ID: 1104719964

View in Genome Browser
Species Human (GRCh38)
Location 12:131039740-131039762
Sequence CCCTTTCCCAGCGTGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104719964_1104719971 3 Left 1104719964 12:131039740-131039762 CCCAGGCTCACGCTGGGAAAGGG 0: 2
1: 0
2: 0
3: 12
4: 183
Right 1104719971 12:131039766-131039788 AGACTCAGCTGGGCCCAAACAGG 0: 1
1: 0
2: 1
3: 13
4: 122
1104719964_1104719972 4 Left 1104719964 12:131039740-131039762 CCCAGGCTCACGCTGGGAAAGGG 0: 2
1: 0
2: 0
3: 12
4: 183
Right 1104719972 12:131039767-131039789 GACTCAGCTGGGCCCAAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1104719964_1104719968 -7 Left 1104719964 12:131039740-131039762 CCCAGGCTCACGCTGGGAAAGGG 0: 2
1: 0
2: 0
3: 12
4: 183
Right 1104719968 12:131039756-131039778 GAAAGGGCCCAGACTCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 198
1104719964_1104719967 -8 Left 1104719964 12:131039740-131039762 CCCAGGCTCACGCTGGGAAAGGG 0: 2
1: 0
2: 0
3: 12
4: 183
Right 1104719967 12:131039755-131039777 GGAAAGGGCCCAGACTCAGCTGG 0: 1
1: 0
2: 3
3: 22
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104719964 Original CRISPR CCCTTTCCCAGCGTGAGCCT GGG (reversed) Intronic
900036997 1:421776-421798 CACTTTCCCTGCGTTACCCTGGG - Intergenic
900058626 1:657517-657539 CACTTTCCCTGCGTTACCCTGGG - Intergenic
900250177 1:1664817-1664839 CCGGTTCCCCACGTGAGCCTTGG - Exonic
900261209 1:1730723-1730745 CCGGTTCCCCACGTGAGCCTTGG - Intronic
900372615 1:2338899-2338921 CCCTTTACCTGGCTGAGCCTCGG - Intronic
900540435 1:3199987-3200009 CCCTTCCCCAGCAAGACCCTGGG - Intronic
900606030 1:3523927-3523949 CCTTTTACCGGCCTGAGCCTGGG + Intronic
900640202 1:3684843-3684865 CCCTTTCCCAGCATCTGCCTCGG - Intronic
900763907 1:4491182-4491204 CCCTTGACCAGAGTGACCCTTGG - Intergenic
900814734 1:4834809-4834831 CCATTTCCAAGAGGGAGCCTTGG + Intergenic
901725850 1:11241506-11241528 CCCTGTATCAGCGTGAGGCTTGG - Intronic
903017434 1:20370137-20370159 CCCTTGGCCAGCATGGGCCTGGG - Intergenic
903028268 1:20444712-20444734 GCCCTTCCCATCTTGAGCCTCGG + Intergenic
903140084 1:21334196-21334218 CTCTTTCCCTTTGTGAGCCTTGG + Intronic
903813751 1:26049655-26049677 GCCTTTCCTGGCGTGAGTCTGGG + Intergenic
903960498 1:27054147-27054169 CCCTCTCCTAGCAGGAGCCTGGG + Intergenic
910825522 1:91404132-91404154 TCCTTTCCCAGGCCGAGCCTCGG - Intronic
912869306 1:113289402-113289424 CCCTCTCCCAGCCTAGGCCTTGG - Intergenic
913136209 1:115891824-115891846 ACTTTTCCCAGCCTGTGCCTTGG - Intergenic
913200895 1:116494631-116494653 CCCTCTCCCAGGGACAGCCTTGG + Intergenic
913224947 1:116690731-116690753 CCCTCCACCAGCGTGACCCTTGG - Intergenic
913535271 1:119766252-119766274 CACTTTACCAGTGTGTGCCTTGG - Intronic
913970944 1:143417241-143417263 CTCTTCCCCAGCTTGAGTCTGGG - Intergenic
914065322 1:144242852-144242874 CTCTTCCCCAGCTTGAGTCTGGG - Intergenic
914113829 1:144723502-144723524 CTCTTCCCCAGCTTGAGTCTGGG + Intergenic
915519886 1:156436068-156436090 CCCCTTCCCTGCGGGCGCCTCGG - Intergenic
