ID: 1104722424

View in Genome Browser
Species Human (GRCh38)
Location 12:131052269-131052291
Sequence GCCCTGACCAGGGTGGGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104722424_1104722431 -2 Left 1104722424 12:131052269-131052291 CCGAGTCCCACCCTGGTCAGGGC 0: 1
1: 0
2: 2
3: 34
4: 262
Right 1104722431 12:131052290-131052312 GCCGTGTCCTGAGGCTGGCGTGG 0: 1
1: 0
2: 4
3: 26
4: 246
1104722424_1104722434 2 Left 1104722424 12:131052269-131052291 CCGAGTCCCACCCTGGTCAGGGC 0: 1
1: 0
2: 2
3: 34
4: 262
Right 1104722434 12:131052294-131052316 TGTCCTGAGGCTGGCGTGGGTGG 0: 1
1: 1
2: 4
3: 31
4: 498
1104722424_1104722437 13 Left 1104722424 12:131052269-131052291 CCGAGTCCCACCCTGGTCAGGGC 0: 1
1: 0
2: 2
3: 34
4: 262
Right 1104722437 12:131052305-131052327 TGGCGTGGGTGGGCACCTGCTGG 0: 1
1: 0
2: 4
3: 15
4: 213
1104722424_1104722433 -1 Left 1104722424 12:131052269-131052291 CCGAGTCCCACCCTGGTCAGGGC 0: 1
1: 0
2: 2
3: 34
4: 262
Right 1104722433 12:131052291-131052313 CCGTGTCCTGAGGCTGGCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 142
1104722424_1104722430 -7 Left 1104722424 12:131052269-131052291 CCGAGTCCCACCCTGGTCAGGGC 0: 1
1: 0
2: 2
3: 34
4: 262
Right 1104722430 12:131052285-131052307 TCAGGGCCGTGTCCTGAGGCTGG 0: 1
1: 1
2: 2
3: 27
4: 177
1104722424_1104722435 3 Left 1104722424 12:131052269-131052291 CCGAGTCCCACCCTGGTCAGGGC 0: 1
1: 0
2: 2
3: 34
4: 262
Right 1104722435 12:131052295-131052317 GTCCTGAGGCTGGCGTGGGTGGG 0: 1
1: 1
2: 3
3: 35
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104722424 Original CRISPR GCCCTGACCAGGGTGGGACT CGG (reversed) Intronic
900177662 1:1297982-1298004 GCCCAGCCCAGGGTGGGGCGGGG - Intronic
900315806 1:2055808-2055830 GACCTGCCCAGGGTGGGGCAGGG - Intronic
900470816 1:2854103-2854125 GCCCTGGCCAGCCTGGGCCTGGG - Intergenic
900490580 1:2946937-2946959 CCCCTCACCAGGGTGGGCCCAGG - Intergenic
900514973 1:3077340-3077362 GCCCAGGCCAGCGTGGGGCTGGG - Intronic
902693024 1:18122060-18122082 GCTCAGACCAGGGAGGGATTCGG - Intronic
902777484 1:18684093-18684115 GCCATGAGGAGGGTGGGACAGGG + Intronic
903264255 1:22147503-22147525 ACCCTGACCAGGGAGGGAACGGG + Intergenic
903718209 1:25385184-25385206 GCCCAGAGAAGGGTGGGCCTCGG - Intronic
905447962 1:38039552-38039574 AGCCTGACCAGGGTGGGTCTGGG - Intergenic
906536026 1:46551407-46551429 TCCCTGGTCAAGGTGGGACTGGG - Intronic
906556656 1:46719232-46719254 GCCCTGCCCCGGCTGGGGCTGGG + Intergenic
907131693 1:52102995-52103017 GCCCTTCCAAGGGTGGGCCTTGG + Intergenic
907252170 1:53146719-53146741 GCCCTGACCAGGGGGAGCCAGGG + Intergenic
907335597 1:53697453-53697475 CCCCAGAGGAGGGTGGGACTTGG - Intronic
908027195 1:59965600-59965622 GCCCTGACCAGTGGTGTACTTGG + Intergenic
910667228 1:89738890-89738912 GCCCTGACCAGGCAGAGCCTGGG - Intronic
915087526 1:153398376-153398398 CCCCTAACCAGGGTGGGAGTAGG - Intergenic
