCTGAGAGGAAGGCTGG + Intronic
1079719757 11:23794990-23795012 AAAAAATAACAGAGGAAGGAAGG + Intergenic
1080582723 11:33657141-33657163 AAGCAAGCAGAGAGGGAGGAAGG + Intronic
1080839400 11:35970336-35970358 AGACACTCACAGAGGGAAGATGG + Intronic
1081522162 11:43892892-43892914 AAACATTGACTGAGGGAACATGG + Intronic
1082888924 11:58117777-58117799 AGACATTCCCAAAGGTAGGATGG + Intronic
1083562075 11:63681196-63681218 AAACATTCACATAAAGAGGCAGG + Intergenic
1085171124 11:74450853-74450875 AAACATTCAGAGACTGAGGATGG - Intergenic
1085790390 11:79492731-79492753 AAACAGTTACAGAGGGAGGATGG + Intergenic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1086532583 11:87803285-87803307 ACACATACTCAGAGGGAAGATGG - Intergenic
1086916978 11:92541717-92541739 ACAGTTTCACAGAGGTAGGAGGG - Intronic
1086941851 11:92806644-92806666 AAACATTCAGAAAGGATGGAAGG - Intronic
1087022670 11:93618837-93618859 ACACACACACAGAGGGAAGAAGG - Intergenic
1087266587 11:96068468-96068490 ACACACACACAGAGGGAGGGAGG + Intronic
1087339238 11:96881565-96881587 ACACAATCCCAGAGGGAAGAAGG - Intergenic
1087341627 11:96914436-96914458 AATAAGTCACAGAGGGAGGGAGG - Intergenic
1087913466 11:103780283-103780305 AAACATGGAAAGAGGGAGGAAGG + Intergenic
1088122439 11:106385998-106386020 AGGCATGGACAGAGGGAGGAAGG - Intergenic
1088374527 11:109125540-109125562 AATCCTTCTCAGAGGGAGCATGG + Intergenic
1089521514 11:119067572-119067594 AAACATGCTCAAAGGGATGAAGG + Intergenic
1089641613 11:119851386-119851408 AAACAGACAGAGAGGGAGGGAGG - Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1089683915 11:120134825-120134847 ACACAGGCACAGAGGAAGGAAGG - Intronic
1090429434 11:126633778-126633800 AAACATACACTGATGGATGATGG - Intronic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1092261308 12:6954723-6954745 AGACATTCACAGAGAGGGGCCGG - Intronic
1092290493 12:7157244-7157266 GAACAAACACAGAGGGAGGCAGG - Intronic
1095106265 12:38236885-38236907 ATACCTACAAAGAGGGAGGAGGG + Intergenic
1095332001 12:40977369-40977391 AATAATTCCCAAAGGGAGGAGGG + Intronic
1095405924 12:41867189-41867211 AAACAATCACAGAGGGAGCCTGG - Intergenic
1095863572 12:46947180-46947202 AGACATTTACAGTTGGAGGAAGG - Intergenic
1096011359 12:48218377-48218399 AAATTTTCAGAGCGGGAGGAGGG + Intergenic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1097396640 12:59082988-59083010 AAACATTGACATGGGTAGGATGG + Intergenic
1098244073 12:68498572-68498594 AAATATTCACAGAGTGATTAAGG - Intergenic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1100707261 12:97214815-97214837 AAACATTCACAGAGCTGGGAGGG + Intergenic
1100859659 12:98791048-98791070 AAACATTCACAATGAGAGGCTGG + Intronic
1100891954 12:99135500-99135522 AAACTTCCAGAGAGGGAGAAAGG + Intronic
1101294892 12:103411871-103411893 ACACATACACAGAGGGAGACAGG + Intronic
1102114859 12:110395036-110395058 AAACATGGAGAGAGGGAGCAGGG + Intronic
1102714825 12:114961126-114961148 AAACAATCACAGCGTGAGAATGG - Intergenic
1102720772 12:115014106-115014128 AAAGATCCATAGAGAGAGGAAGG - Intergenic
1104493641 12:129216443-129216465 AGACAGACACACAGGGAGGATGG + Intronic
1104515292 12:129419484-129419506 AAACTTTAGCAGAAGGAGGATGG + Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1104722635 12:131053669-131053691 AAACATCCAAAGTGGGAGGGCGG + Intronic
1105067880 12:133216217-133216239 AGACATGCATACAGGGAGGAAGG + Intergenic
1105795592 13:23849042-23849064 AAACATGCACAGAGGGTGTTTGG + Intronic
1105914785 13:24903401-24903423 AGACACACACAGAGGGAAGATGG + Intronic
1106749829 13:32750836-32750858 ACACACACACAGAGGGAGGCCGG - Intronic
1107080553 13:36370144-36370166 AAACATGCACAGACGGAAGGTGG + Intronic
