ID: 1104714149

View in Genome Browser
Species Human (GRCh38)
Location 12:131005536-131005558
Sequence CTCTGCGTGTGGAGGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 429}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104714142_1104714149 1 Left 1104714142 12:131005512-131005534 CCTCACTCAGTGTTGCCCTAAAT 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG 0: 1
1: 0
2: 3
3: 46
4: 429
1104714141_1104714149 12 Left 1104714141 12:131005501-131005523 CCTGCATTCTGCCTCACTCAGTG 0: 1
1: 0
2: 1
3: 23
4: 262
Right 1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG 0: 1
1: 0
2: 3
3: 46
4: 429
1104714140_1104714149 21 Left 1104714140 12:131005492-131005514 CCTTGAAAACCTGCATTCTGCCT 0: 1
1: 0
2: 2
3: 31
4: 344
Right 1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG 0: 1
1: 0
2: 3
3: 46
4: 429
1104714138_1104714149 23 Left 1104714138 12:131005490-131005512 CCCCTTGAAAACCTGCATTCTGC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG 0: 1
1: 0
2: 3
3: 46
4: 429
1104714139_1104714149 22 Left 1104714139 12:131005491-131005513 CCCTTGAAAACCTGCATTCTGCC 0: 1
1: 0
2: 5
3: 19
4: 281
Right 1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG 0: 1
1: 0
2: 3
3: 46
4: 429
1104714137_1104714149 24 Left 1104714137 12:131005489-131005511 CCCCCTTGAAAACCTGCATTCTG 0: 1
1: 0
2: 2
3: 17
4: 226
Right 1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG 0: 1
1: 0
2: 3
3: 46
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104714149 Original CRISPR CTCTGCGTGTGGAGGGCAGA CGG Intronic
900778383 1:4601127-4601149 CTCCGAGTGTAGAGGGCGGAAGG - Intergenic
901271528 1:7955529-7955551 CTCTGCCTGTGGAGGTCACAAGG - Intronic
901840255 1:11949814-11949836 GTCGGCAGGTGGAGGGCAGAAGG + Exonic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903680720 1:25094978-25095000 GTCTGTGTGTTGAGGGCAGGTGG - Intergenic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903886167 1:26542331-26542353 CTCTGCGGGTGGATGGCTGCCGG - Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904320929 1:29697465-29697487 CTCGGGGTGTGCAGGGTAGATGG - Intergenic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
906568366 1:46816249-46816271 GTCTGAATGTTGAGGGCAGAGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907461513 1:54608283-54608305 CTCTGGGTGCTGAAGGCAGAAGG + Intronic
907481488 1:54748290-54748312 CTCTGCGGGCTCAGGGCAGAGGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908175646 1:61552754-61552776 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
908967833 1:69787419-69787441 CTCTGCGAGGGCAGTGCAGAGGG - Intronic
909177624 1:72380619-72380641 CTCTGCGAGGGCAGTGCAGAAGG - Intergenic
909732724 1:78914821-78914843 CTCTGCGCTTGGAGGGTAGAAGG + Intronic
910000013 1:82330631-82330653 CTCTGTGTGTGGCTTGCAGATGG + Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
912084041 1:105977031-105977053 CTCTGCTAGTGCAGTGCAGAAGG + Intergenic
913307805 1:117450901-117450923 CTCTGCTAGGGGAGGGCCGAAGG + Intronic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
915673451 1:157509730-157509752 CTCTGCGTGGGAAGGGAAGAAGG - Intergenic
915689598 1:157675660-157675682 CTCTGCTAGTGCAGTGCAGAAGG + Intronic
916123749 1:161551064-161551086 CTCTGTGTGTGGCGGGGGGAGGG - Intergenic
917035433 1:170742970-170742992 CTCTGCGAGGGCAGTGCAGAAGG - Intergenic
917371849 1:174301480-174301502 CTCTGCCAGCAGAGGGCAGAGGG + Intronic
917717681 1:177754509-177754531 TTCTGCATATTGAGGGCAGAGGG - Intergenic
918105810 1:181414085-181414107 CTCTGTTTGTGTAGGGCAAAAGG + Intronic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