920021690 1:202961329-202961351 CCCTTTCCCAGGGTAGGACTAGG - Intergenic
920070916 1:203302615-203302637 CCATTACCCAGGGTGTGCCTTGG - Intergenic
923394107 1:233543706-233543728 CACTTTCCCTGGGTGAGGCTGGG + Intergenic
1067658174 10:48212980-48213002 GCCTTTCCCAGCCTAACCCTGGG + Intronic
1073486232 10:103820654-103820676 GCCTTTCCCTGCATGGGCCTGGG - Intronic
1075646838 10:124102406-124102428 CCCTTTCCCAGAGCAAGCTTGGG - Intergenic
1076685566 10:132197064-132197086 CCCGTTCTCAGCGTGCACCTGGG - Exonic
1078510465 11:11980784-11980806 GCCTTTCCCAGTATGAGTCTTGG - Intronic
1078894599 11:15586847-15586869 CTCTTCCCCAGTGTGGGCCTTGG + Intergenic
1080652592 11:34234484-34234506 CCCTTGCCCAGCCTCACCCTGGG - Intronic
1082876462 11:57993594-57993616 CCCTTTCCAAGTTTTAGCCTGGG + Intergenic
1083893017 11:65606189-65606211 ACCATTCCCAGGGTGAGCTTTGG + Intronic
1085251384 11:75146146-75146168 CCCTTGCCTGGCGTGACCCTAGG - Intronic
1089250520 11:117156922-117156944 GCCCTCCCCAGCCTGAGCCTGGG + Intronic
1091582665 12:1798585-1798607 CCCTTCCACTGCGTGACCCTGGG - Intronic
1093460680 12:19404238-19404260 CTCTGTCCCTGCGTGAGTCTGGG + Intronic
1096477645 12:51918072-51918094 CTGTTTCCCAGCCTGAGGCTGGG - Intronic
1096532175 12:52249068-52249090 CGCTTACCTAGGGTGAGCCTTGG + Intronic
1096834610 12:54341641-54341663 CCCTTTGCCAGGGAGAGCCTGGG + Intronic
1104719964 12:131039740-131039762 CCCTTTCCCAGCGTGAGCCTGGG - Intronic
1104982868 12:132581951-132581973 CCCCTTCTCAGTGTCAGCCTGGG + Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1111583609 13:90255924-90255946 CTCTTTCCCATAGAGAGCCTGGG - Intergenic
1111907417 13:94271522-94271544 CCCTTTACAACCTTGAGCCTTGG + Intronic
1114612404 14:24051652-24051674 CCCTCTCCCAGCATGGCCCTAGG + Intergenic
1117770341 14:59127931-59127953 CCCTTTCCCAGCGGAAACCAGGG + Intergenic
1118452216 14:65913354-65913376 CCCTTTCCCAGCACCAGCCATGG + Intergenic
1119191919 14:72688806-72688828 CCCTCTCCCTGCATGAGGCTGGG - Intronic
1120936891 14:89905538-89905560 CCCTTCCTCAGCATGAGACTGGG - Intronic
1122813833 14:104302468-104302490 CCCCAGCCCAGCGTCAGCCTTGG + Intergenic
1122830316 14:104392694-104392716 CCCTTCCCCATCGTGTGCCCCGG - Intergenic
1122923456 14:104889426-104889448 CCCTCTCCCAGAGGGACCCTGGG + Intronic
1124060493 15:26289506-26289528 CACTTTCACAGCGTGGGGCTCGG + Intergenic
1126436910 15:48645887-48645909 CCCTTTGCCAGCCTCCGCCTCGG + Intergenic
1129166652 15:73782289-73782311 CCCTGTCCCAGCTAGAGCTTCGG - Intergenic
1129597531 15:76976131-76976153 CCCTTCTCCTGCGTGAACCTTGG - Intergenic
1131261619 15:90890797-90890819 GCTCTGCCCAGCGTGAGCCTGGG + Intronic
1131792005 15:95975242-95975264 CCATTTCCCAGCCTGGGCCTTGG + Intergenic
1132359505 15:101200992-101201014 CCCCTTCCCTGCCTGAGCCAGGG + Intronic
1132958840 16:2611140-2611162 CCCTTTGTCTCCGTGAGCCTAGG + Intergenic
1141612491 16:85190595-85190617 CCCTTTCCCTTCCTGGGCCTTGG - Intergenic
1144628940 17:16860419-16860441 CCGTTTCCCAGCCTGAGCTAAGG - Intergenic
1145160514 17:20570986-20571008 CCGTTTCCCAGCCTGAGCTAAGG - Intergenic