1107764767 13:43722348-43722370 AAATGTTCACAGAGGGATGTAGG + Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108779842 13:53816178-53816200 AAACAGACACAGAAGGAAGAAGG + Intergenic
1110452924 13:75657069-75657091 AGACATGCACAGAGGGATGAAGG + Intronic
1111693403 13:91592928-91592950 AGACATTCTCAGAGGGAGATGGG + Intronic
1112002126 13:95220668-95220690 AAAAATGCACAGAGAGAGGAGGG + Intronic
1112029516 13:95444236-95444258 AAACATGCACAAGGGCAGGAAGG - Intronic
1112515408 13:100048991-100049013 AAACTTTCACTCATGGAGGAAGG + Intergenic
1112634960 13:101206202-101206224 AAAGATACAGGGAGGGAGGAAGG - Intronic
1113475885 13:110580894-110580916 AAACATTCTCACATGAAGGAAGG - Intergenic
1113508675 13:110834138-110834160 AAACATTTTCATAAGGAGGAAGG - Intergenic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1113617210 13:111689345-111689367 AGACGTTCGCAGAGGGAGTATGG + Intergenic
1113622740 13:111774616-111774638 AGACGTTCGCAGAGGGAGTATGG + Intergenic
1114676472 14:24443490-24443512 AAACATTTTCAAAGGGAGGAAGG - Intergenic
1116172786 14:41424744-41424766 AAACATTCAGAGAAGAAGTAAGG + Intergenic
1116363689 14:44033381-44033403 AATCATTCACAGGTGGAGGGTGG + Intergenic
1117111761 14:52464548-52464570 AAACATTCAAAAGGGAAGGAAGG + Intronic
1119727425 14:76930138-76930160 ACACATTCAAAGCTGGAGGAAGG - Intergenic
1120045732 14:79803475-79803497 AGACATACCCAGTGGGAGGAAGG - Intronic
1120277073 14:82389480-82389502 ACACATTCAAACAGGGAGGCAGG - Intergenic
1120698840 14:87675531-87675553 AAATTTTCACGGTGGGAGGAAGG - Intergenic
1122749732 14:103923917-103923939 ACACACACACAGAGGGAGGGGGG + Intronic
1123208510 14:106736887-106736909 TAACATTCACAGAGTGGGAAAGG - Intergenic
1123757642 15:23409287-23409309 AAATATTCACAGAAGGCGGCTGG + Intergenic
1124204397 15:27704696-27704718 AATCATACACAGCAGGAGGATGG + Intergenic
1126837568 15:52682313-52682335 TCACATTCACAGATGGGGGATGG - Intronic
1127068922 15:55268978-55269000 AGACATGAACACAGGGAGGATGG + Intronic
1127845470 15:62866621-62866643 CCAAATTCACACAGGGAGGAAGG - Intergenic
1128710592 15:69868527-69868549 AAAGATTCTAAGAGGAAGGAAGG + Intergenic
1128765457 15:70248446-70248468 GAACAGTCACAGAGGCAGGAAGG + Intergenic
1131296577 15:91154679-91154701 AGACACACACAGAGGGAAGATGG + Intronic
1131465846 15:92654574-92654596 GAACATTCACAGGGGCATGAGGG - Intronic
1131612315 15:93978044-93978066 TAACATCCAAAGTGGGAGGATGG + Intergenic
1131889568 15:96957836-96957858 AGACATTGAGAGAGAGAGGAAGG + Intergenic
1132071123 15:98777353-98777375 AACCTTTCAAAGAGGGAAGAAGG + Intronic
1132113556 15:99119507-99119529 AAGCAGTCACAGTGGGAGGCGGG + Intronic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134458694 16:14413475-14413497 AAACATTCACAGAAGGCGGCCGG - Intergenic
1136688313 16:32009146-32009168 AACCATCCACACAGGGAGGCGGG - Intergenic
1136788914 16:32952701-32952723 AACCATCCACACAGGGAGGCAGG - Intergenic
1136880898 16:33901233-33901255 AACCATCCACACAGGGAGGCAGG + Intergenic
1136932934 16:34435366-34435388 ACACATCCCCAGAGAGAGGAGGG - Intergenic
1136971638 16:34976448-34976470 ACACATCCCCAGAGAGAGGAGGG + Intergenic
1137529833 16:49272121-49272143 AAACTTTCAAAGAGGGAAGAGGG - Intergenic
1138085882 16:54133377-54133399 ACAAATTCACAGAGACAGGAAGG - Intergenic
1139316530 16:66075541-66075563 ACACATTAATAGAAGGAGGAGGG + Intergenic
1139962336 16:70725197-70725219 AAAGACTCACAGAGTGAGGAGGG + Intronic
1141336269 16:83158297-83158319 CAACATTCAGAGAGGCAGCAGGG - Intronic
1142453226 16:90197210-90197232 AAAAACACACATAGGGAGGAGGG - Intergenic
1203091111 16_KI270728v1_random:1214190-1214212 AACCATCCACACAGGGAGGCGGG - Intergenic