915954090 1:160208631-160208653 GGCCTGGCCATGGTGGGGCTTGG - Intronic
916420803 1:164636043-164636065 ACCCAGACCAGGCAGGGACTGGG - Intronic
916723938 1:167506168-167506190 TCTGTGACCAGAGTGGGACTGGG - Intronic
916740704 1:167644747-167644769 GAGCTGAACAGGGTGGGATTCGG + Intronic
917687548 1:177432537-177432559 GCCTTTACCAGGGTGGCATTGGG + Intergenic
917731078 1:177875667-177875689 GCCTTCAGCAGGGTGGCACTGGG - Intergenic
918549876 1:185730073-185730095 GCCCAGACCAGGATGAGAGTAGG - Intergenic
920388406 1:205583772-205583794 GCCTTGACCAAGGTAGGAGTGGG - Intronic
1064544425 10:16436817-16436839 CCCCGGACCAGGGTGGGGCGTGG + Intergenic
1065743285 10:28815920-28815942 GCCCTGGGCAGTGAGGGACTTGG - Intergenic
1068586656 10:58807671-58807693 GCCCTGCTCAGGGTGAGACTGGG + Intronic
1069577827 10:69543521-69543543 GCCCTGACAAGGCTAGGGCTGGG - Intergenic
1069640708 10:69953855-69953877 ATCCTGGCCAGGGTAGGACTGGG + Intronic
1070702191 10:78612340-78612362 GCCCTGAACTGGGTGGCACTGGG - Intergenic
1071475803 10:86024125-86024147 GCCATGACCAGGGTTGGAATGGG + Intronic
1071570626 10:86694811-86694833 GCCTGGACCAGGGTGGGACAAGG - Intronic
1072484591 10:95843057-95843079 GCCCTGCCCAGGGTGAGAGGAGG + Intronic
1073116365 10:101094048-101094070 GCCCTGGCCAGGGTGGGAGAGGG - Intronic
1073302917 10:102481799-102481821 GGCCTGGCCTGGGTGGAACTAGG - Intronic
1075669102 10:124251032-124251054 CTCCAGACCAAGGTGGGACTGGG + Intergenic
1076381819 10:130028678-130028700 GCCCTGGGCAGAGTGGGTCTTGG + Intergenic
1076408584 10:130230412-130230434 GCACTGAGCAGGGTGGGGCTGGG - Intergenic
1076675619 10:132146144-132146166 GCCCGGGCCAGGGTGGGGGTGGG - Intronic
1076829148 10:132985654-132985676 GCCCTGACCAGATGGGGACATGG + Intergenic
1077486075 11:2838990-2839012 GCCCTGCCCGGGGTTGCACTAGG + Intronic
1078081156 11:8205689-8205711 GTCCTGCCCAGGGTGGAACAAGG - Intergenic
1078110675 11:8389280-8389302 GCCCAGAGCAGGGAGGCACTCGG + Intergenic
1078489489 11:11756089-11756111 GCCCTGCCCATGGTGGGCCCTGG + Intergenic
1078795817 11:14591175-14591197 GCCCTGGGCAGTGAGGGACTTGG + Intronic
1078915200 11:15772229-15772251 GCCCTGTCCTGGGTGTGACTTGG + Intergenic
1081647207 11:44798496-44798518 GCCCTGTCCTGTGAGGGACTTGG + Intronic
1082996794 11:59261689-59261711 GCCCTGACCAGCGGTGGCCTTGG - Intergenic
1083212886 11:61199978-61200000 TCCCTGAGCATGGTAGGACTAGG - Intergenic
1083215829 11:61219141-61219163 TCCCTGAGCATGGTAGGACTAGG - Intergenic
1083218713 11:61237970-61237992 TCCCTGAGCATGGTAGGACTAGG - Intergenic
1083560621 11:63670911-63670933 GCTCTGCCCAGGGCGGGGCTCGG + Intronic
1083587235 11:63869218-63869240 TCCCTGCCCAGGGTGGGGGTGGG - Intronic
1083672471 11:64306886-64306908 TCCCTGGCCTGGGTGGGAGTAGG + Intronic
1083822381 11:65180855-65180877 GCCCTGACTTGGGGGGGTCTCGG + Exonic
