ID: 1104721740

View in Genome Browser
Species Human (GRCh38)
Location 12:131048292-131048314
Sequence CTGTGAGTCTCGCACTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104721732_1104721740 18 Left 1104721732 12:131048251-131048273 CCAGCAGCGGACGGCACGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1104721740 12:131048292-131048314 CTGTGAGTCTCGCACTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104721740 Original CRISPR CTGTGAGTCTCGCACTCCCC AGG Intronic
900568564 1:3347313-3347335 CTGAGAGTCTCGCCCTCCCTGGG - Intronic
901003815 1:6161948-6161970 CAGTGAGTCCCGGGCTCCCCAGG + Intronic
905033424 1:34902544-34902566 CAGACAGCCTCGCACTCCCCTGG - Intronic
906244315 1:44262433-44262455 GTGTGCTTCTCTCACTCCCCTGG + Intronic
912613363 1:111071700-111071722 CTGTGAATCTGTCACTTCCCGGG + Intergenic
913129958 1:115830144-115830166 CTGTGAGTCCCTCAGGCCCCTGG - Intergenic
917091605 1:171359120-171359142 CTATGAGTCTTGCACCTCCCTGG + Intergenic
918480354 1:184971205-184971227 CTGTGAGCCTTGACCTCCCCTGG - Intronic
919932291 1:202229203-202229225 CTGTGAATCTCTAACTCCCAGGG + Intronic
924168618 1:241312655-241312677 CTGTGTCTCTCCCACTCCTCGGG + Intronic
1063152011 10:3345611-3345633 CTGTGAGCTTCACACTCCTCAGG - Intergenic
1070592694 10:77811905-77811927 CTGGGAGGCCCGCACTCACCTGG + Exonic
1071404896 10:85320295-85320317 CTGTGACTCCCACACTCACCAGG + Intergenic
1073512108 10:104049135-104049157 CTGTGAGCTCCCCACTCCCCTGG - Intronic
1076364677 10:129914334-129914356 CTGGGAGTCTCCCTCTCCCAAGG - Intronic
1077446330 11:2592714-2592736 CTGTGAGTGTCAGGCTCCCCAGG - Intronic
1077719553 11:4614012-4614034 CTGTGAGTCTGGCTGTCCACGGG + Intergenic
1078730125 11:13965846-13965868 CTGTGAAGCTGGCATTCCCCTGG + Intronic
1085252364 11:75152300-75152322 CTGTGAGGCTCACACAGCCCAGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1089103258 11:115981922-115981944 AGCTGAGTCTCCCACTCCCCTGG - Intergenic
1091282503 11:134390041-134390063 CAGTGGGTCTTCCACTCCCCGGG - Exonic
1091784951 12:3237708-3237730 CTGCAAGTCTCCCCCTCCCCAGG + Intronic
1093843937 12:23944266-23944288 CTTTGAGTCTCTGACTCCTCAGG + Intronic
1101641248 12:106586947-106586969 CAGACAGTCTCGCCCTCCCCGGG + Intronic
1104638896 12:130454816-130454838 CTGTGGGCCTCGGACTCACCGGG + Intronic
1104721740 12:131048292-131048314 CTGTGAGTCTCGCACTCCCCAGG + Intronic
1104776276 12:131391944-131391966 CCATGAGTCTCCCTCTCCCCAGG + Intergenic
1112336785 13:98523005-98523027 GGGTGAGCCTCACACTCCCCTGG + Intronic
1113369184 13:109707112-109707134 TTGTGAGTGCCCCACTCCCCAGG + Intergenic
1114713873 14:24804697-24804719 CTCTGAATCTCCCCCTCCCCGGG + Intergenic
1118891106 14:69909873-69909895 TTTTGGGTCTAGCACTCCCCAGG + Intronic
1121025067 14:90609526-90609548 CTCTGAGTCTTGCACTGCCAGGG - Intronic
1122054267 14:99081959-99081981 CTGTGCATCTCACTCTCCCCTGG - Intergenic
1124386176 15:29209785-29209807 CTGTGAGTCTCTCTGTGCCCTGG + Intronic