1142950008 17:3471155-3471177 AAAAATGGAGAGAGGGAGGAAGG + Intronic
1143087272 17:4425540-4425562 AAAGTTTCACAGATGGAGGGTGG - Intergenic
1143606288 17:7988286-7988308 AAACATACAGAGAAGGAGGCCGG - Intergenic
1145887520 17:28392863-28392885 AAACAACCAAAGAGGGATGACGG - Intronic
1148117375 17:45184394-45184416 ACACATGCATAGAGGGAAGATGG - Intergenic
1148227326 17:45908059-45908081 ACCCATTCACAGAGGCTGGAGGG - Intronic
1150457568 17:65319758-65319780 ACACATTCACAGAGAAAGAAGGG + Intergenic
1150691226 17:67368863-67368885 TGACAATCACAGAGGGAAGAGGG - Intergenic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1152729608 17:81962958-81962980 GGACATTCTCAGAGGGAGGCAGG + Intergenic
1154130466 18:11732708-11732730 CAACATTTACAAATGGAGGAGGG + Intronic
1154352217 18:13593765-13593787 AAACAAATAAAGAGGGAGGAGGG - Intronic
1154493105 18:14936365-14936387 AAGCAAGCAAAGAGGGAGGAAGG - Intergenic
1156276618 18:35589498-35589520 AAACATTAACAGAAGCAGAAGGG - Intronic
1156802482 18:41133907-41133929 ACACACACACAGAGTGAGGAAGG + Intergenic
1157612286 18:48964942-48964964 ACACATACACATTGGGAGGAAGG + Intergenic
1157694289 18:49708564-49708586 AAGCATTCACAGACTGATGAAGG - Intergenic
1158208781 18:55023516-55023538 AGAGATTCAGACAGGGAGGAAGG - Intergenic
1158212574 18:55067693-55067715 TAGCATTCAGAGATGGAGGATGG - Intergenic
1159951654 18:74488488-74488510 AGACATACACAGAGGGAAGATGG + Intergenic
1160132144 18:76235012-76235034 GACCATTCACAGAGGAAGGGGGG - Intergenic
1160897796 19:1410862-1410884 GGAAAGTCACAGAGGGAGGAAGG + Intronic
1161322306 19:3646932-3646954 AGGCACTCACAGAGGGAGGAGGG + Intronic
1161322328 19:3647007-3647029 AGGCGCTCACAGAGGGAGGAGGG + Intronic
1161322351 19:3647084-3647106 AGGCGCTCACAGAGGGAGGAGGG + Intronic
1161322398 19:3647240-3647262 AGGCACTCACAGAGGGAGGAGGG + Intronic
1161519081 19:4713658-4713680 AACCATTCCCAGAGGGAGTCGGG - Intronic
1161877009 19:6919431-6919453 ACACACACACAGAGGGAGGGAGG - Intronic
1163043661 19:14622690-14622712 AAAAATTCAGAGAGTTAGGAAGG + Intronic
1163048348 19:14661917-14661939 AAACAACAACAGAGGAAGGAAGG + Intronic
1163528584 19:17836206-17836228 AATCATTCAGAGATGGAGGTGGG - Intronic
1165217920 19:34289956-34289978 TAACATTCACAGATGCTGGATGG + Intronic
1165813749 19:38628369-38628391 GGAAACTCACAGAGGGAGGAGGG - Intronic
1166237949 19:41470056-41470078 TAATATTCACAGGGGGAGAAGGG - Intergenic
1166248296 19:41546574-41546596 AAGAAATCATAGAGGGAGGAGGG - Intergenic
1166803746 19:45472996-45473018 AAGAGTTCACAGAGCGAGGAGGG - Exonic
1167980860 19:53273599-53273621 AGACATCCACAGAAGCAGGAAGG - Intergenic
1168716610 19:58532157-58532179 AAACATTCCCAGAGAGTAGAAGG - Intronic
925214215 2:2079934-2079956 AAACAGTAACTGAGAGAGGATGG + Intronic
925683464 2:6447495-6447517 AAACTTTCACAGGGAGAGGAAGG + Intergenic
925790048 2:7475457-7475479 ACACACACACAGAGGGAGGATGG + Intergenic
926281371 2:11449967-11449989 AAAGATTTAAAGAGGGATGAGGG - Intronic
926326262 2:11786802-11786824 ATACGTTCACACAGGGAGTAGGG - Intronic
927018464 2:18993254-18993276 AACGATTCACAGAGGGTGAATGG - Intergenic
927277078 2:21271491-21271513 AAAGTGTCACAGAGGGAGAAGGG - Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
928853287 2:35774414-35774436 GAAGTTTCACAGTGGGAGGAAGG + Intergenic
929391860 2:41478282-41478304 TATCATTCACAGAAGGAAGAGGG + Intergenic
929810449 2:45185074-45185096 GAAGCTTCACAGAGGAAGGAAGG - Intergenic
931006965 2:57861448-57861470 AAACATTCAGAAGGGAAGGAAGG + Intergenic
931140118 2:59448344-59448366 AAGCATTCTCAAAGGTAGGATGG + Intergenic