1084410386 11:69003194-69003216 GCGCTGGGGAGGGTGGGACTTGG + Intergenic
1087130792 11:94667896-94667918 TCTCTGACCAGGGTGAGGCTGGG - Intergenic
1089665419 11:120014816-120014838 GCCCTGAGCAGGGTGGAATTGGG - Intergenic
1089697534 11:120225359-120225381 ACCCTGATCAGGGTGGGTCAGGG - Intronic
1092894525 12:12999972-12999994 GCCCCGACGAGGGTGGGGGTGGG + Intronic
1097497669 12:60361693-60361715 GAGCTCAACAGGGTGGGACTTGG - Intergenic
1097878795 12:64668636-64668658 GCTTTCAGCAGGGTGGGACTTGG + Intronic
1099944551 12:89229318-89229340 GGCCTGAAAAGGGTGGGATTGGG + Intergenic
1102099494 12:110267458-110267480 GCCCTGTCCAGGGTGGGGAAGGG - Intergenic
1102585328 12:113919116-113919138 CCCCTGACCAGGAAGGGCCTAGG + Intronic
1103033659 12:117639192-117639214 GCCAGGACTAGGGTGGGGCTGGG - Intronic
1103319540 12:120083543-120083565 TCCTTGAACAGGGTGGGGCTGGG - Intronic
1104021346 12:124994171-124994193 GGCCTGACCAGTGCGGGTCTGGG + Intronic
1104571071 12:129926606-129926628 GCCCCGAACAGGGAGGGACGTGG - Intergenic
1104722424 12:131052269-131052291 GCCCTGACCAGGGTGGGACTCGG - Intronic
1104804175 12:131574427-131574449 GCCCTGAACAGGGCGGGACTCGG + Intergenic
1105398990 13:20071403-20071425 GCACTGAATAGGGTGGGAATGGG + Intronic
1107541010 13:41389146-41389168 GATCTGACCAGGGTGGGACCTGG + Intergenic
1112298578 13:98210380-98210402 GTCCTGTCCAGGCTGGGTCTGGG - Intronic
1113777763 13:112958497-112958519 CCCCCGACGAGGGTGGGACTGGG + Intronic
1114626275 14:24132150-24132172 GCACAGACCAGGGTGGGAGATGG + Intronic
1116895622 14:50312407-50312429 GCCCCGAGCCGGGCGGGACTAGG + Exonic
1118745846 14:68772526-68772548 AACCTGGCCAGGGTGGGACCAGG + Intergenic
1118776388 14:68976914-68976936 GCTCTGACCTGGGTGGCAGTGGG - Intronic
1118822174 14:69352712-69352734 GCCAAGCCCAGGGTGGCACTGGG + Intronic
1119675548 14:76550836-76550858 GAGCTCACCAGGGTGGGGCTGGG + Intergenic
1120965656 14:90165290-90165312 GTGCTGATCAGGGTGGGGCTGGG + Intronic
1121177819 14:91904436-91904458 GCCATTGCTAGGGTGGGACTAGG - Intronic
1121578950 14:95012051-95012073 ACCCGGCCCAGGGTGGGAGTGGG + Intergenic
1123061726 14:105597598-105597620 GCCCTGCCCTGGGTGGGAAAAGG - Intergenic
1123086464 14:105719329-105719351 GCCCTGCCCTGGGTGGGAAAAGG - Intergenic
1123587006 15:21769827-21769849 GGCGGGACCAGGGTGGGACCAGG + Intergenic
1123623644 15:22212392-22212414 GGCGGGACCAGGGTGGGACCAGG + Intergenic
1123806344 15:23877738-23877760 GCGCTGACCAAGGAGGGACTGGG + Intergenic
1124094690 15:26638179-26638201 GCTCTGACCAGGCTTGGACCAGG - Intronic
1125723508 15:41856546-41856568 GCTCTGACCCGGGTGGTGCTGGG - Exonic
1127449767 15:59105220-59105242 GCCCGGCCCAGGGAGGGACGCGG - Exonic
1127963995 15:63910375-63910397 GCCCTGCTCAGGGAGCGACTGGG - Intronic
1129111570 15:73340140-73340162 GGCCTGGCCAGGGTGGCAGTGGG + Intronic
1130671357 15:85915716-85915738 GCCCTGACCAGTGAGTCACTGGG - Intergenic