1125667874 15:41446652-41446674 CTTTTAGTCTCACACTACCCTGG + Intronic
1133106785 16:3516407-3516429 CTGTGAGGCTCTGACTCCCTAGG - Intronic
1136033948 16:27524427-27524449 CTGTAAGTCTCACAATACCCTGG + Intronic
1149113141 17:53059029-53059051 CTGTGAGGCTCACATTGCCCTGG + Intergenic
1149542113 17:57475258-57475280 CTGTGAGTGTCCCACTCAACTGG - Intronic
1154346982 18:13550761-13550783 CTTGGAGTCTCGCTCTTCCCAGG - Intronic
1155791910 18:29982915-29982937 CTGTGAGTCTGGCACTTCTAAGG + Intergenic
1157210703 18:45739661-45739683 TGGTGAGTCTCCCACGCCCCTGG + Exonic
1159045787 18:63367384-63367406 CCGGGTGTCTCCCACTCCCCCGG + Exonic
1161145693 19:2676822-2676844 CTTTGAGTCTTGCACCCGCCCGG - Intronic
1161167525 19:2796382-2796404 CCCTGAGTCCAGCACTCCCCGGG - Intronic
1161468771 19:4446197-4446219 CTCTGACTCCCCCACTCCCCAGG - Exonic
1163466042 19:17469290-17469312 GTGTGAGTTGAGCACTCCCCCGG + Intronic
1165801888 19:38557270-38557292 CTGTGTGTCAGGCACTGCCCTGG + Intronic
1167477945 19:49711795-49711817 CTGTGGGTCCTGCAGTCCCCAGG - Exonic
926415870 2:12649408-12649430 CTCTGAGTCTCTCCCTGCCCAGG - Intergenic
927470826 2:23375179-23375201 CAGTGATTCTCAAACTCCCCTGG + Intergenic
927965252 2:27263989-27264011 CTGTAAGTCGCTCCCTCCCCTGG - Intronic
928364550 2:30691212-30691234 CTGTGAGCCTGTCTCTCCCCGGG - Intergenic
935296696 2:101656161-101656183 GTGTGAGTCCCCCACACCCCAGG + Intergenic
938135483 2:128753248-128753270 CTGTGAGTCCCTCACTCCAGAGG - Intergenic
943674655 2:190705176-190705198 CTGTGAGTACCTCACTCCCCAGG + Intergenic
948792885 2:240388346-240388368 CTGTGAGTCTCAGTTTCCCCAGG - Intergenic
948792894 2:240388391-240388413 CTGTGAGTCTCAGTTTCCCCAGG - Intergenic
948792903 2:240388436-240388458 CTGTGAGTCTCAGTTTCCCCAGG - Intergenic
948809091 2:240465885-240465907 CTGGGAGACTCTCACTCCCTGGG - Intronic
1168835277 20:873485-873507 CTCTGAGTCTCTCACTCTCCAGG + Intronic
1170056570 20:12211451-12211473 CTCTGTGTCTGGCACTCTCCTGG - Intergenic
1171461195 20:25298925-25298947 CTGGGAGTCTCTGCCTCCCCAGG + Intronic
1174113706 20:48213178-48213200 CAGTGAGTCTGGCACAGCCCTGG + Intergenic
1174192681 20:48751343-48751365 CTGGGAGTGCCGCACTCCGCTGG + Intronic
1175314782 20:58039725-58039747 CTGTGCGGCCCACACTCCCCCGG - Intergenic
1176368115 21:6045772-6045794 TTCTGTGTCTCTCACTCCCCTGG + Intergenic
1179755404 21:43492770-43492792 TTCTGTGTCTCTCACTCCCCTGG - Intergenic
1181050557 22:20236460-20236482 CTGTGAGCCTGGCCCTGCCCCGG + Intergenic
1181519466 22:23436919-23436941 CTGAGAGCCAAGCACTCCCCAGG + Intergenic
1183987548 22:41577787-41577809 CTGTGAGTGTGGCCCACCCCAGG - Exonic
1184122376 22:42460471-42460493 CGGTGAGTCTCGCAGTATCCTGG - Intergenic
1184407542 22:44308567-44308589 CCGTGATTCTCTCACTCCCCAGG + Intronic
1184428651 22:44428254-44428276 CAGTGAGGCTCGCACACACCCGG - Intergenic
1184491443 22:44811537-44811559 GTGTGACTCTCCCACTCCCCGGG + Intronic
1184821808 22:46915131-46915153 CTGGGGGTTTCGCACACCCCTGG - Intronic
1185184873 22:49393040-49393062 CTGTGGCTCTAGGACTCCCCTGG - Intergenic
1185411468 22:50685197-50685219 CCGTGAGTCACGCACACACCAGG - Intergenic
951272153 3:20639377-20639399 CTCTGAGTCTCTTACTCTCCCGG + Intergenic
952077368 3:29713456-29713478 CTGTGAGTATGCCACTCACCTGG + Intronic
953848596 3:46448666-46448688 CTGTGGGTTTCCCACTCCTCTGG - Intronic
962854280 3:139329993-139330015 CTGTGGGTCTCTGGCTCCCCTGG + Intronic
969343887 4:6559335-6559357 CTGTGAGCCTGGCACTGCACGGG - Intronic
969696130 4:8735888-8735910 CTGTGTGTCTCGCAGCCCCTTGG - Intergenic
975683479 4:76897877-76897899 GTCTGAGTCTCGCCCTCCCGGGG + Exonic
981102300 4:140842657-140842679 CTGTCTGTCTCGTACTCGCCAGG + Intergenic
992556509 5:77908902-77908924 CTGTCAGTCTCGTAGTCACCAGG + Intergenic
993989417 5:94637939-94637961 TGGTGAGTCTCTCACTCCCTGGG + Intronic
996409646 5:123144170-123144192 CTTTGAGTCTCACCCTCCTCAGG + Intronic
997569040 5:134911761-134911783 CTGTGAGTCTCCAACTCCTAAGG + Intronic
1012011541 6:93793021-93793043 CTGTGAGTCAAGCATTGCCCTGG + Intergenic
1013213933 6:108010523-108010545 TTGAGAGTCTCGCTCTGCCCAGG + Intergenic
1015530491 6:134216941-134216963 CCATGAGTCTTGCACTCCCATGG - Intronic
1019591812 7:1839413-1839435 CTGAGAGCCAAGCACTCCCCAGG - Intronic
1023142253 7:37113278-37113300 CTGTGTGCCTGGCACTGCCCCGG + Intronic
1023872269 7:44269525-44269547 CTGTGAGTCACCCACTGCCAGGG - Intronic
1029357696 7:100064743-100064765 CTGTGGAGCTCGCACTCCTCAGG - Exonic
1032843739 7:135735451-135735473 CTGTGAGCCTGGCACTACCCAGG - Intronic
1034890130 7:154832394-154832416 ATGTGTGTCTGTCACTCCCCAGG - Intronic
1035328516 7:158081195-158081217 GTGTGAGTCTCTCTCTGCCCTGG + Intronic
1036168570 8:6460750-6460772 CTGTGAGGCTAGCTGTCCCCTGG + Intronic
1038537978 8:28368208-28368230 CTGTGAGGCTTGTTCTCCCCAGG - Intronic
1039559463 8:38501137-38501159 CTGTGAGTCTCTCATTTCCAGGG - Intergenic
1039821665 8:41140607-41140629 CCGTGCGGCTCTCACTCCCCAGG - Intergenic
1044790750 8:95844470-95844492 CTGAGATTCTCAGACTCCCCAGG + Intergenic
1046772117 8:118126637-118126659 CTGTGAGTCTATAACTCACCAGG - Intergenic
1048522849 8:135172747-135172769 CTGTGAGTTTCTCATTCTCCTGG + Intergenic
1049036863 8:140083486-140083508 CTGTGGTTCTCGCTCTTCCCTGG - Intronic
1049713466 8:144078246-144078268 CTGTCAGTGTCGCACCCCACTGG + Intergenic
1056452576 9:86730346-86730368 CTGTGAGTCTCGCCATCGCAGGG + Intergenic
1057202249 9:93147804-93147826 CTGTGTGTCTCTCATTCTCCTGG + Intergenic
1057249457 9:93488482-93488504 CTGTGATTCTCACACTCTCCTGG + Intronic
1061056742 9:128226836-128226858 CTGATTCTCTCGCACTCCCCTGG - Intronic
1061359551 9:130132309-130132331 CTGTGCTTTTCTCACTCCCCAGG + Intronic
1062071138 9:134555625-134555647 CTGTGGGTCTCCCATTCCCATGG - Intergenic
1062253463 9:135609615-135609637 CTGTGCGTCTCAGACTCCCAGGG + Intergenic
1199897037 X:152136167-152136189 CTGTGAGTTCCCCACTACCCTGG + Intronic
1200119732 X:153784620-153784642 CTGTGAGCCTCGGGGTCCCCAGG - Intronic