931141365 2:59462017-59462039 AAATGTTCACAGAGTGAGGGAGG - Intergenic
932145981 2:69317657-69317679 AAACCTTCAGAGAGGAAAGAAGG - Intergenic
933203828 2:79482323-79482345 ATACATGCACACAGGGATGAAGG + Intronic
933391161 2:81669137-81669159 ACACACACACAGAGGGAGGGAGG - Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934604804 2:95686655-95686677 AAATATTTGCAGAGGGAGTATGG - Intergenic
934646799 2:96063655-96063677 CAACATTCACAGCTGCAGGATGG - Intergenic
934774016 2:96925841-96925863 TGACATTCTCAGAGGGAAGATGG + Intronic
934840201 2:97619737-97619759 CAACATTCACAGCTGCAGGATGG - Intergenic
935189765 2:100767551-100767573 CAACAATTACAGAGGGAAGAAGG + Intergenic
935599250 2:104905743-104905765 AGGCACTCACAGAGGGAAGATGG - Intergenic
935614592 2:105064202-105064224 AAACTTTCAGAGAGGTAGGAGGG + Intronic
936763372 2:115813796-115813818 AAACATTCACATAAAGAGGAAGG + Intronic
936888480 2:117341180-117341202 AGAGACACACAGAGGGAGGAAGG - Intergenic
937370456 2:121293921-121293943 AAACTTGCACAGCTGGAGGACGG + Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939399252 2:141669642-141669664 ACAAATTCCCAGAGGAAGGAGGG + Intronic
940342014 2:152591303-152591325 AAATATTACCAGAGGGAGGCCGG - Intronic
940788909 2:158011338-158011360 AAACACTCAGAGACGCAGGAGGG - Intronic
941983747 2:171489305-171489327 AAACACTAACAGACAGAGGATGG + Intergenic
942213003 2:173690533-173690555 AACCTTTCACAGAGAGAGCAAGG - Intergenic
943494995 2:188609379-188609401 AGGCATTCTCAGAGGGTGGAAGG + Intergenic
944102687 2:196045319-196045341 AAAGAATAAAAGAGGGAGGAAGG + Intronic
945280975 2:208035224-208035246 AAACATCCAGGGAGGGATGAAGG + Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
946070410 2:217029942-217029964 AAACAAAGAAAGAGGGAGGAGGG - Intergenic
946669665 2:222089320-222089342 AACCATCAACTGAGGGAGGACGG + Intergenic
946749967 2:222884312-222884334 AAACATTCACAGTGGCAGTGAGG + Intronic
947612963 2:231535172-231535194 AAATATTCAGAGTGCGAGGAAGG + Intergenic
949084665 2:242141868-242141890 AAAAACACACATAGGGAGGAGGG - Intergenic
1168826785 20:819398-819420 AAAGAGACAGAGAGGGAGGAAGG - Intergenic
1168979962 20:1995907-1995929 AAACTCTCACATAAGGAGGAGGG + Intergenic
1169319152 20:4616951-4616973 ACACAGACACAGAGGGAAGATGG - Intergenic
1170366544 20:15604277-15604299 AAAGATGGAAAGAGGGAGGAAGG - Intronic
1170449423 20:16466924-16466946 ACACAGTCACAAGGGGAGGAGGG + Intronic
1171280503 20:23892191-23892213 GAACATTCACTGAGGATGGAGGG + Intergenic
1171877607 20:30593207-30593229 AAAAAAACAAAGAGGGAGGAGGG + Intergenic
1171962398 20:31504167-31504189 AAACATTCCCAGTAGGAGGGTGG - Intergenic
1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG + Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173076952 20:39828347-39828369 AGACATGCACACAGGGAGAATGG + Intergenic
1174302097 20:49589834-49589856 AAAAAGTCAGAGAGGGAGCAGGG - Intergenic
1174729781 20:52904580-52904602 AAACATTGGGAGAGGGAGGAGGG + Intergenic
1175053172 20:56173595-56173617 ATACTTTAAGAGAGGGAGGAGGG + Intergenic
1175535531 20:59708385-59708407 CCACAATCACAGAGGCAGGAAGG + Intronic
1175642505 20:60642795-60642817 GAACAGCCACAGAGGGAGGCTGG - Intergenic
1175675301 20:60941628-60941650 ACACACACACAGAGGGAGGGAGG - Intergenic
1175702478 20:61150077-61150099 CAACTTTCTCAGGGGGAGGAGGG + Intergenic
1175753304 20:61513924-61513946 AAAGTTTCACAGCGGGAGAAAGG + Intronic
1176281242 20:64314369-64314391 AAAAACACACATAGGGAGGAGGG - Intergenic
1177658708 21:24054329-24054351 GCACATGCACAGAGGGAAGAAGG - Intergenic
1177833946 21:26170210-26170232 AGACATTCAGACAGGGGGGAAGG - Intronic
1178778417 21:35575251-35575273 AGACACTCACAAAGGGAGGGAGG - Intronic