1131189173 15:90300489-90300511 GCCCTGGCCAGGGTGGCAAAGGG - Intronic
1131447127 15:92509734-92509756 GCACTGATCAGGGTGTGAATTGG + Intergenic
1131624313 15:94101471-94101493 ACACTAATCAGGGTGGGACTAGG - Intergenic
1132194087 15:99897170-99897192 GCTGTGGCCAGGGTGGGAGTGGG - Intergenic
1132346563 15:101112309-101112331 GCCCTGTCCAGGGTGGGGAGGGG - Intergenic
1132998329 16:2835906-2835928 CCCCCGACAATGGTGGGACTGGG - Intronic
1133127648 16:3656763-3656785 GCCTGGGCCAGGGTGGGGCTCGG + Intronic
1133230046 16:4362129-4362151 GCCCTGAGCATGGCGGAACTTGG + Exonic
1133315143 16:4878301-4878323 GACATGACCAGGGTGCTACTTGG + Intronic
1133708666 16:8380007-8380029 GGCCTCACCAGGGTGGAAATTGG + Intergenic
1134467808 16:14494834-14494856 GCACTGCCCAGGCTAGGACTCGG - Intronic
1135328645 16:21543613-21543635 GCCCGGACCAGCCTGGAACTAGG + Intergenic
1136338995 16:29629586-29629608 GCCCGGACCAGCCTGGAACTAGG + Intergenic
1138534638 16:57653389-57653411 GACCTGGGCAGGGTGGGACCTGG + Intronic
1139482020 16:67236024-67236046 GGCCTGCCCAGGAGGGGACTGGG + Intronic
1139551317 16:67674659-67674681 GCCCTTCCCAGGTGGGGACTGGG - Exonic
1140279567 16:73542280-73542302 GGGCTGCACAGGGTGGGACTGGG + Intergenic
1141699296 16:85635121-85635143 GCCCTGACCAGGGCGGGCTGGGG + Intronic
1142110096 16:88326769-88326791 GCCCTGGCCAGGGAAGGCCTGGG - Intergenic
1142302897 16:89268925-89268947 GCCCTGCTCTGGGTGGGCCTGGG + Intronic
1142362278 16:89633111-89633133 GCACTGTCCTGGGTGGGGCTGGG - Intronic
1142428956 16:90016136-90016158 CCCCAGAGCAGGCTGGGACTGGG + Intronic
1142535093 17:609295-609317 GCCCTGACCTGGGTGAACCTTGG - Intronic
1142714020 17:1738219-1738241 GCCCTGGCCAGTGTGGGACCGGG + Exonic
1143056406 17:4165464-4165486 GCCCTGCCCTGGCTGGGACTAGG - Exonic
1143398351 17:6621520-6621542 GTCCTGACCAGGTGGAGACTGGG - Intronic
1144737846 17:17564839-17564861 GCCCTGGCCAGGGAGGGCCTTGG + Intronic
1145799650 17:27674692-27674714 TCCCTGCCCAGGGTAGGCCTGGG + Intergenic
1145800111 17:27677176-27677198 GCCTACACCAGGGTGGGAGTAGG - Intergenic
1146863294 17:36323525-36323547 TCCCTGCCCAGGGTGGTCCTGGG - Intronic
1147066154 17:37924113-37924135 TCCCTGCCCAGGGTGGTCCTGGG - Intergenic
1147093624 17:38127608-38127630 TCCCTGCCCAGGGTGGTCCTGGG - Intergenic
1147156666 17:38547632-38547654 GCTGTGGCCATGGTGGGACTTGG + Intronic
1147649291 17:42053051-42053073 CCCCTGGCCATGGTGGGAGTGGG - Intronic
1147650373 17:42058552-42058574 GCTCTGCCCAGGTGGGGACTAGG - Intronic
1147862751 17:43533204-43533226 CCCATGGCCAGGGTGGGGCTGGG + Exonic
1149568008 17:57653083-57653105 GCTCTGAGGAGGGTGGGGCTGGG + Intronic
1149848162 17:60019398-60019420 TCCCTGCCCAGGGTGGTCCTGGG + Intergenic
1149996922 17:61410440-61410462 GCACTGCACAGGGTGGGGCTTGG + Intergenic
1150086514 17:62275980-62276002 TCCCTGCCCAGGGTGGTCCTGGG + Intronic
