ID: 1104722795

View in Genome Browser
Species Human (GRCh38)
Location 12:131054745-131054767
Sequence GTCTCTGCCGGGTCTTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104722788_1104722795 15 Left 1104722788 12:131054707-131054729 CCTCTCCGGTCACTGGTCTTGGA 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1104722795 12:131054745-131054767 GTCTCTGCCGGGTCTTGCCTAGG 0: 1
1: 0
2: 1
3: 11
4: 110
1104722789_1104722795 10 Left 1104722789 12:131054712-131054734 CCGGTCACTGGTCTTGGATATCT 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1104722795 12:131054745-131054767 GTCTCTGCCGGGTCTTGCCTAGG 0: 1
1: 0
2: 1
3: 11
4: 110
1104722784_1104722795 29 Left 1104722784 12:131054693-131054715 CCATGCAGCTCTCTCCTCTCCGG 0: 1
1: 0
2: 8
3: 54
4: 347
Right 1104722795 12:131054745-131054767 GTCTCTGCCGGGTCTTGCCTAGG 0: 1
1: 0
2: 1
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104722795 Original CRISPR GTCTCTGCCGGGTCTTGCCT AGG Intronic
900356301 1:2266438-2266460 GTTTCTGCTGGGCCCTGCCTGGG + Intronic
900918752 1:5657546-5657568 GTCTCTGCCTTCTCTTTCCTAGG - Intergenic
900948549 1:5844812-5844834 GCCTCCCCCGGGTCTCGCCTTGG + Intergenic
901425832 1:9182151-9182173 GGCTCTGCCTGGGCTTGCCTGGG - Intergenic
901770624 1:11528806-11528828 GTCTCTGACGGGGCTAGCTTTGG + Intronic
903540782 1:24095080-24095102 TTCTCTTCTGGGTCTTGACTAGG + Intronic
905281259 1:36850790-36850812 GTCAGTGCCAGGTCTTGCCCTGG + Intronic
906942675 1:50269322-50269344 GACTCTGACGGGTCTTTCCCTGG - Intergenic
914224451 1:145708390-145708412 GTCTTTGCTGGGCCTTGGCTTGG + Intergenic
914900736 1:151709850-151709872 CTCTCTGCAGGGCCTGGCCTGGG - Intronic
919823228 1:201485803-201485825 CTCTCTGCCCTGTGTTGCCTTGG + Intronic
923445909 1:234071129-234071151 GACTCTGCCGGGTCTGCTCTTGG - Intronic
1070744513 10:78924944-78924966 ATCTCTGCCACTTCTTGCCTGGG + Intergenic
1071958214 10:90782030-90782052 GGCTCTGCTGGCTCCTGCCTTGG + Intronic
1073192512 10:101661768-101661790 GTTTCTTCTGGGTCTTGTCTAGG - Intronic
1073524109 10:104163327-104163349 GTCTCTGCTGGATATTGGCTGGG - Intronic
1077369794 11:2176103-2176125 GGCTCTGCAGGGTCTAGCCATGG + Intergenic
1082285556 11:50314137-50314159 GTCTCTGCCAGGTTTTATCTGGG + Intergenic
1083231411 11:61323030-61323052 GTGTTTGTCGGGTCTCGCCTGGG - Exonic
1083292872 11:61699573-61699595 GTCTCTGCTGGGCCATGCCTTGG - Intronic
1084434506 11:69131108-69131130 GTCCCTGCCGGCTCTTGTCCTGG + Intergenic
1085395863 11:76206775-76206797 GTGTCTGCCCGGTCTCTCCTGGG - Intronic
1085444605 11:76592045-76592067 GTCTGTGCCAGGCCTTGTCTTGG + Intergenic
1088753284 11:112864200-112864222 GTCTCTGCCTAGTCTTCCCTTGG + Intergenic
1091388224 12:108735-108757 GGCTCTGCCGGGTCTGGCTCTGG + Intronic
1094498124 12:31001977-31001999 GTCTCTGCTTGTTCTTGCTTTGG - Intergenic
1104722795 12:131054745-131054767 GTCTCTGCCGGGTCTTGCCTAGG + Intronic
1109554637 13:63955862-63955884 CTCTCTGCCCTGTGTTGCCTGGG + Intergenic
1110948948 13:81460674-81460696 GTCCTTGCCCGGTATTGCCTAGG + Intergenic
1114217681 14:20669070-20669092 GGCTTTGCTGGGTTTTGCCTGGG + Intergenic
1115664796 14:35534649-35534671 GTCTCCGCCGAGTCTTTCCCCGG + Exonic
1116857500 14:49965865-49965887 GTCTCTGCCAGTTCTTTCCAAGG + Intergenic