1179001441 21:37463555-37463577 AATCATTGAGAGAGGGAGGGAGG - Intronic
1179068845 21:38053042-38053064 ACACATTTTCAGAGGAAGGAAGG + Intronic
1179427505 21:41293588-41293610 AAAAGTTCACAGAAGGAAGATGG - Intergenic
1180182047 21:46122424-46122446 AAAGCTGCCCAGAGGGAGGAAGG + Intronic
1181893376 22:26084512-26084534 GAACAGCCACATAGGGAGGAGGG + Intergenic
1182046532 22:27278595-27278617 AGACAATGACAGAGGGAGGAAGG - Intergenic
1182267207 22:29126484-29126506 AGACACACACAGAGGGAAGATGG - Intronic
1182340632 22:29617630-29617652 TGACATTCAGAGAGGCAGGATGG + Intronic
1184064594 22:42110438-42110460 AAACACTTACAGAGCAAGGAAGG - Intergenic
1184997297 22:48217666-48217688 AAACACGCACAGAGGGATGACGG + Intergenic
950641245 3:14349895-14349917 AGACAGGCACAGAGGGAAGATGG + Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
952177754 3:30884795-30884817 AAATATTTATTGAGGGAGGAAGG + Intronic
952197906 3:31095343-31095365 AAACATTCACAGAAAGAAGGTGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953794729 3:45975874-45975896 AAACATGTGCAGAAGGAGGAAGG + Intronic
954900739 3:54017111-54017133 AAAAAAACTCAGAGGGAGGAAGG - Intergenic
955216956 3:56992013-56992035 ACACACACACAGAGAGAGGAGGG - Intronic
955332462 3:58058861-58058883 AAACATTCCCAGAGGCTGGGAGG - Intronic
955496453 3:59538299-59538321 ACACACACACAGAGGGAGGGAGG - Intergenic
957156691 3:76552600-76552622 AACCTTTCACAGACTGAGGAAGG + Intronic
957928998 3:86853230-86853252 AAATATTCCCAGAGGAAGGGCGG + Intergenic
959351969 3:105276979-105277001 AAGCATGCAGAGAGAGAGGAGGG + Intergenic
959470406 3:106742912-106742934 AAACATTCACATAGACAGTAAGG + Intergenic
960152208 3:114261901-114261923 ACACATGCACAGAGGGAGGGAGG + Intergenic
960712121 3:120541886-120541908 GAACAATAACAGAGGTAGGATGG - Intergenic
962057955 3:131892893-131892915 AAACAATGACAGAGAAAGGAAGG + Intronic
963181039 3:142356642-142356664 AAACATTTACAGAGAAAGCATGG + Intronic
964967291 3:162511767-162511789 AAACGTTCCCAGAGGGAGGGTGG - Intergenic
965991323 3:174822158-174822180 AAACACACACACAGGGCGGAGGG + Intronic
967032818 3:185624163-185624185 AAGCATGCAGGGAGGGAGGAAGG - Intronic
967046119 3:185738588-185738610 AAACATTTTCTGAGAGAGGATGG - Intronic
967769419 3:193318140-193318162 AAACAAGCACAGAGTAAGGAAGG + Intronic
969547387 4:7840179-7840201 AAACATTCACTGATGTAGGAAGG + Intronic
970779270 4:19716255-19716277 AACCTTTCACAGATGGAGCAGGG - Intergenic
971138901 4:23901681-23901703 AAATACACACAGAGGGAAGAAGG + Intronic
971573791 4:28248338-28248360 AAACACACACACACGGAGGAGGG - Intergenic
973199105 4:47479565-47479587 CAAGATTCACAGAGAAAGGAGGG + Intergenic
974120688 4:57634479-57634501 AAACATTCCTAGAGGGGTGAGGG - Intergenic
974183367 4:58412246-58412268 AGACAATGAAAGAGGGAGGAAGG - Intergenic
974207765 4:58728649-58728671 AAATCTTCCCAGTGGGAGGAAGG + Intergenic
976493154 4:85694652-85694674 ACACACACACAGAGGGTGGAGGG - Intronic
976876621 4:89861213-89861235 ATAGATTCACAGAGGGATCATGG + Intergenic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
978393261 4:108250227-108250249 ACACATAGAGAGAGGGAGGAAGG + Intergenic
978508333 4:109485627-109485649 AAACATTCTCAGTGGTGGGATGG + Intronic
978557711 4:109998607-109998629 ACTCACTCACAGAGGAAGGAGGG - Intronic
978734037 4:112065037-112065059 AAACATACAAAGAGTGAGAAAGG + Intergenic
979262096 4:118660109-118660131 AAAAACACACATAGGGAGGAGGG - Intergenic
979848705 4:125549522-125549544 AAATATTTAGAGAAGGAGGAAGG + Intergenic
980510207 4:133775549-133775571 TAACATTCTGATAGGGAGGATGG - Intergenic
980774277 4:137419267-137419289 AAACTGTCCCAGTGGGAGGAAGG - Intergenic