1150460517 17:65346386-65346408 GCACTGCCCAGGGTGGGCCAGGG + Intergenic
1151892404 17:76958518-76958540 GCCCAGAGCTGGGTGGGATTTGG + Intergenic
1152423174 17:80204956-80204978 ACCCTGCCCCGGGAGGGACTGGG - Intronic
1152561258 17:81079886-81079908 TCCCTCAGCAGGGTGGGCCTGGG + Intronic
1153890773 18:9513017-9513039 GCCCTGACTAGGAAGGGACGAGG - Exonic
1157196457 18:45624013-45624035 GCCCTGACCCTGGTGGTACGGGG + Intronic
1158514090 18:58116766-58116788 GCACTCACCAGGGTGGGCATGGG - Intronic
1159284851 18:66336303-66336325 CCCCAGCCCAGGGTGGGTCTGGG + Intergenic
1160807773 19:1000267-1000289 GCCCTGCCCAGGGCGGGATGGGG - Intergenic
1161156419 19:2734026-2734048 GCCCTGACCAGGAGGAGAGTCGG - Intronic
1161266996 19:3368717-3368739 CCCCAGACCAGGCTGGGCCTTGG - Intronic
1161507278 19:4650668-4650690 CCCCCGTCCAGGCTGGGACTGGG - Intronic
1161633822 19:5374523-5374545 CCACTGACCATTGTGGGACTTGG - Intergenic
1161978694 19:7619696-7619718 GGCATTACCAGGGTGGGCCTCGG - Intronic
1162913198 19:13861004-13861026 AGCCGGACCAGGGTGGGCCTTGG + Intergenic
1163038074 19:14583209-14583231 GCCCCGGCCAGGCTGGGGCTGGG + Intronic
1163038766 19:14587466-14587488 GCCCTGGCCAGGCTGGGGCTGGG + Intronic
1163039512 19:14592133-14592155 GCCCTGGCCAGGCTGGGGCTGGG + Intronic
1163578221 19:18122986-18123008 GGCCTGACCAGAGGGGGACTTGG + Intronic
1166171457 19:41030177-41030199 GACCTGGCCAGGGTGGGGGTGGG + Intergenic
1166752117 19:45169226-45169248 GCACTTACCAGTGTGGGACCTGG + Intronic
1167291167 19:48625930-48625952 GCCCTGACCAGGGTGCTCCTAGG - Exonic
1167296336 19:48652329-48652351 ACCCTGACCTGAGTCGGACTAGG - Intergenic
926242820 2:11101287-11101309 GCCCTGGCCTGGGTGGAAGTTGG - Intergenic
927932152 2:27052029-27052051 GCCCTGGGCAGGGTGGGACTGGG - Intronic
929557378 2:42934117-42934139 ACGCTGGCCAGGGTGGGTCTGGG + Intergenic
930051612 2:47220285-47220307 GCCCTGGCCAGGGTGAGATTTGG - Intergenic
930186820 2:48419462-48419484 GCCTAGAGCAGGGAGGGACTGGG + Intergenic
933789416 2:85872103-85872125 CCCCTCACCAGGGTAGGCCTCGG - Intronic
936234804 2:110733213-110733235 GCCCTGTCCAGGGCGTGTCTGGG + Intronic
938067895 2:128291906-128291928 GCCCTGAGCAGGGAGGGTGTTGG - Intronic
940345365 2:152623023-152623045 GCTTTAACCAGGGTGGGAGTGGG - Intronic
942501146 2:176592179-176592201 GCCCCCACCATGGTGGGGCTGGG + Intergenic
945657620 2:212644421-212644443 GCCCTGCCCAGGGAGAGCCTGGG - Intergenic
946700734 2:222410694-222410716 GCCCTGACATGGGTAGGAATTGG + Intergenic
947625686 2:231616816-231616838 TCCCTGACCAGGGCCGGCCTTGG + Intergenic
948330442 2:237160448-237160470 GCCAAGACCAGGGTGGGGCAAGG + Intergenic
948424307 2:237877774-237877796 GCCCTGGACAGGGTGGGGCCAGG - Intronic
948806857 2:240456761-240456783 GCCCCCACGGGGGTGGGACTGGG + Intronic
948901052 2:240957077-240957099 GCCCTGGGCAGGGAGGGAATGGG + Intronic
948927062 2:241105933-241105955 GCCCTGCCAGGGGTGGGCCTAGG - Intergenic