1117615336 14:57528499-57528521 GTCTCTGCTGGGTCATGTGTTGG - Intergenic
1119899432 14:78247283-78247305 GTGTCTTCTGGGTCTTACCTAGG - Intronic
1121329556 14:93041344-93041366 GTCTCTGCACAGTATTGCCTGGG + Intronic
1121436246 14:93922063-93922085 GGCTCTGCCTGGCTTTGCCTTGG + Intronic
1121438862 14:93936333-93936355 GTCTCTGCAGGGATTTCCCTGGG + Intronic
1122152318 14:99731749-99731771 GTCTCTGCCTGGCCTCGCCCTGG - Intergenic
1124250226 15:28102130-28102152 GTCTCTGCCTGTTCCTGCCATGG + Intergenic
1124386328 15:29210725-29210747 TTCTCTGTGTGGTCTTGCCTGGG + Intronic
1124625359 15:31304476-31304498 TTCTCTGCAGGGTCAGGCCTGGG + Intergenic
1125920955 15:43525457-43525479 GTCTTTGCCAGGCCCTGCCTTGG + Exonic
1126285681 15:47008515-47008537 GTCTCTGCCTGGTCATCCGTGGG - Intergenic
1128556667 15:68636399-68636421 GTCTCTGGCTGGGCTTGCATTGG + Intronic
1130154013 15:81334090-81334112 GTCTCTGTGGGGTCTTGACAAGG - Intronic
1132300250 15:100770949-100770971 GTCTCCTCCAGGACTTGCCTTGG + Intergenic
1132654762 16:1037128-1037150 GTCTCTGCCCGCTGCTGCCTCGG - Intergenic
1139630310 16:68227731-68227753 GTTTCTGCTGGGCCCTGCCTTGG - Exonic
1139761585 16:69187948-69187970 ATCTCAGCCGAGTCTTCCCTAGG - Intronic
1140529285 16:75649762-75649784 GTCTCTTCCTGGTCTTGCTTAGG + Intronic
1141688069 16:85581543-85581565 GGCTCTCCAGGGTCCTGCCTTGG - Intergenic
1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG + Intergenic
1142050517 16:87955029-87955051 GGGTCTGCCGGGCCTTGCCCAGG - Intronic
1146419187 17:32666291-32666313 TTCTCTGCAGGCACTTGCCTGGG + Intronic
1150767751 17:68015632-68015654 CCCTCTGCTGGCTCTTGCCTCGG - Intergenic
1151657170 17:75501544-75501566 GTCTCTGCTGGGCCTGGCCTGGG + Exonic
1152451895 17:80386864-80386886 GGCTCAGCCGGGGCTTGCCCTGG - Exonic
1152606741 17:81295225-81295247 GGCTCTTCCGGGTCTGGGCTCGG - Exonic
1153314790 18:3711096-3711118 GTCTCTGCCAGACCTTGCCCAGG - Intronic
1158571243 18:58598469-58598491 GCCTCTGCCAGGTCCTGCCTGGG - Intronic
1159806088 18:72959976-72959998 GCCTCTGCCGTGTCTTTACTAGG + Intergenic
1160731602 19:643874-643896 GCCTCTGCCGGGCCCTGCCTGGG - Intergenic
1161023286 19:2021924-2021946 GTCTCTGGAGGGTCTTGCCCTGG - Intronic
1166059734 19:40318710-40318732 GTCTCAGGAGGGTCTAGCCTGGG + Intergenic
1168707007 19:58476113-58476135 GCCTCAGCCGGGTGTTGCCCCGG - Intronic
927888140 2:26730915-26730937 GTCTCTGCTGGGTCTTTCCTAGG + Exonic
929998138 2:46842277-46842299 GTCTCCTGCTGGTCTTGCCTGGG + Intronic
936418437 2:112341555-112341577 GTCTCTCCAGGTTCTTTCCTGGG + Intergenic
937356562 2:121201593-121201615 GTCTCTGCCTGATCCTGCCTGGG + Intergenic
937362022 2:121236246-121236268 GTGTCTGCCGGGTCTAGCCCCGG + Intronic
939254198 2:139721544-139721566 CTATCTGCCTGTTCTTGCCTAGG + Intergenic
941106827 2:161363979-161364001 GTATCTGGGGGTTCTTGCCTTGG + Intronic
943203543 2:184860747-184860769 GTGTCTGCAGGGGATTGCCTGGG + Intronic
948159957 2:235815269-235815291 GGCTCTGCTGGGCCTTGTCTTGG - Intronic
948728477 2:239948832-239948854 GCCTCTGCTGGCTCCTGCCTAGG - Intronic
1169077662 20:2771359-2771381 TTCTCTGCCATGTCTTTCCTGGG - Intergenic
1170218361 20:13915873-13915895 GTCTCTACAGGGTCTGGCATTGG + Intronic