982115816 4:152097664-152097686 AAAGATTGAGAGAGGAAGGAAGG + Intergenic
983149743 4:164263243-164263265 AAAAACACACATAGGGAGGAGGG + Intronic
983540013 4:168899164-168899186 TAATATTTACAGAGGGAGGTGGG + Intronic
984705750 4:182845969-182845991 AAAGAGTCACAGTGGGAAGATGG - Intergenic
984706763 4:182852886-182852908 AAACAGGCATAGAGGGAAGACGG + Intergenic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
985873021 5:2573147-2573169 AAAAAATCACAGAGGTTGGAAGG + Intergenic
985977700 5:3434098-3434120 AAAAAGTGACAGAGGGAGGCAGG - Intergenic
986045030 5:4028383-4028405 AAACTTCCCCAGAGGGAGGGTGG - Intergenic
986327219 5:6685191-6685213 AAACCTTGACTGAGGGTGGAGGG + Intergenic
986630375 5:9766809-9766831 AAGCATACAGAGAGGGAGGGAGG + Intergenic
986693136 5:10330553-10330575 AAACATTCTCAAAGGATGGATGG - Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
988089339 5:26516078-26516100 AAACATACACAAATGGTGGAAGG - Intergenic
989406331 5:41065193-41065215 AAATATTGACAGAGGGATGTGGG - Intronic
990285307 5:54295830-54295852 AAACATTCATACAGGAAGAAGGG + Intronic
990907759 5:60822025-60822047 CAACATTCCCAAAAGGAGGAAGG - Intronic
991318546 5:65340524-65340546 AAACAATAAGAGAGGAAGGAAGG + Intronic
991428776 5:66521113-66521135 AAACAATCAGGGAGGAAGGAAGG - Intergenic
991550856 5:67834302-67834324 AAAACTTCACAGAGGGTAGATGG - Intergenic
991581082 5:68155816-68155838 ACACACACACAGAGGGAAGAAGG - Intergenic
993124882 5:83821667-83821689 ATACATGCAAAGAAGGAGGAGGG - Intergenic
993512294 5:88786123-88786145 ACACACACACAAAGGGAGGAGGG + Intronic
994260811 5:97656390-97656412 AAACATGCACAGAAGGAAGAGGG + Intergenic
994851759 5:105063969-105063991 AAACATTAACAGAGGGTCCAAGG + Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996580845 5:125030438-125030460 GTACATTCACAGAGGCAGGAAGG + Intergenic
996683562 5:126255362-126255384 ACACATACACACAGGGAGGGAGG - Intergenic
997304317 5:132826691-132826713 TAACAGGCACAGAGGGAGGGAGG - Intronic
997486598 5:134236140-134236162 AAACATGCACAGAAGAGGGATGG + Intergenic
998363600 5:141613150-141613172 AAACATTCTCTTATGGAGGATGG - Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998697623 5:144658033-144658055 AAACATTGAGGGAGGGAAGAAGG - Intergenic
999104932 5:149062815-149062837 AAACACTTACCCAGGGAGGAAGG + Intronic
999186488 5:149714380-149714402 AAACATTCATTGAGGGGGTATGG - Intergenic
999465399 5:151799095-151799117 ACACATTCTCATAGGCAGGATGG - Intronic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1000437618 5:161232398-161232420 AAACACACAGAGAGGAAGGAAGG - Intergenic
1000506412 5:162125754-162125776 AAACTTACACAGAGTAAGGAAGG + Intronic
1001222673 5:169915592-169915614 ACACACACACAGAGGGAGGGAGG + Intronic
1001956496 5:175851389-175851411 AAACAGTCACACAAGGAGAAAGG + Intronic
1002082599 5:176746325-176746347 AAACAGTCCCAGAGAGAGGGTGG + Intergenic
1003331543 6:5133458-5133480 AATCATTGACAGAGGCTGGACGG - Intronic
1003429003 6:6022000-6022022 AGGCATGCACAGAGGGAAGATGG + Intergenic
1003498641 6:6686426-6686448 AGACACCCACAGAGGGAAGACGG - Intergenic
1003924728 6:10867013-10867035 ACACATGGACACAGGGAGGAGGG + Intronic
1004385611 6:15170211-15170233 ATACATTCATAAAGGGAGGAAGG - Intergenic
1004910614 6:20279278-20279300 AAAACTCCAAAGAGGGAGGAAGG - Intergenic
1006047204 6:31308147-31308169 GACCAATGACAGAGGGAGGAAGG - Intronic
1006398919 6:33804653-33804675 AAAGATTCAAAGAGGGAAGAGGG + Intergenic
1010950413 6:82030510-82030532 AGACATGCACAGAGGGAAGGTGG - Intergenic
1011458173 6:87575013-87575035 AAACATGCAGACAGGAAGGAAGG + Intronic
1012361491 6:98387514-98387536 GAATACTCAAAGAGGGAGGATGG - Intergenic
