ID: 1104719964

View in Genome Browser
Species Human (GRCh38)
Location 12:131039740-131039762
Sequence CCCTTTCCCAGCGTGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104719964_1104719968 -7 Left 1104719964 12:131039740-131039762 CCCAGGCTCACGCTGGGAAAGGG 0: 2
1: 0
2: 0
3: 12
4: 183
Right 1104719968 12:131039756-131039778 GAAAGGGCCCAGACTCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 198
1104719964_1104719972 4 Left 1104719964 12:131039740-131039762 CCCAGGCTCACGCTGGGAAAGGG 0: 2
1: 0
2: 0
3: 12
4: 183
Right 1104719972 12:131039767-131039789 GACTCAGCTGGGCCCAAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1104719964_1104719971 3 Left 1104719964 12:131039740-131039762 CCCAGGCTCACGCTGGGAAAGGG 0: 2
1: 0
2: 0
3: 12
4: 183
Right 1104719971 12:131039766-131039788 AGACTCAGCTGGGCCCAAACAGG 0: 1
1: 0
2: 1
3: 13
4: 122
1104719964_1104719967 -8 Left 1104719964 12:131039740-131039762 CCCAGGCTCACGCTGGGAAAGGG 0: 2
1: 0
2: 0
3: 12
4: 183
Right 1104719967 12:131039755-131039777 GGAAAGGGCCCAGACTCAGCTGG 0: 1
1: 0
2: 3
3: 22
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104719964 Original CRISPR CCCTTTCCCAGCGTGAGCCT GGG (reversed) Intronic