ID: 1104711282

View in Genome Browser
Species Human (GRCh38)
Location 12:130988583-130988605
Sequence CTCTTGCAATGGAAGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104711278_1104711282 5 Left 1104711278 12:130988555-130988577 CCAAGAAAGCCATGTGTTTCTTT 0: 1
1: 1
2: 0
3: 41
4: 435
Right 1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 124
1104711276_1104711282 26 Left 1104711276 12:130988534-130988556 CCCAATTCAAGATAACTTTAGCC 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 124
1104711277_1104711282 25 Left 1104711277 12:130988535-130988557 CCAATTCAAGATAACTTTAGCCA 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 124
1104711279_1104711282 -4 Left 1104711279 12:130988564-130988586 CCATGTGTTTCTTTTTCATCTCT 0: 1
1: 0
2: 8
3: 198
4: 1836
Right 1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104711282 Original CRISPR CTCTTGCAATGGAAGCTCTA GGG Intronic
900848372 1:5121712-5121734 CAATTGGAATGGAAGCTCCAAGG + Intergenic
901330873 1:8407520-8407542 CACTTGCAACAGAAGCTCTGTGG + Intronic
904826118 1:33274978-33275000 CTATTGGAATGGTAGCTATAGGG - Intronic
905285571 1:36877829-36877851 CTTGGGGAATGGAAGCTCTATGG - Intronic
905972751 1:42153944-42153966 ATCTTGCAATGCCAGCTCAAGGG - Intronic
907931875 1:59008253-59008275 CTCTTGCACTGGGAGCTCCGGGG + Intergenic
910618108 1:89222232-89222254 CACTTACAAAGGAAACTCTATGG + Intergenic
916861578 1:168811775-168811797 ACCTTAGAATGGAAGCTCTAAGG + Intergenic
920491424 1:206418420-206418442 CTCTTGCAAAGGCAACTCCAAGG - Intronic
920864623 1:209741556-209741578 CACTTGGAATGGCAGCTTTAGGG + Intergenic
922364452 1:224851070-224851092 CTCCTGCAAGGGAAGCTCTTGGG + Intergenic
922741709 1:228017779-228017801 ATCTTGCTATGCAAGCTCCAGGG - Intronic
923475521 1:234327784-234327806 CTCTTGCTGTGGAAGCTGAAGGG + Intergenic
924317806 1:242816769-242816791 GTCTTCCACTGGTAGCTCTATGG - Intergenic
1066227889 10:33402454-33402476 TTCTGGCTTTGGAAGCTCTAGGG + Intergenic
1066997328 10:42576374-42576396 ATCTTGTTATTGAAGCTCTATGG + Intronic
1067069943 10:43124045-43124067 CTGGTGCAATGCAAGCTCAAGGG + Intronic
1070815572 10:79320841-79320863 CTTCTGCAATGGATGCTCTTTGG - Intergenic
1071326189 10:84520734-84520756 TTCTTGCCATGGAGTCTCTAAGG + Intergenic
1073247303 10:102100374-102100396 CTTTTACTATGGAAGTTCTACGG - Intergenic
1077963110 11:7096410-7096432 GTCTTGTAATTGAAGCTGTATGG + Intergenic
1078406389 11:11073857-11073879 CTCCTGCAATGAAAGCTTAAAGG - Intergenic
1080793861 11:35545049-35545071 CTCTTGCAATTGCAGCACTTTGG - Intergenic
1089102710 11:115976926-115976948 CTCTTGGAATGCAAGCTCCTTGG + Intergenic
1091678391 12:2508336-2508358 CACTTTAAATGGAAGCTTTATGG - Intronic
1094014988 12:25853020-25853042 ATCTTACAATGGAAGGTCTGTGG + Intergenic
1100170476 12:91969917-91969939 CTATTGCAATGACAGCACTAAGG + Intergenic
1101101071 12:101393237-101393259 CTGTTGAAATGTAAGCTCTGAGG - Exonic
1101725466 12:107384834-107384856 CTCCTGCAGTGGAGGCTGTAGGG - Intronic
1102997265 12:117360467-117360489 CTCCCGCAAAGGAGGCTCTAGGG - Intronic
1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG + Intronic
1106945956 13:34827965-34827987 ATCTTGCAGTGGAAGTTCTGAGG - Intergenic
1108808703 13:54192747-54192769 CTCTTACAAGCGAAGCTCCACGG + Intergenic
1108856007 13:54793246-54793268 CTCTCCCTCTGGAAGCTCTAGGG + Intergenic