1012873733 6:104700871-104700893 AAACATTCACTCAGAGGGGAAGG - Intergenic
1013333095 6:109126035-109126057 AAACATTAGCATAGGGAGGTAGG + Intronic
1013949126 6:115758315-115758337 AAACTTTAACAGCGGGTGGAGGG + Intergenic
1014639564 6:123892689-123892711 AAATATTCATGGAGTGAGGATGG + Intronic
1014940262 6:127429834-127429856 AAACAATAACAGAAGGAGGCTGG + Intergenic
1015178951 6:130341128-130341150 AAAGAAACACAGAGGGAGGGAGG + Intronic
1016345658 6:143111434-143111456 AAAGAGTCAGAGAGGTAGGAAGG - Intronic
1016938872 6:149468480-149468502 AAGCAGTCACATATGGAGGAAGG + Intronic
1018122738 6:160652765-160652787 CAACATTTTGAGAGGGAGGAAGG + Intronic
1019932279 7:4231617-4231639 AAGCAATCAGAGAGGGAGGGAGG + Intronic
1020173313 7:5862583-5862605 AAACATGAAAAGAGGGAGTAGGG - Intergenic
1020352022 7:7230981-7231003 AAAAATTCAGAGATGTAGGAAGG - Intronic
1020831984 7:13103899-13103921 AGACATGCACAGAGGGATAACGG + Intergenic
1020898785 7:13976036-13976058 AAACACTCCCAGAAGGATGATGG - Intronic
1021597566 7:22333603-22333625 AAACCTTCATAGGGGTAGGATGG + Intronic
1022639111 7:32164742-32164764 ACACATTCCCAGAGGTGGGAGGG - Intronic
1023346898 7:39279690-39279712 AGACACACACAGAGGGAAGATGG - Intronic
1023616791 7:42028433-42028455 AAGCATTCACAGACGGATAAGGG + Intronic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1024538076 7:50454763-50454785 AAAGAGTCACAGAGGGAAGAAGG + Intronic
1026442795 7:70458650-70458672 AAACATCAACAAAGGGAGAAGGG - Intronic
1026540857 7:71278881-71278903 AGAGATACACAGAGGGAAGAAGG - Intronic
1026540942 7:71279477-71279499 AGACACACACAGAGGGAAGAAGG - Intronic
1026918556 7:74138448-74138470 CATCATTCAAAGAGGCAGGAAGG - Intergenic
1027172951 7:75885695-75885717 ACACATTGAGAGAGGGAGGGAGG + Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028109462 7:86921390-86921412 ACACAGACCCAGAGGGAGGACGG + Intronic
1028379062 7:90177526-90177548 AAAGATTCAGAGGGGTAGGAGGG + Intronic
1028696405 7:93717825-93717847 AAAGATGGAGAGAGGGAGGAAGG + Intronic
1029085429 7:98007939-98007961 AAACATGAAAAGAGGGAGTAGGG + Intergenic
1029696563 7:102217543-102217565 AACCATCCCCAGAGGGAGGGAGG + Intronic
1030090264 7:105852075-105852097 GGAACTTCACAGAGGGAGGATGG - Intronic
1030996889 7:116370530-116370552 ACACAGACACACAGGGAGGAAGG + Intronic
1031311088 7:120197813-120197835 AGACACACACAGAGGGAAGAAGG + Intergenic
1031986077 7:128165670-128165692 AAACAAGCACAGAGAGAGGGAGG + Intergenic
1032005636 7:128300175-128300197 AACCAATCACAAAGAGAGGAGGG - Exonic
1032203232 7:129838588-129838610 AAACATACACAGAGGTAAAATGG + Intronic
1032403272 7:131638344-131638366 AAACATCTAGAGAGGGAGGCTGG - Intergenic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033684967 7:143630462-143630484 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033688140 7:143709681-143709703 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033699646 7:143827159-143827181 AAAAATGCACAGAAGGAAGAAGG + Intergenic
1034043902 7:147907470-147907492 AAGCATCCACATAGGAAGGAGGG - Intronic
1034916345 7:155042977-155042999 CAACAATCACACAGGCAGGAAGG - Intergenic
1035255371 7:157622512-157622534 AAAGAGACACAGAGGGAGGGAGG + Intronic
1035444067 7:158927840-158927862 AAACATTCACTCAGGCTGGACGG - Intronic
1036279041 8:7383529-7383551 ATAAATTGACAGAGGGAGGAAGG + Intronic
1036342477 8:7928345-7928367 ATAAATTGACGGAGGGAGGAAGG - Intronic
1036914770 8:12794243-12794265 ATACACTCTCAGAGGGAGGGCGG - Intergenic
1037079680 8:14768729-14768751 GAACACTTACAGATGGAGGAAGG + Intronic
1037871621 8:22502824-22502846 AATCATTAACAGTGGGAGGTTGG + Intronic
1038582138 8:28757282-28757304 AGAGATTCAGAGAGGGAGGGAGG - Intergenic
1039263082 8:35794206-35794228 ACACATTTACAGAGGGCAGAGGG - Intronic
1039456472 8:37710756-37710778 AAGCAGTCACAGAGCCAGGAGGG - Intergenic
1039637690 8:39183664-39183686 CAACATCCAGAGAGGTAGGAAGG - Intronic
1039805617 8:40994977-40994999 AAAAAAAGACAGAGGGAGGAAGG + Intergenic
1041877265 8:62704132-62704154 AAACATTCAACCAGGGAAGATGG - Intronic
1042233358 8:66582103-66582125 AAACATTAAGAGAGGAAGAAAGG + Intronic
1042776156 8:72433849-72433871 AAACATTCATTGAGGGAAAATGG + Intergenic
1046010413 8:108539591-108539613 ACACAGACACAGAGGGAAGATGG + Intergenic
1046037765 8:108864601-108864623 GAAAATTAACAGAGGGATGAAGG + Intergenic
1046435478 8:114182574-114182596 AAACACTCACGGTGGGTGGAAGG + Intergenic
1046961126 8:120114074-120114096 ATACAGTCACAGAGGGAGCAGGG + Intronic
1047663326 8:127062375-127062397 AGACATGTACAGAGGGAAGATGG - Intergenic
1048253167 8:132884055-132884077 AGACAGACACAGAGGGAAGATGG - Intronic
1048253371 8:132885927-132885949 AAAGATGCACACAGGGAAGAAGG - Intronic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1048876184 8:138838324-138838346 ACACACTCACTGAGGGATGAGGG + Intronic
1049343375 8:142125747-142125769 AAAGATTCCCAGCTGGAGGAGGG - Intergenic
1050818483 9:9846779-9846801 AAACATTGAGAGCTGGAGGAAGG + Intronic
1052065319 9:24011308-24011330 AAATAGTCAGAGAGGGAAGACGG - Intergenic
1052362368 9:27574572-27574594 AATCATTCACCGAGGAAGAAAGG + Intergenic
1052678235 9:31654702-31654724 AAACATTTACAAAGGGAGAAAGG + Intergenic
1053047139 9:34929128-34929150 AAATATTCAGATAGGGAGAAGGG - Intergenic
1053360324 9:37482011-37482033 AGACAAACACAGAGGGAGAAAGG + Intergenic
1055554996 9:77464925-77464947 ACACAGACACAGAGGGAAGATGG + Intronic
1055713984 9:79097475-79097497 ACACACTCTCAGAGGGTGGAGGG - Intergenic
1057816673 9:98301044-98301066 AGAGATGCACAGAGCGAGGACGG - Intronic
1058408111 9:104699991-104700013 AAAAAATGACATAGGGAGGAGGG + Intergenic
1059770539 9:117419787-117419809 AAGAATTGACAGACGGAGGATGG - Intergenic
1060025000 9:120163345-120163367 AAACATACAGAAAGGAAGGAAGG - Intergenic
1061650442 9:132044099-132044121 AAAAAGTCACAGAGGGACAAAGG + Intronic
1062719039 9:138025265-138025287 AACAATTCACAGAGGTAGGCTGG - Intronic
1203585776 Un_KI270747v1:2136-2158 ACAGATGCAGAGAGGGAGGATGG + Intergenic
1185829053 X:3281314-3281336 AAAAATTCATGGAGGGAGGAAGG + Intronic
1187602906 X:20851650-20851672 AAACAGACACACAGGGAGGAAGG + Intergenic
1188831203 X:34899204-34899226 AAACATTAAGAGAGGAAGAAAGG + Intergenic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1190394925 X:49972350-49972372 ACACAAAAACAGAGGGAGGAAGG - Intronic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1190681484 X:52830408-52830430 AAAAAAACACACAGGGAGGATGG - Intergenic
1190739282 X:53278774-53278796 AAACTTTCAAATAGGGAGGAGGG + Intronic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1191915007 X:66192044-66192066 AAACACTAACAGAAGGAGGAAGG + Intronic
1193996589 X:88372942-88372964 AATGATTCACAGAGGAAGTAAGG + Intergenic
1195421325 X:104678288-104678310 AAACAATACCAGAGGGAGAATGG + Intronic
1195851039 X:109281556-109281578 AAACATTCACATAGAGATAAAGG + Intergenic
1197303321 X:124807909-124807931 ACACACACACAGAGGAAGGAAGG + Intronic
1198183549 X:134233147-134233169 AGACACACACAGAAGGAGGATGG + Intergenic
1199390794 X:147276080-147276102 AGACATACATAGAGGGAGAAGGG - Intergenic
1199425992 X:147701765-147701787 AAAGTATGACAGAGGGAGGAGGG - Intergenic
1200048874 X:153417914-153417936 AGACACACACAGAGAGAGGATGG + Intergenic
1202039845 Y:20669929-20669951 ACACATACACAGAAAGAGGATGG - Intergenic