949026859 2:241770401-241770423 TCCCTACCCAGGGTGGGACGTGG - Intergenic
1168869524 20:1116554-1116576 GCCCTGACTGGGTTGGGGCTAGG + Intronic
1169340033 20:4789712-4789734 GCCCAGCTCAGGGTGGGAGTGGG + Intronic
1170949926 20:20927086-20927108 GCCCTGAGCAGGGTGGCAGGTGG + Intergenic
1171071295 20:22070825-22070847 GCGCTGAGCAGGATGGGGCTGGG + Intergenic
1171405422 20:24909515-24909537 GCCCCAACCAGGGAGGGACAGGG - Intergenic
1172126614 20:32628291-32628313 GCCCTGCACAGGCTGGCACTCGG + Intergenic
1172408194 20:34704517-34704539 GTCCCGACCCGGGTGGGCCTGGG + Intronic
1174455887 20:50648506-50648528 CCACTGACCAGGGTGGGGGTTGG + Intronic
1175191853 20:57216790-57216812 GCCCTGTCCAAGGTGGCAGTTGG + Intronic
1175225331 20:57441087-57441109 TCCCAGCCCAGGGTGGGACAGGG - Intergenic
1175401153 20:58700850-58700872 CCCCTGGCCAGTGTGGGATTGGG - Intronic
1175551461 20:59820603-59820625 CCCCTGCACAGGATGGGACTCGG - Intronic
1175733077 20:61367173-61367195 CCCCAGGCCAGGGTGGGACAGGG + Intronic
1175895161 20:62332821-62332843 GTCCGGGCCAGGGTGGGACTCGG - Intronic
1176087707 20:63305602-63305624 GCCCAGAGGAGGGTGGGACCCGG - Intronic
1176151860 20:63595560-63595582 GCCATGGCCAGGGTGGGGCTGGG + Intronic
1176255590 20:64151038-64151060 GCCCTGAACAGGATGTGACTTGG + Intergenic
1176266416 20:64211841-64211863 GCCCTGACCAGGCTGAGGGTGGG + Intronic
1177754502 21:25329705-25329727 AGCCTCACCAGGGTGGGATTGGG - Intergenic
1179909106 21:44438639-44438661 GCACAGGCCGGGGTGGGACTGGG + Intronic
1180049962 21:45326572-45326594 CACATGCCCAGGGTGGGACTCGG + Intergenic
1180082151 21:45491846-45491868 TCCCTGCCCAGAGTGGGGCTTGG - Intronic
1181166133 22:20984035-20984057 GGCCTGAGCAGGGGGGCACTTGG - Intronic
1181521284 22:23450041-23450063 GGCCTGTGCAGGGTGGGGCTGGG + Intergenic
1182419436 22:30241823-30241845 GCCCAGACATGGGTGGGAGTGGG + Exonic
1182577828 22:31285008-31285030 TCCAAGGCCAGGGTGGGACTGGG + Intronic
1183292502 22:37011314-37011336 GCCCTGCCCAGGACTGGACTCGG - Exonic
1183662726 22:39230940-39230962 GCCCCGACTAGGGTGAGACCAGG + Intronic
1183990995 22:41597024-41597046 GCCCTGCCCTGGGAGGTACTGGG + Intergenic
1184286139 22:43472742-43472764 TCCCTGGCCAGGCTGGGACCTGG + Intronic
1184398888 22:44262126-44262148 GTCCTGGCCAGGGTGGGAATTGG + Intronic
1184582220 22:45425610-45425632 GCCCTGCCTTGGGTGGGACCAGG + Intronic
1184734936 22:46392363-46392385 GCTGTGACCAGGCTGTGACTTGG + Intronic
1185330040 22:50248385-50248407 GCCCTGACAGGGGTGGGGCCGGG + Exonic
1185367662 22:50444264-50444286 AGCCTGACCAGGGTGGGCCGTGG - Exonic
950614974 3:14150945-14150967 GCGCTGGCCAAGGTGGGACAAGG + Intronic
952737795 3:36707435-36707457 GCCCTGCCCAGAGTAGGATTTGG + Intergenic
953024713 3:39138193-39138215 CCCTGGGCCAGGGTGGGACTGGG - Intronic
953583096 3:44174505-44174527 GTCCTAGCCTGGGTGGGACTTGG - Intergenic
953859561 3:46531469-46531491 GTCTTGACCAGGGTGGCAGTGGG + Intronic
954397962 3:50303022-50303044 GCCCTGAGCAGTGGGGGAATCGG - Exonic
954432684 3:50479635-50479657 TCCCTGGCCAGGGTTGGACCTGG - Intronic
954453666 3:50585481-50585503 TCCCTGTCCAAGCTGGGACTAGG + Intergenic
954747848 3:52797085-52797107 GCCCTGACCAGGGTGCGAGATGG - Exonic
960936968 3:122910441-122910463 GCCCTCAGCTGGGTGGAACTGGG - Intronic
961361894 3:126373331-126373353 GCCCAGACCAGGGTGGCCCATGG + Intergenic
968182899 3:196610311-196610333 ACCTTGGCCATGGTGGGACTAGG - Intergenic
969273252 4:6117152-6117174 GCCATTAGCAGGGTGTGACTCGG + Intronic
981573462 4:146177845-146177867 TCCCTGAGCAGGGTGGGGCAGGG + Intronic
985575427 5:671409-671431 GCCCTGCCCAGGCCGAGACTGGG - Intronic
986316076 5:6587308-6587330 GCCATGACCAGGGATGAACTTGG + Intergenic
987122376 5:14779166-14779188 GGCCTGACCAGGGTGAGTGTGGG + Intronic
988913342 5:35868526-35868548 GCCATGACCAGTGTGGGTCCTGG + Intronic
991291397 5:65036603-65036625 GCCCTGACCTGAATGGGACGTGG + Intergenic
997351521 5:133234567-133234589 GCCCTCATCAGGTTGGGCCTTGG + Intronic
997470722 5:134115429-134115451 GCCCTGGCCTCGGTGGGACGGGG + Intronic
998352050 5:141508272-141508294 TCCTTGACCAAGGTGGGCCTTGG + Intronic
1000430764 5:161149526-161149548 GCCCTGACTAGGGTGATGCTAGG - Intergenic
1002006347 5:176238111-176238133 CACCTGGGCAGGGTGGGACTGGG + Intergenic
1002220030 5:177672525-177672547 CACCTGGGCAGGGTGGGACTGGG - Intergenic
1002442911 5:179273635-179273657 GCCCTGACCACAGCGGGTCTTGG + Intronic
1002799100 6:504188-504210 GCCCAGACCAGGCAGGGGCTGGG + Intronic
1006457404 6:34139759-34139781 GCCCGGTCCAGAGTGGCACTCGG + Intronic
1006803601 6:36774798-36774820 GCCCTGCACAGGCTGGGGCTTGG - Intronic
1007284615 6:40738470-40738492 ACCCAGTCCAGGGTGGGAGTAGG - Intergenic
1007304481 6:40893379-40893401 CCCCTGAAACGGGTGGGACTAGG - Intergenic
1008531895 6:52469022-52469044 ACCCTCACTGGGGTGGGACTAGG + Intronic
1010198617 6:73263626-73263648 GCCCTGCAGAGGGTGGGCCTGGG - Intronic
1011329254 6:86185374-86185396 TCCCTGGCCAGGGTATGACTAGG + Intergenic
1017948817 6:159118363-159118385 GCAGAGAGCAGGGTGGGACTGGG + Intergenic
1018961178 6:168449932-168449954 GTCCTGACCAGGGTCGGAATGGG - Intronic
1019700964 7:2474929-2474951 GCACAGACCAGGGTGGGAGGTGG + Intronic
1020365567 7:7377499-7377521 ACTCTGACCAGGCTGGGACAGGG + Intronic
1022507494 7:30915924-30915946 GTCCTGCCCAGGGAGGGGCTGGG + Intronic
1026654474 7:72245207-72245229 GTCCTTACCAGGGCGGGGCTGGG - Intronic
1026891528 7:73985537-73985559 GCCCTGACCAGGCTAAGACGGGG - Intergenic
1026941620 7:74290518-74290540 GTCCTTCCCAGGGTGGGGCTGGG - Intronic
1027187328 7:75980234-75980256 GTCCTGCCCAGGGTGGCACCAGG - Intronic
1027197438 7:76040305-76040327 GCCCTGACCAGGCTGTGACCTGG + Intronic
1029184881 7:98731410-98731432 GGCCTGAGCAGGGTGTGGCTCGG + Intergenic
1029536513 7:101160640-101160662 GCCCTGTTCTTGGTGGGACTCGG + Exonic
1034265082 7:149776864-149776886 GGCCTCCCCAGGGTGGGACTGGG + Intergenic
1034424606 7:151007876-151007898 GCCCTGAACAGTGTGGCACTGGG - Intronic
1034432753 7:151049303-151049325 GCCATGTCAAAGGTGGGACTGGG - Exonic
1035073249 7:156159980-156160002 GCCAGGACCAGGGTGGGCTTTGG - Intergenic
1035335442 7:158124980-158125002 GCCTGGACCAGGGTGGGAGAAGG + Intronic
1035923967 8:3707774-3707796 GCCCTGACCATGCCTGGACTGGG - Intronic
1035945100 8:3953922-3953944 GCCCTGGCAAGGGTGGCTCTGGG + Intronic
1036379753 8:8228805-8228827 GCCCTGACCAGGGAGAGCCCAGG - Intergenic
1039427064 8:37494895-37494917 TCCCTGACCAGGAAGGGCCTGGG + Intergenic
1040934284 8:52766825-52766847 GCCCTGACCAGGAGGAGAGTTGG - Intergenic
1041389408 8:57335691-57335713 GGGCTGGCCAGGGTGGGTCTAGG - Intergenic
1042174839 8:66028723-66028745 GCCCAGACCAGGGTGGCAGCAGG - Intronic
1045027421 8:98101170-98101192 ACCCTGGCCAGGTTGGGTCTAGG - Intergenic
1048997900 8:139805360-139805382 GCCCTCACCAGGGTCGGAAGTGG + Intronic
1049323640 8:142010625-142010647 GCCCTGAGCAGGGTGGGTAGTGG - Intergenic
1049500305 8:142959591-142959613 GCCCTGGGCAGTGAGGGACTTGG + Intergenic
1049619909 8:143593427-143593449 CCCATGTCCTGGGTGGGACTGGG + Intronic
1052974600 9:34401524-34401546 GCCCTGCACAGGGTGGGCCTGGG - Intronic
1052997758 9:34560049-34560071 GCCCTGAGCAGGGAAGGGCTTGG + Intronic
1053201407 9:36153960-36153982 GGCCTGGCCTGGGTGGGGCTGGG - Intronic
1056101985 9:83308558-83308580 GGCCTGAGCAGGGCTGGACTAGG + Intronic
1057216481 9:93231524-93231546 GCCCTGACCACAGAGGAACTTGG + Intronic
1057305966 9:93912212-93912234 GCCCAGGCCAGGATGGGGCTGGG + Intergenic
1059421058 9:114192650-114192672 GGCCAGCCCAGGCTGGGACTTGG + Intronic
1059458621 9:114415445-114415467 GCCCTGAGCAGGTTGGCACATGG - Intronic
1059698205 9:116748745-116748767 TCCCTGTCCAGGGCAGGACTGGG - Intronic
1060732622 9:126048054-126048076 GCCCTGTGCAGGGTGGGGCTGGG + Intergenic
1061070974 9:128310526-128310548 GGCCTGAGCTGGGTGGGACTGGG + Intronic
1062610191 9:137370054-137370076 GCCCTTACCAGGGTGGAGCTAGG - Intronic
1187958610 X:24545590-24545612 GCACTGCCCAGGGTGGAGCTTGG - Intergenic
1191853140 X:65601180-65601202 GCTCTGACCAACGTGTGACTGGG + Intronic
1194005868 X:88491248-88491270 GACCTGACCATGCTGGCACTTGG - Intergenic
1197916868 X:131544861-131544883 GTCCTGGTCAGGGTAGGACTTGG - Exonic
1198032135 X:132763544-132763566 CTCCTGAACAGGGTGGGACATGG - Intronic
1198047211 X:132914677-132914699 GCCCTGACCTGGGGGGCACAAGG + Intronic
1199057589 X:143316524-143316546 GCAGTGACCTGGGTGAGACTGGG - Intergenic
1200003362 X:153072986-153073008 GCGCGGACCAGGGTGGCACGGGG - Exonic
1200004361 X:153077023-153077045 GCGCGGACCAGGGTGGCACGGGG + Intergenic
1200141524 X:153905134-153905156 GCCATGAGCATGGTGGGGCTGGG - Exonic