ID: 1104722585

View in Genome Browser
Species Human (GRCh38)
Location 12:131053205-131053227
Sequence TCACTGTGATGACGGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104722581_1104722585 14 Left 1104722581 12:131053168-131053190 CCTTCTGGTAGCTCTTTCTCTGA 0: 1
1: 0
2: 2
3: 20
4: 322
Right 1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG 0: 1
1: 0
2: 2
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104722585 Original CRISPR TCACTGTGATGACGGAGTGC AGG Intronic
900324039 1:2099160-2099182 TGATGGTGATGAAGGAGTGCCGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
919708961 1:200707172-200707194 TGACTGCGATGACTGAGTGTGGG + Intergenic
920536120 1:206737564-206737586 ACACTGTTCTGACTGAGTGCAGG - Intergenic
924697966 1:246419655-246419677 TGACTGTGATACGGGAGTGCTGG - Intronic
1063413639 10:5855793-5855815 TCACTGTCAGGCTGGAGTGCAGG - Intergenic
1074971381 10:118542292-118542314 TCCCTGGGATGATGGGGTGCTGG - Intergenic
1076702246 10:132279905-132279927 TCAGCGTGATCACGGAGTGTAGG - Intronic
1076702287 10:132280098-132280120 TCAGAGTGATCACGGAATGCAGG - Intronic
1076702305 10:132280208-132280230 TCAGCGTGATCACAGAGTGCAGG - Intronic
1076702366 10:132280511-132280533 TCAGCGTGATCACGGAGTGCAGG - Intronic
1076702423 10:132280833-132280855 TCAGTGTGATCACGGAGTGCAGG - Intronic
1076781134 10:132725273-132725295 ACACTTTCATGACTGAGTGCGGG - Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079536791 11:21524880-21524902 TGACAGTGAGGAAGGAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083226067 11:61285641-61285663 CCACTGAGATGAGGGAGGGCCGG - Intronic
1083780106 11:64913373-64913395 GTACTGTGATGAGGCAGTGCGGG - Exonic
1084423069 11:69070484-69070506 TCACTGTGATAGGTGAGTGCAGG + Exonic
1085336532 11:75701006-75701028 GCCCTGTGATGTTGGAGTGCTGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1088086544 11:105987466-105987488 CCACTGTGACAAAGGAGTGCAGG + Intergenic
1089637972 11:119828578-119828600 GCACTGTGATGACAGAGAGATGG + Intergenic
1091044950 11:132317193-132317215 GCACTGTGATTCAGGAGTGCGGG - Intronic
1091458101 12:623204-623226 TCACTGTCAGGAGGGAGTGCTGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098131391 12:67354141-67354163 TCATTGTGATGACAGATTGCAGG + Intergenic
1099606282 12:84805756-84805778 GCACTCTGATGAGGGAGTGAAGG - Intergenic
1100367582 12:93935799-93935821 TCACTGTGGGGATGGAGTGGAGG + Intergenic
1103993793 12:124816174-124816196 ACAGTGTGAAGCCGGAGTGCAGG - Intronic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1107737265 13:43412943-43412965 ACACTTTGATGGCTGAGTGCAGG + Exonic
1107908338 13:45082579-45082601 TCACTGGGAGGACAGAGTGTGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1116055170 14:39854902-39854924 TGACAGTGAGGATGGAGTGCTGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1124841327 15:33244711-33244733 TCTCTGTGATTACAGAGTTCTGG + Intergenic
1129641276 15:77381053-77381075 TCTCTGTGAAGAGGGAGAGCAGG - Intronic
1131120828 15:89822619-89822641 ACACTGTGACGAGGGAGGGCAGG + Intergenic
1134231314 16:12432654-12432676 TAACTGTGATGTCCGAGTACAGG + Intronic
1135741862 16:24982635-24982657 TCACAGTGATGAGGGAGATCAGG - Intronic
1136016145 16:27402413-27402435 TCACTCTGATGACGGGCAGCTGG - Exonic
1143094026 17:4467154-4467176 TCACGGTGATGGGGGAGTGAGGG + Intronic
1143393017 17:6571283-6571305 TCAGTGTGATGAAGGAGTCTTGG - Intergenic
1144202133 17:12951116-12951138 TCATTGTGAAAAGGGAGTGCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146371684 17:32268405-32268427 TCATAGGGATGAGGGAGTGCTGG + Intronic
1148399665 17:47345456-47345478 TCAGTGTCATGAAGGAGTGAAGG - Intronic
1150657249 17:67047446-67047468 TCACTGTGATTACGGAATGTTGG - Intronic
1151844510 17:76642889-76642911 TCACTCTGCTGCCGGAGTGCTGG - Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1157801286 18:50623467-50623489 TCACTGTGAAGACTGAGGACAGG - Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159878429 18:73835035-73835057 TCACTGGGATGACGGAGACAAGG - Intergenic
1159889202 18:73938754-73938776 TCAGTGTGGTGATGGAGTGGCGG + Intergenic
1161041268 19:2111869-2111891 ACACTGTGATGGGGGCGTGCTGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163978304 19:20873845-20873867 CCACTGTGATGAATGAGTGGGGG - Intergenic
1163978833 19:20879053-20879075 CCACTGTGATGAATGAGTGGCGG - Intergenic
1163979464 19:20885380-20885402 CCACTGTGATGAATGAGTGGTGG - Intergenic