1171384713 20:24762629-24762651 GTCTCTGCATGGCCCTGCCTAGG + Intergenic
1172099640 20:32477470-32477492 GTCTCTGCCCTGTCTTTCCCTGG + Intronic
1173549256 20:43921085-43921107 GCCTCTGCGGGGTCCTGCCCTGG - Intronic
1175619907 20:60434735-60434757 ATGTCAGCCTGGTCTTGCCTCGG + Intergenic
1176056153 20:63150419-63150441 GTCTCCCCGGGGACTTGCCTGGG - Intergenic
1176993338 21:15523954-15523976 GTATCTCCAGGTTCTTGCCTTGG - Intergenic
1179585769 21:42373279-42373301 GTCTCTTCTGGGTCTCCCCTAGG + Intronic
1180251983 21:46596167-46596189 CTCTCTCCAGGGTCTTGGCTGGG + Intergenic
1182356624 22:29725069-29725091 TCCTCTGCAGGGTCCTGCCTGGG - Intronic
1182769985 22:32787868-32787890 GCCTCTCCCAGGTCTTGCCATGG - Intronic
1183814389 22:40287480-40287502 GCCTCTCCAAGGTCTTGCCTGGG + Intronic
1184300311 22:43555022-43555044 GTCTCTGTCGGCTGTGGCCTTGG + Exonic
952904820 3:38132778-38132800 GTCTCTGCAGAGCCTGGCCTGGG - Intronic
957056278 3:75445249-75445271 GTAACTCCCGGGTGTTGCCTTGG + Intergenic
960564618 3:119120022-119120044 ATCTTTGCCAGGTCTTTCCTTGG - Intronic
962949370 3:140203929-140203951 GTCTCTCCAGGGTCTTGGTTAGG + Intronic
967230469 3:187333119-187333141 GTGTTTGCCAGGCCTTGCCTTGG - Intergenic
968213383 3:196867967-196867989 GTCGCTGGCGGGGCTTCCCTTGG + Exonic
969401614 4:6959440-6959462 GTCTCTGCTGGGCCTTCCCCCGG + Intronic
969711189 4:8845112-8845134 GTCCCTGCCGTGTTGTGCCTGGG + Intergenic
969754910 4:9143104-9143126 GTAACTCCCGGGTGTTGCCTTGG - Intergenic
982383117 4:154770955-154770977 GACTCTGCAGGGTCCTGCATGGG - Intergenic
986786834 5:11122681-11122703 GTCTCTGCAGGATCTGGCCTGGG + Intronic
1005094495 6:22099404-22099426 GTCTCTGACAGTTCGTGCCTGGG - Intergenic
1007732448 6:43955271-43955293 GTCTCTGACTGGTCTTCCCCAGG - Intergenic
1022099245 7:27159433-27159455 GTTGGTGCGGGGTCTTGCCTGGG + Intergenic
1023837848 7:44078914-44078936 GTCTCTGCCGGGTGTTGGAGGGG - Intronic
1025996378 7:66529977-66529999 ATCTCTGCAGGGACTGGCCTTGG - Intergenic
1033072039 7:138212352-138212374 GTCTCTGCAGTGTCTTGGCAGGG + Intergenic
1034417401 7:150972275-150972297 GTCTCTGCCTGGGCCAGCCTCGG - Intronic
1037783710 8:21889279-21889301 GTCTCTGCAGGGTCTCACGTAGG - Intergenic
1039454917 8:37699838-37699860 GGCTCTGCCGGGCCAGGCCTAGG - Exonic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1048988630 8:139748621-139748643 TTCTGTGCCGGGCCTTGCATAGG + Intronic
1049207838 8:141371661-141371683 GGCTCTGCCTGGCCTTGCCATGG + Intergenic
1051240736 9:15053102-15053124 GTCTCTGCCAGGTTTTGGTTTGG - Intergenic
1057174807 9:92988342-92988364 ACCTGTGCAGGGTCTTGCCTGGG - Intronic
1059403903 9:114088068-114088090 GGCTCTGCAGGTTCCTGCCTGGG - Intronic
1062196240 9:135275744-135275766 GTCGCTGCCAAGTCATGCCTGGG - Intergenic
1062414134 9:136439425-136439447 GTCTCTCCCGGGGCAGGCCTCGG + Exonic
1185747026 X:2582093-2582115 GTCACTCGCGGGGCTTGCCTGGG - Intergenic
1186753612 X:12647249-12647271 GTCTCTGGCTGGTGTTTCCTGGG - Intronic
1187710247 X:22046057-22046079 TTCTCTGCCGATTTTTGCCTAGG + Intronic
1190812071 X:53894577-53894599 CTTTCTGCCTGGTATTGCCTTGG - Intergenic
1200154740 X:153969461-153969483 GACTCTTCCAGCTCTTGCCTGGG + Intronic
1200217691 X:154375190-154375212 GGCGCTGCCAGGTCTGGCCTGGG + Intergenic