1147310335 17:39592275-39592297 CCCTTTCCCAGCCAGGGACTCGG + Intergenic
1148551819 17:48555033-48555055 CCCTTCTCCAGCGAGACCCTGGG - Intronic
1148860567 17:50602334-50602356 CCCTGCCCCAGCCTGTGCCTGGG + Intronic
1149981391 17:61314119-61314141 CACTTCCCCAGTGTGTGCCTCGG - Intronic
1152104850 17:78322998-78323020 CCCACTCCCAGCGTCAGCCTGGG + Intergenic
1153560987 18:6371453-6371475 CTCTTTCCCAACATGAGGCTGGG - Intronic
1156266972 18:35497906-35497928 CTTTTTCCCAGCGCGGGCCTTGG + Exonic
1157743477 18:50114423-50114445 CCCTTTCCCAAGAGGAGCCTTGG - Intronic
1159480684 18:68987476-68987498 ACCTTTCTCAGCGTCAACCTTGG + Intronic
1160640526 19:129329-129351 CACTTTCCCTGCGTTACCCTGGG - Intergenic
1160896891 19:1407387-1407409 CCATTTCCCAGCGTGCCCCGCGG + Intergenic
1161283676 19:3458403-3458425 CCCTTCCCCAGCCTCTGCCTTGG + Intronic
1162057129 19:8071490-8071512 CCCCTTCCCTGTCTGAGCCTTGG - Intronic
1164077405 19:21833218-21833240 CTCTTTCCCAGAGTGAGTTTAGG - Intronic
1165123364 19:33577743-33577765 CCCTGTCCCAGAGAGACCCTAGG + Intergenic
1166684678 19:44789216-44789238 GCCTTTCCCACCCTGAGCCTTGG + Intronic
1166747367 19:45147693-45147715 CCCTTTGCCAGCAGGGGCCTGGG + Intronic
1167042047 19:47028150-47028172 CCCTCTCCCAGGATCAGCCTGGG - Intronic
1167650550 19:50726257-50726279 CCCTTCCCCTCTGTGAGCCTCGG + Intergenic
1168713286 19:58513667-58513689 ACCTTGCCCAGCCTGACCCTGGG + Exonic
926224139 2:10955378-10955400 CCATTGCCCAGCAGGAGCCTTGG + Intergenic
934175643 2:89578164-89578186 CTCTTCCCCAGCTTGAGTCTGGG - Intergenic
934285959 2:91652529-91652551 CTCTTCCCCAGCTTGAGTCTGGG - Intergenic
935432794 2:102994456-102994478 CCCTTTCTCTGGGTGGGCCTGGG - Intergenic
936611978 2:114010478-114010500 CCCATGCCCAGCAAGAGCCTTGG - Intergenic
945995893 2:216435761-216435783 CTCTTTCCCAGCGTGACTCATGG + Intronic
946364898 2:219243031-219243053 CCCTTTCCCACCCTTGGCCTAGG + Intronic
947267866 2:228302745-228302767 GCCCTTCCCAGCTTGAGCTTAGG + Intergenic
947800818 2:232927823-232927845 CTCTTTCCCAGCTTGCGCCCGGG - Intronic
948119501 2:235518558-235518580 CTGTTTCCCACCGTCAGCCTTGG + Intronic
948711676 2:239829155-239829177 CCCTTTCCCAGAGGGGGCCCTGG + Intergenic
948711698 2:239829219-239829241 CCCTTTCCCAGAGGGGGCCCTGG + Intergenic
948892455 2:240914102-240914124 CCCCTTCCCAGCCTGAGCAAAGG - Intergenic
949027972 2:241775136-241775158 CCCTTTCCCAGCCTGGGGCTGGG + Intergenic
1169379705 20:5096010-5096032 CCCTTTACCAGCATGTGGCTGGG - Intronic
1171487633 20:25495753-25495775 CCCTCTCCCTGCCTGAGCCTGGG + Intronic
1173111208 20:40192309-40192331 CACATTCCCAGTGTCAGCCTGGG - Intergenic
1174106578 20:48166447-48166469 TCCTATCCCAGCCAGAGCCTGGG + Intergenic
1174187471 20:48716771-48716793 GCCTTTCCCAGCGTTTGCGTAGG - Intronic
1174391436 20:50220619-50220641 CCCTTTTCCAGACTGGGCCTTGG + Intergenic
1175185493 20:57177277-57177299 TCCTGTCTCAGCCTGAGCCTTGG - Intronic
1175228256 20:57457778-57457800 CCCTTCGCCATGGTGAGCCTTGG - Intergenic