1163979950 19:20889825-20889847 CCACTGTGATGAGTGAGTGGGGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925026497 2:611689-611711 TCACTGTGAGGACGATGTGTTGG - Intergenic
925373043 2:3361636-3361658 TGACTCTGATGACTGAGTGGAGG - Intronic
929915644 2:46133246-46133268 TTTCTGTGATGACAGAGTGCTGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
932842779 2:75099213-75099235 GCACTGAGATGCCAGAGTGCTGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
942381857 2:175399880-175399902 ACAGTGTGAGGAAGGAGTGCTGG - Intergenic
946156815 2:217812401-217812423 CCAATGGGATGATGGAGTGCTGG + Exonic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1172186472 20:33034204-33034226 TCAGTGTGATGACGGGCAGCTGG - Exonic
1172760027 20:37315143-37315165 TCACTGCCATGAGGGAATGCAGG + Intronic
1173162146 20:40661029-40661051 TCACTGGGATGTGGGAGTGAGGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1180200655 21:46222170-46222192 TCACGGTGAGGAAGGAGTGGGGG - Intronic
1185058336 22:48592661-48592683 TCACTGAGAGGAGGGAGTGAGGG - Intronic
949498238 3:4653965-4653987 TCACTGTGGTCACGGAGTGCTGG + Intronic
949802719 3:7921063-7921085 TCACTGGGATGACTGACTGAGGG - Intergenic
950824988 3:15809221-15809243 TCACTGTGAAGACAGAGTTTAGG - Intronic
952732370 3:36652371-36652393 TAACAGTGATGACAGATTGCAGG - Intergenic
953326302 3:42014356-42014378 TCACTGTCACCTCGGAGTGCCGG - Intronic
953443048 3:42936327-42936349 TCAGTGTGATGACGCACTTCCGG + Intronic
953906385 3:46870409-46870431 TGACAGTGAAGAGGGAGTGCTGG + Intronic
955133824 3:56196277-56196299 TCTCTGTGAGGAGGGAGTGTGGG - Intronic
956099285 3:65750217-65750239 TCACTGTGCTGATGGAGGGCAGG + Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
964484516 3:157174228-157174250 TCCCTGGGCTGACGGAGTTCAGG + Intergenic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
978641771 4:110879140-110879162 TCACAGAGATGAAGCAGTGCTGG + Intergenic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
981128394 4:141132584-141132606 ACACGGAGAAGACGGAGTGCGGG - Exonic
985724788 5:1510476-1510498 TCACTGTGCTGTGGGACTGCGGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
987829103 5:23073431-23073453 TCACTGTGAGGAAGGAGGGAAGG + Intergenic
992488991 5:77222664-77222686 GCAATGTGTTGACTGAGTGCCGG + Intronic
993330908 5:86598632-86598654 TGACTGTGATGAAGGTTTGCTGG - Intergenic
994773881 5:104019427-104019449 TCACTGTGATTACAGACTGGTGG + Intergenic
997381513 5:133441490-133441512 TCACTGTGATGGGTGAGGGCTGG - Intronic
999992431 5:157061771-157061793 TCATTTTGATGACGGAATGTGGG + Intergenic
1000814350 5:165901868-165901890 TAACTTTGATGTCGCAGTGCTGG - Intergenic
1001226727 5:169951040-169951062 TCACTGTGGTGTGGGAATGCAGG - Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007234788 6:40382732-40382754 TCACTGTAATGCATGAGTGCGGG + Intergenic
1007731321 6:43949182-43949204 TCACTGGGATGCTGGACTGCTGG - Intergenic
1009488277 6:64253730-64253752 TCACTGAGGTGACTTAGTGCAGG + Intronic
1009543686 6:64999401-64999423 TCACTGTGATATGGAAGTGCTGG + Intronic
1012267465 6:97163359-97163381 TAACTCAGATGAGGGAGTGCAGG + Intronic
1022819252 7:33942867-33942889 TCACTCTGATGTTGAAGTGCTGG + Intronic
1024161884 7:46684395-46684417 TTACTGGGATGATGGAGTTCAGG - Intronic
1024200780 7:47103807-47103829 TCGCTGAGATGCCGGAGGGCTGG + Intergenic
1024264388 7:47595684-47595706 TCACTGTGATACAGGAGTGCTGG + Intergenic
1034553516 7:151835816-151835838 CCACTGTGATGGCAGATTGCTGG + Intronic
1035339718 7:158152494-158152516 TCACAGTGATATGGGAGTGCTGG + Intronic
1036045359 8:5134066-5134088 TCACTGTGTTGGCGAAGTGAGGG - Intergenic
1038113366 8:24524867-24524889 ACATTGTGATGACGGAGTCCAGG - Intronic
1038432291 8:27510035-27510057 TCAGTGTGATGGGGGAGGGCAGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044108939 8:88247868-88247890 TCACTGTGATGAGAGAGAGTAGG - Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1049351869 8:142168974-142168996 GCGCAGTGATGACGGTGTGCTGG + Intergenic
1054762512 9:69015643-69015665 ACCCTGTGATGGCTGAGTGCTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186204893 X:7190933-7190955 TTACTGAGATGACTGTGTGCAGG - Intergenic
1188004675 X:25009046-25009068 TCACTGCGATCAAGGAGTGGCGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1199589466 X:149453222-149453244 TCATTGTGATGACTCATTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic