ID: 1104718268

View in Genome Browser
Species Human (GRCh38)
Location 12:131030611-131030633
Sequence CTTCAGCTGCACATCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104718264_1104718268 -8 Left 1104718264 12:131030596-131030618 CCGGACGAGGGGTCTCTTCAGCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1104718256_1104718268 10 Left 1104718256 12:131030578-131030600 CCTCCCCTGAGGCCAAGGCCGGA 0: 1
1: 0
2: 2
3: 18
4: 218
Right 1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1104718258_1104718268 6 Left 1104718258 12:131030582-131030604 CCCTGAGGCCAAGGCCGGACGAG 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1104718259_1104718268 5 Left 1104718259 12:131030583-131030605 CCTGAGGCCAAGGCCGGACGAGG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1104718257_1104718268 7 Left 1104718257 12:131030581-131030603 CCCCTGAGGCCAAGGCCGGACGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1104718263_1104718268 -2 Left 1104718263 12:131030590-131030612 CCAAGGCCGGACGAGGGGTCTCT 0: 1
1: 0
2: 0
3: 2
4: 89
Right 1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1104718254_1104718268 11 Left 1104718254 12:131030577-131030599 CCCTCCCCTGAGGCCAAGGCCGG 0: 1
1: 0
2: 2
3: 18
4: 272
Right 1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104718268 Original CRISPR CTTCAGCTGCACATCGGGGC AGG Intronic
901090613 1:6638316-6638338 CTTCTGCAGCACATCGGTGGCGG + Exonic
902442395 1:16439691-16439713 CTTCACCCCCACATAGGGGCTGG + Intergenic
906690735 1:47791263-47791285 CTTCAGCTGGACACTGAGGCTGG + Intronic
907309029 1:53528896-53528918 CTCCTGCAGCACATGGGGGCTGG + Intronic
914437158 1:147670300-147670322 CTCCTGCTGCACACCGGGCCGGG + Exonic
915624352 1:157105754-157105776 CTTCAGCTGCCCATCGTGACAGG - Intergenic
919809612 1:201400205-201400227 CTTTAGGTGCCCATCTGGGCTGG + Intergenic
919975299 1:202606680-202606702 CTACAGCTGCATGTGGGGGCAGG - Intronic
924335148 1:242980182-242980204 CTTCTGCTGCACTGAGGGGCAGG + Intergenic
924679708 1:246219736-246219758 CTGCAGCTGCATCTGGGGGCTGG - Intronic
1065861569 10:29876738-29876760 CTGCTGCTGCACATGGTGGCAGG + Intergenic
1072615755 10:97048063-97048085 CTTCAGCTGAGCAGTGGGGCTGG - Intronic
1074065097 10:110007287-110007309 CTTCACCTCCACATAGGGGGAGG - Intronic
1077680310 11:4233863-4233885 CTTCTACTGAACATCTGGGCTGG + Intergenic
1077681175 11:4242043-4242065 CTTCTACTGAACATCTGGGCTGG - Intergenic
1077684588 11:4279283-4279305 CTTCTACTGAACATCTGGGCTGG + Intergenic
1077685454 11:4287486-4287508 CTTCTACTGAACATCTGGGCTGG - Intergenic
1077689720 11:4330440-4330462 CTTCTACTGAACATCTGGGCTGG + Intergenic
1085426652 11:76410749-76410771 GCTCAGCTGCACATCTCGGCAGG + Intronic
1086512241 11:87571416-87571438 CTACAGCTCAACATGGGGGCTGG - Intergenic
1091751356 12:3023062-3023084 CCACAGCTGAACATGGGGGCAGG + Intronic
1096109568 12:49020835-49020857 CTCCATCTGGACATGGGGGCAGG - Exonic
1097900680 12:64870787-64870809 CATCAGGTGTACATCAGGGCAGG + Exonic
1099989615 12:89708752-89708774 GTGCAGCTGCACCTCGGGGATGG + Exonic
1102782110 12:115574283-115574305 CTTCATCTGCATAACAGGGCTGG - Intergenic
1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG + Intronic
1104904414 12:132205659-132205681 CATCAGGTTCACATCGTGGCAGG + Exonic
1109856451 13:68134449-68134471 ACTCAGCTGCCCATCGGGGTTGG + Intergenic
1112410920 13:99163054-99163076 CATCAGCTCCAAAACGGGGCAGG - Intergenic
1113669826 13:112168655-112168677 ATACAGTTGCACATCTGGGCAGG - Intergenic
1117341672 14:54797454-54797476 CTTAAGATGCACATCTGGCCAGG - Intergenic
1121170054 14:91846072-91846094 CTGCTGCTGCACCTCTGGGCAGG + Intronic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1122930926 14:104932790-104932812 CTTCAGCAGCACGGCGGGGGTGG + Exonic
1123696567 15:22883046-22883068 CTTCATCTGCACATGTGTGCGGG - Intronic
1123804966 15:23861137-23861159 CTTGAGCTGGACACTGGGGCGGG + Intergenic
1125721528 15:41847398-41847420 CTGGAGCTGCTCTTCGGGGCTGG - Exonic
1128670898 15:69574058-69574080 CTTTAGCTGCTAATCGGGGGTGG - Intergenic
1129236206 15:74225230-74225252 CATCAGCTGCTCACTGGGGCTGG - Intergenic
1137636785 16:49993454-49993476 ATTCAGCTGGGCATGGGGGCAGG + Intergenic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1148215097 17:45829998-45830020 CCTCATCTACACATCTGGGCTGG + Intronic
1149549323 17:57528198-57528220 CTTCAGCTACGCACCGGGGGAGG - Intronic
1149880659 17:60286999-60287021 ATTTAGCTGCACATGGTGGCAGG + Intronic
1152800666 17:82329341-82329363 CCTCAGCAGCACCTCGGGGTTGG - Intronic
1160839623 19:1140353-1140375 GTTCACCTGCACACCGCGGCAGG + Intronic
1161091055 19:2360230-2360252 CTTCTGCTCCACTTCGGGGTGGG + Intergenic
1161394818 19:4039287-4039309 CTTCAGCTGCCCGTGCGGGCGGG - Exonic
940339276 2:152562692-152562714 CATCAGCTTCACATGTGGGCAGG + Intronic
942452585 2:176117546-176117568 CTTCTCCTGCACTTCGGGACTGG - Exonic
946388820 2:219403062-219403084 CTTCCGATGCACTTCGGGGGAGG - Intergenic
948837114 2:240631207-240631229 CTGCCGCTGCCCCTCGGGGCTGG + Exonic
1173818788 20:46007721-46007743 CTTCAACTGCAAATTGGGGCAGG - Intergenic
1175195022 20:57237164-57237186 CTTCAGCTCCAGTTAGGGGCCGG + Intronic
1175295765 20:57907799-57907821 CCTCAGCTGCCCAGTGGGGCTGG + Intergenic
1175378124 20:58543161-58543183 CTTCAGGTGCCCCCCGGGGCTGG - Intergenic
1175539023 20:59736680-59736702 CTGCAGGTGTACAGCGGGGCAGG - Intronic
1175881804 20:62263626-62263648 CTTCTGCTGAACATGGGAGCCGG - Exonic
1176020935 20:62962042-62962064 CCTCAGCAGCAGATGGGGGCTGG + Intronic
1176214100 20:63940110-63940132 CTTCAGCCGCACATGAGGGCAGG - Intronic
1181873566 22:25922474-25922496 CTTCAGCTCCCCATGGGGACCGG - Intronic
1184287414 22:43479369-43479391 CTGCAGCTGGACATGTGGGCAGG + Intronic
951164392 3:19467559-19467581 CTTCAGTAGCCCATGGGGGCAGG + Intronic
968097928 3:195945320-195945342 CTGCAGCTGCAGATCCGGGGAGG - Intergenic
968438847 4:611297-611319 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438857 4:611365-611387 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438869 4:611433-611455 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438881 4:611501-611523 CTTCACCTGCACACAGAGGCTGG + Intergenic
968600426 4:1506114-1506136 CATCAGCTGCGCACAGGGGCAGG + Intergenic
968867926 4:3225615-3225637 CTTGATCTGCACAGGGGGGCAGG - Intronic
969703308 4:8779437-8779459 CTTCTCCTGCACCTCGGGCCAGG + Intergenic
977364370 4:96048587-96048609 CTTCAGCAGCACATTCTGGCTGG - Intergenic
983218330 4:165021243-165021265 CTTCTGCTCCACATCCAGGCTGG + Intergenic
985133024 4:186758155-186758177 CTCCAGGTGCAGAGCGGGGCGGG - Intergenic
990515960 5:56531031-56531053 TTTCACCTGCACATCTGAGCTGG + Intronic
1002068624 5:176665206-176665228 ATTCAGCTGCTCATGGGGGTGGG + Intergenic
1009840108 6:69060320-69060342 CATCAGCTGCTCATCTGGCCTGG - Intronic
1015503261 6:133954120-133954142 CTGCAGATGCACATCTCGGCAGG - Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1019443159 7:1057507-1057529 CTGCAGCTCCACATGGCGGCCGG - Exonic
1029477593 7:100794197-100794219 CTTCAGCTGCAGAGCGGGGGAGG + Exonic
1030320952 7:108166841-108166863 CTCCAGCTGGAGATGGGGGCTGG - Intronic
1032706350 7:134423804-134423826 GTTCACCTGCTCAGCGGGGCCGG - Intergenic
1032778673 7:135143906-135143928 CTTCTGCTGAACATGGGGGAAGG - Intronic
1035233779 7:157483762-157483784 CCTCACCTGCACACCGGGCCGGG - Intergenic
1036111153 8:5904586-5904608 CTTCCGCAGCACATGTGGGCTGG - Intergenic
1037662342 8:20938850-20938872 CCTCAGCTGCAGACCAGGGCGGG - Intergenic
1037720757 8:21441860-21441882 CTTCAGCTGCCCAACGGGACAGG + Intergenic
1037879269 8:22565257-22565279 CTCCAGCAGCACCTGGGGGCGGG - Exonic
1041381469 8:57258184-57258206 CTGCAGCTGCACATGGCGCCTGG + Intergenic
1046826641 8:118699198-118699220 CTTCTGCTCCACATATGGGCAGG + Intergenic
1047218867 8:122902432-122902454 CCTCAGCTGTACATTGGGGATGG + Intronic
1057484799 9:95474392-95474414 CTTCAGCTGCACTGCGAGTCTGG + Intronic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1059391200 9:114000730-114000752 CTTCACCTGCACGGAGGGGCTGG + Intronic
1060895694 9:127215741-127215763 CCTCAGCAGCAGATGGGGGCGGG + Intronic
1060915154 9:127384549-127384571 CTCCAGCTGCACGTCTGAGCCGG - Intronic
1061081897 9:128375940-128375962 CCTGGGCTTCACATCGGGGCCGG + Intronic
1061728705 9:132596808-132596830 CTTCAGCAGGACAGTGGGGCAGG + Intronic
1062017147 9:134296685-134296707 CTCCAGCTGCACCTCGGGGGAGG - Intergenic
1185715061 X:2335034-2335056 CTTTAGCTGGACATGGTGGCGGG + Intronic
1190276927 X:48904870-48904892 CTTTGGCTGCACCTCGGGGAAGG + Exonic
1192152875 X:68722931-68722953 ATTCAGCTGGACTGCGGGGCAGG - Intronic
1193700324 X:84752126-84752148 CTTTAGCAGCACATCTGGGCTGG + Intergenic
1200143592 X:153913997-153914019 CTTCAGCTGAGCGTCTGGGCTGG - Intronic
1200311092 X:155078114-155078136 CTTCAGCTGCAGACTGAGGCAGG - Intronic
1200747871 Y:6918186-6918208 TTTCGGCTGGACATGGGGGCCGG + Intronic
1201866190 Y:18658077-18658099 CTTCAGCAGCACTTCCGGGATGG - Intergenic
1202389669 Y:24356904-24356926 CTTCTGCTGCACTGAGGGGCAGG - Intergenic
1202481115 Y:25313210-25313232 CTTCTGCTGCACTGAGGGGCAGG + Intergenic