920666173 1:207964179-207964201 GTCTTCGTGGGGTGGGCAGAAGG - Intergenic
920895911 1:210049264-210049286 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
920953597 1:210597566-210597588 CTCTGCTTGTGGAAAGGAGAAGG - Intronic
921165009 1:212500553-212500575 CTCCTCCTGTGGAGGGGAGAGGG + Intergenic
922377199 1:224980390-224980412 CTCTGCCTGTGGAGAGAGGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063417853 10:5888994-5889016 CTCTGCGAGTAGAGGGGAGGCGG + Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067052489 10:43030022-43030044 CTCTGCGTGTGGCGTGTAAATGG - Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067942283 10:50667213-50667235 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1068374813 10:56164895-56164917 CTCTGCGAGGGTAGTGCAGAAGG + Intergenic
1068411427 10:56660630-56660652 CTCTGCTTGAGGAAGGAAGATGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070863529 10:79692171-79692193 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1072189570 10:93068919-93068941 CTCTGGGCGCGGAGCGCAGAAGG - Intergenic
1073042012 10:100614352-100614374 CCCTGCGTGGGGTGGGTAGATGG - Intergenic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075074993 10:119344789-119344811 ATGTGCGTGTGGGGTGCAGAGGG + Intronic
1075690861 10:124393202-124393224 CTCTGCCAGTGAAGGGCAGAGGG + Intergenic
1076386190 10:130057659-130057681 GTCAGCATGTGGATGGCAGAGGG + Intergenic
1076398194 10:130157161-130157183 TCCAGCATGTGGAGGGCAGATGG - Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1078652983 11:13213174-13213196 CTATGGCTGTAGAGGGCAGAGGG + Intergenic
1079185819 11:18235596-18235618 CTCTTGGTGTAGAGTGCAGAAGG - Intronic
1080640544 11:34155899-34155921 CCCTGCATGGGGAGGGCAGAGGG - Intronic
1080717567 11:34818837-34818859 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
1080805722 11:35651511-35651533 CTCAGGCTGTGCAGGGCAGAGGG - Intergenic
1081491752 11:43574950-43574972 CTCTTCGGGTGGAGAGCAGAGGG + Intronic
1083121849 11:60520853-60520875 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
1083311459 11:61786008-61786030 CTCTGGGGGTGCGGGGCAGATGG - Intronic
1083990903 11:66245111-66245133 CTCTGCAGGTGGAGGGAATAGGG + Intergenic
1084214414 11:67639772-67639794 CTGTGCGGGAGGAGGGCAGGTGG + Intergenic
1084554570 11:69868215-69868237 CTCTGCCGGTGGACGGAAGAAGG - Intergenic
1084668622 11:70592210-70592232 CCCTGCGTGCAGAGGGAAGACGG - Intronic
1084731935 11:71079374-71079396 CTCTCCGCGTGGAGGGCATATGG + Intronic
1084876230 11:72135783-72135805 CGCTGCGTGTAGAGGTGAGAGGG - Intronic
1084881100 11:72172279-72172301 CGCTGCGTGTAGAGGTGAGAGGG - Intergenic
1084891793 11:72240328-72240350 GGCTGCGTGCGGAGGGCCGAAGG - Intronic
1085699002 11:78729685-78729707 CTCACCGAGTGGAGGGAAGATGG + Intronic
1086033147 11:82384243-82384265 CTCTGCCTGTGGAAAGAAGAAGG + Intergenic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086494145 11:87385121-87385143 CTCTGCATGGGGATGGGAGAGGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086995716 11:93353537-93353559 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1088375846 11:109140879-109140901 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
1089063651 11:115645955-115645977 CGCTGCGTGGGGAGTGCGGAGGG + Intergenic
1089762149 11:120735768-120735790 CTCTGCCTGTGGAAAGGAGAGGG - Intronic
1090435604 11:126684148-126684170 CTCTCCCTGTGCAGGGCTGATGG + Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090874456 11:130776425-130776447 CTCTGTGTGTTGAGGGTACAAGG + Intergenic
1093903247 12:24660839-24660861 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1095227463 12:39694845-39694867 CTCTGCTTGAGGAGAGGAGAAGG + Intronic