1109340848 13:61056211-61056233 GTCTTGAAATGCTAGCTCTAGGG - Intergenic
1113026265 13:105944692-105944714 CTCTTGCAAATGAAGCACTTTGG + Intergenic
1114713015 14:24797355-24797377 CTGTTCCTCTGGAAGCTCTAGGG + Intergenic
1116049369 14:39784454-39784476 CTCTTATAATGGAATCTGTAAGG - Intergenic
1116699508 14:48221669-48221691 CTCTTGGCTTGGAAGATCTAGGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1119588669 14:75863316-75863338 ATCCTGCATTGGAAGCTCTCTGG + Intronic
1119939359 14:78624464-78624486 CTCTTGCCATGCCAGCTCTCAGG - Intronic
1123797654 15:23788965-23788987 ATCTAGCAATGTAAGCTCCATGG - Intergenic
1127286030 15:57534516-57534538 CTCTTGAAATGAAGGCTCTCTGG + Intronic
1128737943 15:70064018-70064040 CCCTCGCAATGGAAGATCCAGGG + Intronic
1130330753 15:82920472-82920494 CTCTAGGGTTGGAAGCTCTAAGG + Intronic
1135699491 16:24619649-24619671 CTCTTGCACTGGAAGATGAAGGG + Intergenic
1139694456 16:68663701-68663723 GTCTGGGAAGGGAAGCTCTAAGG + Intronic
1145413408 17:22693535-22693557 TTCTTGCAAATGAAGCTTTACGG - Intergenic
1145912564 17:28551157-28551179 CTGCTGCTTTGGAAGCTCTAGGG + Intronic
1146094947 17:29920482-29920504 GACTTGCAATGGAACTTCTATGG + Intronic
1146324868 17:31877430-31877452 CTCTTAGACTGGAGGCTCTATGG - Intronic
1148536080 17:48440232-48440254 CTCCTGCAATGGAAGCTCTGTGG + Intergenic
1155259415 18:24026889-24026911 CTCTTGCAAATGAAACTCTTTGG + Intronic
1157870294 18:51224104-51224126 CTCTTGAAATGTAAGATATAGGG - Intergenic
1162043673 19:7985241-7985263 CTCATGCACTGGAATCACTAGGG - Intronic
1165076819 19:33283944-33283966 ATTTAGAAATGGAAGCTCTACGG + Intergenic
1165178088 19:33944774-33944796 CTCTTTCAATGGAAGTTTTGGGG - Intergenic
1168423655 19:56221897-56221919 CTCTTTCAATGTAATCTCTGTGG - Exonic
928726978 2:34185846-34185868 TTGCTGCAATGTAAGCTCTAGGG - Intergenic
930355785 2:50317431-50317453 CACTTACAATGGAAGCTAGAGGG + Intronic
930817152 2:55609893-55609915 CTCTAGCAAGGGAAACTGTACGG + Intronic
943406708 2:187496297-187496319 ATCTGGAAATTGAAGCTCTATGG - Intronic
948827651 2:240580632-240580654 CACTGGCAGTGGAAGTTCTAAGG + Exonic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1169687404 20:8290605-8290627 CGCTTGCACTTGAAGCTGTAGGG + Intronic
1175702160 20:61147457-61147479 CTCATGCCTTGGAATCTCTAAGG - Intergenic
1177179927 21:17734179-17734201 CTATTGCAATGACAGCTCCAAGG + Intergenic
1179313091 21:40214020-40214042 GTCTAGGAAAGGAAGCTCTATGG - Intronic
1179486469 21:41713855-41713877 CTCTGGCCATGGAAGTGCTAAGG - Intergenic
1180885511 22:19240570-19240592 GTCTTGCACTGGGAGCTTTAAGG + Intronic
1182567817 22:31212802-31212824 CTCTTATAGTGGAAGCTCTGTGG + Intronic
1182573750 22:31258965-31258987 CACTTCCTTTGGAAGCTCTAGGG + Intronic
1182620846 22:31617802-31617824 CTGTTGCCCTGGAAGCTCTGAGG - Intronic
949450735 3:4182103-4182125 CTCTTGAATAGGAATCTCTAGGG - Intronic
949716632 3:6939661-6939683 ATCTGGCAATGGAGGCTTTAGGG - Intronic
950307137 3:11924715-11924737 CAGTTGAAATGGAATCTCTAGGG + Intergenic
950330661 3:12153624-12153646 CTGTTGGAACGAAAGCTCTATGG - Exonic
958069566 3:88592890-88592912 CTCTTGTAATAAAACCTCTACGG - Intergenic
958101976 3:89023710-89023732 ATCTTGCAAAGTAAGGTCTATGG - Intergenic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
960062193 3:113334785-113334807 CTCTTGCTTTGGAAGCACTCAGG + Intronic
964453340 3:156834324-156834346 ATCTTGTAAAGGAAGCTCTGTGG - Intronic
964794444 3:160481912-160481934 CAGTTGCAATGAAAGGTCTACGG + Intronic
965150014 3:164960897-164960919 CTCTTCTAATGGAAGCTCTTTGG - Intergenic
970981056 4:22097814-22097836 CTGTTGCCATGGAATCTCTGTGG - Intergenic
973263818 4:48190673-48190695 CTCTTGCACTTGAGGCTCTTTGG - Intronic
982558658 4:156901162-156901184 CTGATGAAATGGAATCTCTATGG - Intronic
984446338 4:179841578-179841600 ATCTTGGAATGGAAGCTCCTTGG - Intergenic
985393549 4:189516472-189516494 CCATTGGAATGGAAGCTCCATGG + Intergenic
985940077 5:3128255-3128277 CTCTTGTAGTGGTAGATCTATGG - Intergenic
988303161 5:29460534-29460556 CTCTTGCTATAGAACCTTTAGGG - Intergenic
989196661 5:38723242-38723264 CTCTGGCAAGGGCAGCTCTCTGG + Intergenic
990676773 5:58195492-58195514 GTGAAGCAATGGAAGCTCTAGGG + Intergenic
991624648 5:68587576-68587598 TTCTTTCAATGGAAGCTCCATGG + Intergenic
993847083 5:92957455-92957477 TTCATGCAATGGATGCTTTAGGG + Intergenic
997395890 5:133559636-133559658 ATATTGCAATGCAACCTCTAAGG + Intronic
998213432 5:140218967-140218989 CTCTTGCCATGAAAACTGTAAGG - Intronic
998608040 5:143656999-143657021 TTCTGGGAATGGAACCTCTATGG + Intergenic
999229290 5:150052320-150052342 CTCAGGGAATGGAAGCTCTTTGG - Exonic
1002071824 5:176683161-176683183 CTCTCACAGTGGAAGCTCTAGGG + Intergenic
1003012121 6:2435890-2435912 CTTTGCCCATGGAAGCTCTAGGG + Intergenic
1004954176 6:20709032-20709054 CCATTGCAATGTAAGCTCCAAGG + Intronic
1005737459 6:28761750-28761772 CTGTTGAAATGGAAGGCCTAGGG - Intergenic
1005742590 6:28806275-28806297 CTGTTGAAAGGGAAGGTCTAGGG - Intergenic
1007177030 6:39903959-39903981 GTCTTGCAGTGGGAGCTCTTGGG - Exonic
1007662564 6:43495755-43495777 CTCTGGCCATGGAAGCCCTGGGG + Intronic
1008122414 6:47633692-47633714 GGCTTCCAAAGGAAGCTCTAGGG + Intergenic
1010734213 6:79424966-79424988 CTCTTTCAATGCAGGCTCTAGGG + Intergenic
1012570110 6:100713915-100713937 CTCTTGCAAAGAAGGCTATACGG + Intronic
1013345633 6:109257617-109257639 CTCTTGGAAGAGATGCTCTAGGG - Intergenic
1022030494 7:26487877-26487899 CTCTTGCAGTGGATGCTGTGGGG + Intergenic
1022485960 7:30777843-30777865 CTCTAGCAATGGAAAATCTGGGG - Intronic
1023145243 7:37144520-37144542 GTCTTGAAATGGAAGCTGCAGGG + Intronic
1032023008 7:128420598-128420620 GTCTTGCAATGTATGCTCTGAGG + Intergenic
1038858497 8:31359668-31359690 CCCTAGCAATGGAAGCTATCAGG + Intergenic
1039983496 8:42428672-42428694 CGCATGCAAGGGAAGCTGTAGGG - Intronic
1041533504 8:58898723-58898745 CCTTTGCAATGGAAACTGTAGGG + Intronic
1042214360 8:66415012-66415034 CTCTAGAAATGGATGCTTTAGGG - Intergenic
1042671933 8:71273769-71273791 CTCTTGAATTGGGAGCTCTCTGG + Intronic
1046765780 8:118068149-118068171 CTCTGGCACTGTAAGCTCTGTGG - Intronic
1055089873 9:72352614-72352636 CTCTTGCAAAGAAAGCCTTACGG + Exonic
1057473861 9:95382284-95382306 CTAATGCAATGGAAACTCCAAGG + Intergenic
1058298010 9:103332989-103333011 CTCTTGCTTTGGAATCTCAACGG + Intergenic
1059663396 9:116423688-116423710 CTCTCACAATCTAAGCTCTAAGG - Intergenic
1060700328 9:125745930-125745952 CCCTTTCAATGGAAAGTCTATGG + Intergenic
1186690656 X:11971878-11971900 CTCTTACAATGGAAGTGATATGG + Intergenic
1193181220 X:78459340-78459362 ATCTTGTAATGGAAGTTCTGTGG - Intergenic
1195618776 X:106933143-106933165 TTCTTGCAATGGAAGGACTCCGG + Intronic
1197526597 X:127571838-127571860 CTTTTGCAAAGAAATCTCTAAGG + Intergenic
1198914336 X:141650975-141650997 CTCTTAAATTGGAAGCTCTTTGG + Intronic