1176933503 21:14841707-14841729 TCCTCTGCCAGCGTGATCCTCGG + Intergenic
1178241972 21:30913087-30913109 CCCTTTCCCTTCCTGATCCTAGG - Intergenic
1179611664 21:42555975-42555997 CCCTTTCCCAGAGTGACCGCTGG + Intronic
1180742156 22:18061277-18061299 CACGTTCCCAGCCTTAGCCTGGG - Intergenic
1180844903 22:18975666-18975688 CCCTCACCCAGCCTCAGCCTTGG - Intergenic
1181056560 22:20263043-20263065 CCCTCACCCAGCCTCAGCCTTGG + Intronic
1183149577 22:36027802-36027824 CCCCATCCCAGCGTGTGCCCAGG + Intronic
1183429442 22:37756894-37756916 CCCCTTGCCACTGTGAGCCTCGG + Intronic
1183479073 22:38052954-38052976 CCCTTTGCCTGCCTCAGCCTGGG + Intergenic
1183686602 22:39364538-39364560 CTCTTTCCCACCCTGAGCCTTGG - Intronic
1185003621 22:48262418-48262440 CCTTTTCCCAGCATGGGGCTGGG + Intergenic
1185043795 22:48518779-48518801 GCCTGTCCCAGCGTGACCCTGGG - Intronic
949214165 3:1545317-1545339 CATTTTCCCAGCGTGAGTGTGGG + Intergenic
949217137 3:1583538-1583560 CCCTTTCCCAGGGAGATCCGTGG + Intergenic
949463010 3:4314117-4314139 TCCTTTCCCAGGGTCATCCTGGG - Intronic
950633264 3:14298088-14298110 CCCTTTCCCAGTTTAGGCCTAGG + Intergenic
953726973 3:45408228-45408250 CCCTGCTCCAGGGTGAGCCTTGG - Intronic
954464582 3:50647000-50647022 TCCTTCCCCACCCTGAGCCTTGG + Intronic
954654432 3:52185440-52185462 GCCTATCCCAGGGTGAGCTTAGG + Intergenic
954669108 3:52278665-52278687 CCCTTTCCCGGCGTGCGCCGCGG - Intronic
956864282 3:73353834-73353856 CACTTACCCAGCCTGGGCCTGGG + Intergenic
960156003 3:114297726-114297748 CTATTTCCCAGCCTGAACCTGGG + Intronic
962746330 3:138399849-138399871 CCCTTTGCCAGCCCGAGGCTTGG + Intronic
965904286 3:173683886-173683908 CCATTTCCCAGCATGTGACTTGG - Intronic
967504497 3:190238761-190238783 CCATTCCTCAGCTTGAGCCTAGG + Intergenic
968173556 3:196529282-196529304 CCCCTTCCCAGTGTGAGAGTTGG + Intergenic
969057361 4:4410121-4410143 CCCTTTCCCTGCGTGGCCTTGGG - Intronic
971168683 4:24210853-24210875 ACCTCTCCCAGTGGGAGCCTAGG + Intergenic
972157990 4:36188697-36188719 CCCTTCCACAGCGTTATCCTTGG + Intronic
975923302 4:79419170-79419192 ACCTTTCTCAGCATCAGCCTTGG - Intergenic
979516370 4:121614721-121614743 CCTTCTCCCAGCATGATCCTGGG + Intergenic
981540468 4:145841437-145841459 TCCTTTCCCAGCACAAGCCTAGG - Intronic
981769592 4:148292932-148292954 CCCTTTCCCTGTGCTAGCCTTGG - Intronic
982261076 4:153494911-153494933 CCCTTTACCTGCGTGATCCGGGG + Intronic
982269902 4:153575807-153575829 CCCTCATCCAGAGTGAGCCTGGG - Intronic
983412889 4:167421310-167421332 GCCCTTCCCAGCTTGAGCTTAGG - Intergenic
985260091 4:188106771-188106793 CACTTTCCCAGCGCGGGCCGGGG - Intronic
985881347 5:2641159-2641181 CCTTTTCCCAGTGTGGGCCAAGG + Intergenic
985984386 5:3502612-3502634 CCCTCTCCCAGCCTCTGCCTAGG - Intergenic
989432710 5:41374326-41374348 CCCTTTCCCAGCCTAGGACTTGG - Intronic
999246563 5:150158120-150158142 CCCTTGCCCTGCCTGAGCCTCGG + Intergenic
999256228 5:150211299-150211321 CTCTTTCCCTCCGTGGGCCTCGG - Intronic
999312784 5:150562652-150562674 CCATTTCTGAGCCTGAGCCTGGG + Intergenic
1001967426 5:175921124-175921146 CCCCTTCCCTACCTGAGCCTGGG + Intronic
1002521241 5:179794238-179794260 CCCTCTTCCAGCTTGGGCCTGGG - Intronic
1002736824 5:181397090-181397112 CACTTTCCCTGCGTTACCCTGGG + Intergenic
1002747875 6:77732-77754 CACTTTCCCTGCGTTACCCTGGG - Intergenic
1002911031 6:1491118-1491140 CCCTTACTCAGCCTGAGCCCTGG - Intergenic
1003068659 6:2926289-2926311 CCCTTTACCGGTGTGGGCCTGGG + Intergenic
1005518365 6:26575865-26575887 CACTTTCCCACCTTCAGCCTTGG - Intergenic
1006402068 6:33823627-33823649 GAATTCCCCAGCGTGAGCCTAGG + Intergenic
1006519034 6:34560992-34561014 CCTTTTCGCAGCTGGAGCCTGGG - Intergenic
1007078227 6:39081377-39081399 CCCTTCCCCACAGTGAGCCAGGG - Intronic
1018254403 6:161904071-161904093 TCCCTTCCCACAGTGAGCCTGGG + Intronic
1019241923 6:170672619-170672641 CACTTTCCCTGCGTTACCCTGGG + Intergenic
1019825609 7:3281862-3281884 CCCTTTCCCTCCATGAGCCTCGG - Intergenic
1024031170 7:45461026-45461048 CCCTTTCCCAGCGTGAGCCTTGG + Intergenic
1024219664 7:47277788-47277810 CCCTTTCCCATGGGGACCCTAGG + Exonic
1024222189 7:47297599-47297621 TTCTTACTCAGCGTGAGCCTTGG - Intronic
1024281054 7:47720294-47720316 CCCATTCCCCCCGTGAGTCTGGG - Intronic
1029746276 7:102517366-102517388 CCCCTTCCCCTCGTGAGCCGCGG + Intronic
1029764214 7:102616345-102616367 CCCCTTCCCCTCGTGAGCCGCGG + Intronic
1035506195 8:135477-135499 CACTTTCCCTGCGTTACCCTGGG - Intergenic
1037885011 8:22591368-22591390 CCCTTGCCCAGCCTCAGCCATGG + Intronic
1049463839 8:142742147-142742169 CCCTGTCCCAGGGTGAAGCTGGG + Intronic
1049766847 8:144358908-144358930 CCCTTTCCCGGCGTCCGGCTTGG + Exonic
1050056680 9:1662617-1662639 CTCTTTCTTGGCGTGAGCCTAGG + Intergenic
1050830051 9:9999171-9999193 GCCTTTCCCAGCCCGAGCGTAGG - Intronic
1056752786 9:89364111-89364133 CCCATGGCCAGCGGGAGCCTTGG + Intronic
1060147525 9:121265656-121265678 CTCCTTCCCAGAGTGAGGCTGGG - Intronic
1061209789 9:129184426-129184448 CCCTTTCCCAGACTGAGACCTGG + Intergenic
1203602114 Un_KI270748v1:21853-21875 CACTTTCCCTGCGTTACCCTGGG + Intergenic
1185873624 X:3684526-3684548 CCCTTTCCCAGGATGAACCGAGG - Intronic
1186457753 X:9723280-9723302 CACTTTCCCAGGACGAGCCTGGG - Intergenic
1186541757 X:10408452-10408474 CCCTTTCCCTGAGTGAGAGTGGG - Intergenic
1187775342 X:22750237-22750259 CCATTTCCCAGTGTGCTCCTTGG - Intergenic
1190246842 X:48696573-48696595 CGCTTTCCCAGAGTGCGTCTGGG - Intronic
1191110303 X:56799079-56799101 TCCTCTCCCAGCTTCAGCCTGGG - Intergenic
1192044127 X:67654238-67654260 CCTTTTCCTAGAGTGAGTCTTGG + Intronic
1194075455 X:89386392-89386414 CCCATTTCCAGCTTGAGCCCAGG - Intergenic
1195051086 X:101097704-101097726 CGCTTTCCCCGTGTGAACCTAGG - Intergenic
1195701526 X:107709188-107709210 CCCCTTCCCACCATGAGCCCTGG + Intergenic
1200093179 X:153645152-153645174 CCCTTTCTCAGTGTGTTCCTGGG - Intronic
1200115329 X:153767464-153767486 CCCTTCTCCAGCGAGGGCCTGGG + Exonic
1200731056 Y:6740553-6740575 CCCATTTCCAGCTTGAGCCCAGG - Intergenic
1201190087 Y:11437762-11437784 CCCTGTCCCAGCCTTGGCCTTGG + Intergenic