1095626179 12:44318026-44318048 CTCTGCATGGGGAGGGGTGACGG + Intronic
1096007317 12:48183784-48183806 CTCTGCTTGTGGCGCCCAGAGGG + Exonic
1096189885 12:49609613-49609635 GTCTGAGTGTGGAATGCAGAGGG - Intronic
1096768500 12:53914881-53914903 CTATGCGTGTGTGGGGCAGGGGG - Intergenic
1097249755 12:57626038-57626060 CTCATCATGTGGAGTGCAGAGGG + Exonic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098649907 12:72952109-72952131 CTCTGCCAGTGCAGTGCAGAAGG - Intergenic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104323581 12:127774625-127774647 CCTGGCGTGTGGAGGGAAGACGG - Intergenic
1104569095 12:129909421-129909443 CTCTGCGTGTGCCAGGCAGGTGG + Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105259589 13:18769208-18769230 CTCTACGAGTGCAGTGCAGAAGG + Intergenic
1105280466 13:18960002-18960024 GTCTGCGGGTGGAGGACAGATGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106718798 13:32418472-32418494 CTCTGCTAGTGCAGTGCAGATGG + Intronic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1109576310 13:64263747-64263769 CTCTGCTAGGGCAGGGCAGAAGG + Intergenic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110566219 13:76959831-76959853 CTCTGCTTGGGCAGTGCAGAAGG - Intergenic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1115381623 14:32746213-32746235 TTCTGCTTGAGGAGAGCAGAGGG - Intronic
1115925189 14:38425403-38425425 CTCTGCTTGAGGAGGGATGAAGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120121054 14:80680519-80680541 GTCTGCGTGTGGAGCAGAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120320550 14:82955182-82955204 ATATGCGTGTGGAGGGTAGGAGG - Intergenic
1122692720 14:103538805-103538827 CTCCGCGTGGGGAGGGCCCATGG - Intergenic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1123565809 15:21545838-21545860 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123602071 15:21983125-21983147 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1124230195 15:27938366-27938388 CTCTGCAAGTTGTGGGCAGAAGG - Intronic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1126534203 15:49742664-49742686 CTCTGCGTGTGGAAAGGGGAGGG + Intergenic
1126670402 15:51110695-51110717 CACTGCTTGTGCAGGGCAGGTGG - Intergenic
1126933546 15:53681275-53681297 GGCAGCGTGGGGAGGGCAGATGG + Intronic
1129248986 15:74297874-74297896 CTTAGCTTGGGGAGGGCAGAGGG - Intronic
1130409303 15:83631411-83631433 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
1202974178 15_KI270727v1_random:272931-272953 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1132775302 16:1590390-1590412 CTCAGCGTGTGGAGGGTATGAGG - Intronic
1132785916 16:1656918-1656940 CGCTGCTTGTGGAGGGCGGTGGG - Exonic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1134017857 16:10901798-10901820 CTCTCCGTGTGGAGGCCCTAGGG + Intronic
1134345660 16:13388988-13389010 CTATGCGTGTATAGGACAGAGGG - Intergenic
1134803647 16:17107274-17107296 CTCTCCATGGGAAGGGCAGATGG + Exonic
1135424323 16:22324789-22324811 ATCTGGGTGTGAAGGGCAGGTGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136284605 16:29233615-29233637 CTCGGAGTGGGAAGGGCAGACGG + Intergenic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1140481848 16:75266315-75266337 CTCAGCTGGGGGAGGGCAGAGGG - Intronic
1140487434 16:75304816-75304838 CACTGCGGGTGGAGGGAAGGCGG - Intronic
1142183223 16:88681676-88681698 CTCTGCCTGTGGGGGGCTGGTGG - Exonic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1142938727 17:3362715-3362737 CTCTGCTAGTGGAGTGCTGAGGG - Intergenic
1143256576 17:5562110-5562132 CTCTGCCTGTGGTAGCCAGATGG + Intronic
1144335978 17:14269288-14269310 CCCTGCCTGTGGGTGGCAGATGG - Intergenic
1144519216 17:15943292-15943314 TTATGCCTGTGGAGGGCAGAGGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1145878872 17:28339747-28339769 CTCGGGGTGGGGAGGGCAGGAGG + Intronic
1145942269 17:28748821-28748843 CTCTACGTGAGGAAGACAGAGGG - Intronic
1147342884 17:39765342-39765364 TTCAGCCTGTGAAGGGCAGAAGG + Exonic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148869605 17:50648747-50648769 CTCTGTGTGTTGGGGGCAGGTGG - Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151680714 17:75621328-75621350 CCCAGCCTGTGGGGGGCAGAGGG - Intergenic
1151930289 17:77227874-77227896 CTCTGCGGCTGGTGGGGAGAAGG + Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152489364 17:80619254-80619276 CTCTCAGTGTGGGGGACAGAAGG + Intronic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1152889743 17:82873714-82873736 GTCTGGGTGTGGAGGGCTGGGGG + Intronic
1152912615 17:83013702-83013724 CCCCGCGGGGGGAGGGCAGAGGG + Intronic
1153242871 18:3046442-3046464 GTCTGCAGGAGGAGGGCAGAGGG + Intergenic
1153356650 18:4144006-4144028 CTCTGCTTGAGGAGAGGAGAAGG - Intronic
1153615450 18:6929581-6929603 CTCTCCGAGTGGAAGGCAGAGGG - Intergenic
1154262050 18:12843611-12843633 CTCCGCTGGTGGAGGGCAGCAGG + Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154378022 18:13824719-13824741 ATCTGAGTTTGGAGGGCAAAGGG + Intronic
1154429178 18:14295188-14295210 CTCTACGAGTGCAGTGCAGAAGG - Intergenic
1154431450 18:14311533-14311555 CTCTACGAGTGCAGTGCAGAAGG - Intergenic
1154434128 18:14330837-14330859 CTCTACGAGTGCAGTGCAGAAGG - Intergenic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1156368578 18:36451994-36452016 TGCTGCTTGTGGAGGGCAAAGGG - Intronic
1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG + Intronic
1157386731 18:47264039-47264061 ATCAGCGGGAGGAGGGCAGAGGG + Intergenic
1157528946 18:48406110-48406132 CTGTGCCTGTGTAGGGCTGAAGG - Intronic
1158532222 18:58273921-58273943 CTCTCTGTGTGGATGGGAGAGGG - Intronic
1159215593 18:65387110-65387132 CTCTGCTAGGGCAGGGCAGAAGG + Intergenic
1159446252 18:68544926-68544948 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1159461177 18:68723909-68723931 CTCTACTAGGGGAGGGCAGAAGG - Intronic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162386196 19:10361887-10361909 GCCTGCGAGTGGAGGGCAGCGGG - Exonic
1162858302 19:13486904-13486926 GGCTGCGTGTGTAGGGAAGAAGG - Intronic
1163382873 19:16980259-16980281 CTCTGTGTGTGCAGGGGACAGGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163555241 19:17988396-17988418 CTCCCTGTGTGCAGGGCAGAGGG - Exonic
1165899421 19:39161876-39161898 ACCTGCGTGAGGAGGGGAGAGGG - Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166656498 19:44615789-44615811 CTCTCAGGGCGGAGGGCAGAGGG + Intronic
1167209173 19:48122423-48122445 CTCTGCGTGTGCAGGGAGCAAGG - Intronic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
926061775 2:9809001-9809023 GTCTCAGTGTGAAGGGCAGAGGG - Intergenic
926499902 2:13641215-13641237 ATCTGCCAGGGGAGGGCAGAGGG + Intergenic
927050257 2:19321234-19321256 CTCTGCTTGAGGAGGGCACCGGG + Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
929099936 2:38301931-38301953 TTCTGCGTGAGGAGAGGAGAGGG + Intronic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
929938952 2:46315773-46315795 CTCTGAGGGTGGAGGGCAAGAGG + Intronic
929964596 2:46524783-46524805 GTCTGCGTGTGGAGAGCAGGTGG + Intronic
931012226 2:57929962-57929984 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
931460602 2:62447262-62447284 CTCTGCATCAGGATGGCAGAAGG + Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
938293556 2:130162953-130162975 CTGTCCCTGTGGAGGGCAGGAGG - Intronic
938435116 2:131278301-131278323 CTCTGCGAGGGCAGTGCAGAAGG - Intronic
938462999 2:131510008-131510030 CTGTCCCTGTGGAGGGCAGGAGG + Intergenic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
939638758 2:144614049-144614071 CTCTGAGTGTTTGGGGCAGAAGG - Intergenic
940288758 2:152057799-152057821 CTCTGCCTATGGCAGGCAGAGGG + Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941060045 2:160836708-160836730 CTCTGCCTGGGGAGGACACAGGG - Intergenic
941453654 2:165690817-165690839 CTCTTCTGGTGGGGGGCAGAAGG + Intergenic
941678663 2:168371506-168371528 CTCTGCCTGTGAAAAGCAGAAGG + Intergenic
942538973 2:176995659-176995681 CTCTAAGTGTGGAGGAGAGAAGG - Intergenic
942880707 2:180857633-180857655 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
942972207 2:181970808-181970830 CTCTGCTTGTGGAAAGGAGATGG - Intronic
944800183 2:203231317-203231339 CTCTGCTAGTGCAGTGCAGAAGG + Intergenic
944990471 2:205229881-205229903 CTCTGCTTGTGGAAAGAAGAGGG - Intronic
945457112 2:210063320-210063342 CTCTGCTAGGGGAGTGCAGAAGG + Intronic
945724868 2:213463745-213463767 CTCTGCTAGGGGAGTGCAGAAGG + Intronic
947819057 2:233058355-233058377 TCCTGAATGTGGAGGGCAGAAGG + Intergenic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1169680909 20:8212775-8212797 CTCTGCATGTGGAGTGCAACTGG - Intronic
1170278046 20:14614989-14615011 CTCTGCGTGTGCTGGGGAAAGGG + Intronic
1170709311 20:18775736-18775758 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
1171936917 20:31283523-31283545 ATCTGAGGGTGGAGGGCAGGAGG + Intergenic
1172418885 20:34797222-34797244 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
1173342058 20:42161616-42161638 CTTGGCCTGAGGAGGGCAGAGGG + Intronic
1173365276 20:42379542-42379564 CTGAGCCTGTGGAGGGCAGCAGG + Intronic
1173923346 20:46762233-46762255 CTTTGAGTGTTGAGGCCAGAAGG + Intergenic
1174193805 20:48758609-48758631 CTCTACATGTGCAGGGCTGAAGG + Intronic
1174428287 20:50448873-50448895 GGCGGCGTGTGCAGGGCAGAGGG - Intergenic
1174579652 20:51562622-51562644 CTCTGCATCTGGAGGGCACGGGG + Intronic
1175541618 20:59751445-59751467 ATGCGCGTGTGCAGGGCAGAGGG - Intronic
1175895368 20:62333573-62333595 CCCTGCGTGTGGAGGCCGAAGGG - Exonic
1176107217 20:63395125-63395147 CTCTGAGGGTGGAGAGCACACGG - Intergenic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1176845595 21:13874234-13874256 CTCTACGAGTGCAGTGCAGAAGG + Intergenic
1177724678 21:24951504-24951526 CTCTGCATTTTGAGGGGAGAGGG - Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178338635 21:31766370-31766392 CTCTGCTTGGGGAGTGCAGAAGG + Intergenic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179522690 21:41955400-41955422 CTCTGCAAGAGGAGGGCACAGGG - Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180011043 21:45051707-45051729 CTCTGCATGTGAGGGGCAGTGGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1181107227 22:20582530-20582552 CTATGCGTGCGGTGGGCAGGTGG + Intronic
1181463061 22:23096630-23096652 CTCAGGGTGTGGAGGCCACAGGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1182316904 22:29453838-29453860 CTCTGCGAGATGAGAGCAGAGGG - Intergenic
1182585180 22:31340919-31340941 ATCTGAGTGGGAAGGGCAGAGGG + Intronic
1182686020 22:32122248-32122270 CACTGCCTGTGGAGGGGAGTGGG + Intergenic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183481323 22:38067096-38067118 GTTTGCGTGGGGAGGGAAGAAGG + Intronic
1183732713 22:39627708-39627730 CTCGGCTTGGGGAGAGCAGAAGG + Intronic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
1184468636 22:44683416-44683438 TTCTGGGTGTGGGTGGCAGATGG - Intronic
1184578768 22:45397983-45398005 CTCTGCCAGCAGAGGGCAGAGGG - Intronic
1185229321 22:49671072-49671094 ATTTGCGTGGGGAGGGCAGGAGG - Intergenic
949474622 3:4431662-4431684 CTGTGCCGGTGAAGGGCAGAGGG - Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
949663014 3:6303706-6303728 GTCTGTGTGTGGAGTGTAGAGGG - Intergenic
951172092 3:19554470-19554492 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
951773479 3:26283762-26283784 CTCTGCTTGGGCAGTGCAGAAGG - Intergenic
951829335 3:26906996-26907018 CTCTGCGTGTGGTTGTGAGAGGG - Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
953970225 3:47341677-47341699 CACAGCGTGTGGATGGGAGACGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956963901 3:74435915-74435937 CTCTGTGTGTAGAGGATAGATGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957293437 3:78306693-78306715 CTCTATGTGTGGAGGCCTGATGG + Intergenic
958050275 3:88335696-88335718 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
959368269 3:105490959-105490981 CTCTGCGAGGGCAGTGCAGAAGG - Intronic
959756487 3:109905859-109905881 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
959893643 3:111583498-111583520 CTCTGCTTGGGCAGTGCAGAAGG - Intronic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
961601388 3:128064911-128064933 CTGTGCGTGTGGCCAGCAGATGG - Exonic
961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG + Intronic
961836933 3:129669653-129669675 CTCTGCGTGTGAAGGTAACAAGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
963933841 3:151032578-151032600 ATCGGAGGGTGGAGGGCAGAAGG + Intergenic
964710248 3:159664237-159664259 CTCTGCCTGGTGTGGGCAGAGGG + Intronic
964804143 3:160588092-160588114 CTCTGCCTATGGAAAGCAGAGGG + Intergenic
965108398 3:164388131-164388153 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
965145045 3:164890263-164890285 CTCTGCTTGAGGAGAGGAGATGG - Intergenic
965777031 3:172242354-172242376 CTCTGCTAGGGTAGGGCAGAAGG - Intronic
966749840 3:183311471-183311493 CTCTGTATGTGGATGCCAGACGG + Intronic
967689554 3:192458178-192458200 CTCTGCTTGGGAAGTGCAGAAGG + Intronic
968334539 3:197901637-197901659 CTCCGCATGTGGAAAGCAGATGG + Intronic
968561654 4:1286345-1286367 CTCTGCTGGTGAAGGGCAAAGGG + Intergenic
968600390 4:1505990-1506012 CCCTGCTTCTGGAGGGCACAGGG - Intergenic
969592788 4:8131511-8131533 TTCTGCATGCGGAGGGCAGATGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970784872 4:19783689-19783711 CTCTGCTCGTGCAGTGCAGAAGG - Intergenic
971670237 4:29546613-29546635 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
972337711 4:38122396-38122418 CACTGGTTGTGCAGGGCAGAAGG - Intronic
972346876 4:38199742-38199764 CTCTGCGTGTGGTGGGAACGGGG - Intergenic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
972960752 4:44448848-44448870 CTCTCCGTGGGGAGGGCGGGAGG + Intergenic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
974317921 4:60306376-60306398 CTCTGCTTGGGCAGTGCAGACGG - Intergenic
975592349 4:76012436-76012458 CCCTGCGTGGGGAGAGGAGAGGG - Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
977307407 4:95342258-95342280 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
978654314 4:111048611-111048633 CTCTGCTTGAGGAGAGAAGAAGG + Intergenic
980099515 4:128527672-128527694 CTGTGCGTGGAGAGAGCAGAGGG + Intergenic
980426182 4:132630578-132630600 CTCTGCTTGGGCAGTGCAGAAGG + Intergenic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
983282179 4:165694900-165694922 CTCAGCCTGTGGAGGGCATATGG + Intergenic
983845646 4:172514581-172514603 ATCTGGGGGTGGAGGGCAAATGG - Intronic
984590621 4:181613491-181613513 CTCTGCGTTAGGAGAGCTGAGGG - Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986423416 5:7606983-7607005 CCCTGCATGTGCAGGGCAGGTGG - Intronic
987975166 5:25006060-25006082 CTCTGCTTGTGGAGGGCTTGAGG + Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
989671765 5:43925390-43925412 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
990774266 5:59287322-59287344 CTCTGCTTGTGGAAAGGAGAAGG + Intronic
991594515 5:68288852-68288874 CGCTGCCTGGGGAGGACAGATGG + Intronic
993278813 5:85898410-85898432 CTCTGCCTTTGGAAAGCAGATGG - Intergenic
993689580 5:90982826-90982848 CTCTGCATGTGGTGGGAGGAGGG + Intronic
995319994 5:110823713-110823735 GTCTGCCAGTGGAGGGAAGATGG - Intergenic
997091551 5:130864469-130864491 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
1000610139 5:163365095-163365117 CTCTGCCAGTGAAGGGCAGAGGG - Intergenic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1001485441 5:172116466-172116488 CTCTGCAGGTGGATGGCAAAAGG + Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002571754 5:180143510-180143532 CTCAGCGTGGGGCTGGCAGAAGG + Intronic
1003438009 6:6111803-6111825 CTCTGCTTGAGGAGAGGAGAAGG - Intergenic
1004271795 6:14202210-14202232 CTCTGCGTGTGTGGGGTGGAGGG - Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1006021567 6:31120818-31120840 GACTGCGAGTGGAGGGCAGATGG - Intronic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1007416393 6:41693886-41693908 GTGTGCGTGTGGTGGGCAGTGGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010285924 6:74077693-74077715 TACTGAGTGTGAAGGGCAGATGG + Intergenic
1011271030 6:85580086-85580108 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
1012814006 6:103999094-103999116 ATCAGAGGGTGGAGGGCAGAAGG - Intergenic
1014101610 6:117517548-117517570 CTCTGCTTGGGTAGTGCAGAAGG - Intronic
1016611942 6:145999708-145999730 CTCTGCGAGGGCAGTGCAGAAGG - Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1019265672 7:116286-116308 TCCTGAGTGTGGAGGGGAGATGG - Intergenic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1022229982 7:28405329-28405351 CTCTGAGTGATGTGGGCAGAAGG + Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023790420 7:43749583-43749605 CTCAGCCAGAGGAGGGCAGAGGG - Intergenic
1024369108 7:48559578-48559600 TTCTGCTTGAGAAGGGCAGAGGG - Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1026533039 7:71216463-71216485 CTTTGCTTTTGGAGGGGAGAGGG + Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027520379 7:79199251-79199273 GGCTGCATTTGGAGGGCAGAAGG + Intronic
1027956357 7:84883562-84883584 ATCTGAGGGTGGAGGGTAGAAGG - Intergenic
1028032439 7:85933036-85933058 CTCTGCTAGTGCAGAGCAGAAGG + Intergenic
1028521948 7:91741996-91742018 CTCTGCCTGTGGAAAGGAGAGGG - Intronic
1029459762 7:100687922-100687944 CTCTGCCTGTGGAGGGGATCTGG - Intronic
1029507672 7:100972097-100972119 CTCTGCAAGAGGAGGGCAGGGGG - Intronic
1029892387 7:103944266-103944288 CTAGGCGTGTGGAGGACAGTAGG + Intronic
1031306211 7:120130725-120130747 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1034657886 7:152743806-152743828 CTCTCCTGGTGGAAGGCAGAAGG + Intergenic
1034847858 7:154463855-154463877 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035137008 7:156713474-156713496 CTCTGCATGTGGGGGACAGGAGG + Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036620171 8:10419739-10419761 CTCTTTGGGTGGAGGGCAGGCGG + Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1040521221 8:48177480-48177502 CTCCGCGTGTGAGGAGCAGACGG - Intergenic
1040797290 8:51300040-51300062 CTCTGCTAGGGCAGGGCAGAGGG - Intergenic
1041852294 8:62405157-62405179 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043077022 8:75715440-75715462 CTCTGCCAGCGGAGGGCAGAGGG - Intergenic
1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG + Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1045111326 8:98941083-98941105 CTCTGCGTGGCGCGGGCTGAGGG - Intronic
1046257657 8:111722070-111722092 CTCTGCTTGGGCAGTGCAGAAGG - Intergenic
1047412053 8:124631808-124631830 CTCTGCCTTTGGAGGGCCGTGGG - Intronic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1048295851 8:133212843-133212865 GCCTGCGGGGGGAGGGCAGAGGG - Exonic
1048306885 8:133290643-133290665 TTCAGCGTGTGGAGGTCAGCTGG + Intronic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1048795566 8:138146226-138146248 CTCTGAGTGTGGGGGGCCAAGGG - Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049269460 8:141686533-141686555 CTCCACGTCTGGAGGGGAGACGG + Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1052512310 9:29437620-29437642 CTCTGTGTGTGTATTGCAGAGGG - Intergenic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1055341881 9:75292921-75292943 CTCTGCTTGGGCAGTGCAGAGGG - Intergenic
1056516715 9:87359180-87359202 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057081816 9:92179125-92179147 TCCTGGGTGTGGAAGGCAGAGGG + Intergenic
1057983089 9:99681813-99681835 CTCTGCTAGGGGAGTGCAGAGGG - Intergenic
1058704936 9:107630256-107630278 CTCTGCCTGTGGAGGGAGGCTGG + Intergenic
1059449585 9:114362113-114362135 CACAGCCTGTGGATGGCAGAGGG - Intronic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG + Intergenic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062176208 9:135164447-135164469 CTCTGCCTGTGGAGGGAGGGGGG - Intergenic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062444184 9:136586830-136586852 CTCTGTGTGTGCAGGGCAAGAGG + Intergenic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1186033034 X:5390882-5390904 CTCCCCTGGTGGAGGGCAGAGGG + Intergenic
1186150889 X:6673359-6673381 CTATGCATGTGTAGGGGAGAAGG - Intergenic
1186509122 X:10117356-10117378 CTCTGCTTGTGGAAGCCCGAGGG - Exonic
1186911620 X:14173928-14173950 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
1187214683 X:17264898-17264920 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1189297701 X:39930363-39930385 CTCTGTGTGTGCTGGACAGATGG + Intergenic
1190374284 X:49774368-49774390 CTCTGCCTGTGGAAGGAGGAGGG - Intergenic
1190487432 X:50941841-50941863 CTCTGCTGGTGGAGGACAGAGGG + Intergenic
1192047297 X:67689327-67689349 TTCAGAGAGTGGAGGGCAGAAGG + Intronic
1192381509 X:70621142-70621164 CTATGCATGTGGTGGGGAGAGGG + Intronic
1193471284 X:81907269-81907291 CTCTGCTAGTGCAGGGCAGGAGG - Intergenic
1193871570 X:86805083-86805105 CTCTACGAGTGCAGAGCAGAAGG - Intronic
1193981601 X:88187617-88187639 CTCTGCGTGAGGAGAGGAAATGG + Intergenic
1194467074 X:94246311-94246333 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1194710662 X:97232641-97232663 ATCAGGGTGTGGACGGCAGAAGG - Intronic
1194941521 X:100016422-100016444 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1196368274 X:114947067-114947089 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
1196782989 X:119399572-119399594 CACCGGGTGTGGCGGGCAGAGGG + Exonic
1197379443 X:125721780-125721802 CTCTGCTTGGGCAGTGCAGAAGG + Intergenic
1197581918 X:128294393-128294415 CTCTGCTTGGGCAGTGCAGAAGG + Intergenic
1197739124 X:129875779-129875801 CTCTGCCTCTGCAGGCCAGAAGG - Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198846353 X:140916639-140916661 CTATTCGTGTAGATGGCAGAGGG + Intergenic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199374189 X:147088090-147088112 CTCTGCGTTTGGAAAGGAGATGG - Intergenic
1199685262 X:150259796-150259818 CTCTGCATGAGGATAGCAGAAGG - Intergenic
1200032865 X:153310565-153310587 TTCTCCTTGCGGAGGGCAGAAGG - Intergenic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic