ID: 1104723651

View in Genome Browser
Species Human (GRCh38)
Location 12:131061201-131061223
Sequence GTTCCCACCCCCAGTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 3, 2: 2, 3: 31, 4: 236}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104723637_1104723651 26 Left 1104723637 12:131061152-131061174 CCCCGCCCAGCCTCTCAAGGTGA 0: 1
1: 0
2: 3
3: 61
4: 946
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723643_1104723651 16 Left 1104723643 12:131061162-131061184 CCTCTCAAGGTGATGCCTATGGC 0: 1
1: 0
2: 0
3: 2
4: 81
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723639_1104723651 24 Left 1104723639 12:131061154-131061176 CCGCCCAGCCTCTCAAGGTGATG 0: 1
1: 0
2: 10
3: 211
4: 2316
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723645_1104723651 -6 Left 1104723645 12:131061184-131061206 CCCCCAAAAGTCCCTGTGTTCCC 0: 1
1: 1
2: 0
3: 39
4: 383
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723646_1104723651 -7 Left 1104723646 12:131061185-131061207 CCCCAAAAGTCCCTGTGTTCCCA 0: 1
1: 0
2: 1
3: 19
4: 304
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723641_1104723651 20 Left 1104723641 12:131061158-131061180 CCAGCCTCTCAAGGTGATGCCTA 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723638_1104723651 25 Left 1104723638 12:131061153-131061175 CCCGCCCAGCCTCTCAAGGTGAT 0: 1
1: 0
2: 3
3: 231
4: 6396
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723640_1104723651 21 Left 1104723640 12:131061157-131061179 CCCAGCCTCTCAAGGTGATGCCT 0: 1
1: 0
2: 0
3: 12
4: 197
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723648_1104723651 -9 Left 1104723648 12:131061187-131061209 CCAAAAGTCCCTGTGTTCCCACC 0: 1
1: 0
2: 1
3: 23
4: 268
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723644_1104723651 1 Left 1104723644 12:131061177-131061199 CCTATGGCCCCCAAAAGTCCCTG 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236
1104723647_1104723651 -8 Left 1104723647 12:131061186-131061208 CCCAAAAGTCCCTGTGTTCCCAC 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG 0: 1
1: 3
2: 2
3: 31
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104723651 Original CRISPR GTTCCCACCCCCAGTGACTC AGG Intronic
900214837 1:1475840-1475862 GTTCCTACCCCCAGTGACTCTGG - Intronic
900222050 1:1514194-1514216 GTTCCTACCCCCAGTGACTCTGG - Intronic
901671752 1:10860242-10860264 GTCCCCATCCCCAGTGATTTGGG + Intergenic
901803847 1:11725382-11725404 GGCCCCACCCCCAGAGATTCTGG - Exonic
902332076 1:15735591-15735613 GCCCCCACCCCCACTGCCTCTGG - Intergenic
903069304 1:20718616-20718638 GTGCCCACCACCAGAGACGCGGG - Intergenic
904156913 1:28491492-28491514 GGTCCCACCCCCAGTGATTATGG - Intronic
904902563 1:33869035-33869057 GTTCACACCTCCAGTTGCTCCGG - Intronic
905692537 1:39954209-39954231 GTTTCAACCCTCAGTGCCTCTGG + Intergenic
908828187 1:68153521-68153543 GTCCCGACCCCCAGTGCTTCTGG - Exonic
912379633 1:109240405-109240427 GTTCCCACACCCAGGTATTCAGG + Intergenic
912513038 1:110201369-110201391 GTCCCCACCCCCACTGGCTTTGG + Exonic
914897206 1:151687393-151687415 GGTCCTACCCCCAGAGATTCTGG - Intronic
915301983 1:154956908-154956930 ATTCCCACTCCCAGGGACCCTGG + Intergenic
916878839 1:168999112-168999134 GTTCCCTCCCCCACTGTCCCTGG + Intergenic
918685425 1:187408808-187408830 ATTCCCACCCTCAGTCACTAAGG + Intergenic
918787517 1:188782214-188782236 TTTCCCAGGCCCTGTGACTCTGG + Intergenic
923208249 1:231778893-231778915 GTTCCCAGCCCCAGTGGGCCGGG + Intronic
924771985 1:247087326-247087348 GAACCCACCCCCAGCTACTCTGG - Intergenic
1065190966 10:23208737-23208759 GTTCCCTCACACATTGACTCTGG + Intronic
1065608771 10:27449139-27449161 GTTCCCTCCCACATTGGCTCTGG + Intergenic
1066075221 10:31868589-31868611 CTTGCCACCCCCAGTAACTCTGG - Intronic
1066111372 10:32199958-32199980 GTTCCATCCCCCAGGCACTCGGG - Intergenic
1066324407 10:34342361-34342383 CTTCCTACCCCCAGTAACCCAGG - Intronic
1067187322 10:44042294-44042316 GTTCCCAGCCCCAGTTGCCCTGG + Intergenic
1068845063 10:61662893-61662915 GTTCCCAGGCCCAGGGACGCCGG + Intergenic
1069786996 10:70994801-70994823 GTTCCCTCCACCAATAACTCTGG + Intergenic
1070307185 10:75246570-75246592 CTTCCTGCCCCCAGTGGCTCAGG + Intergenic
1071143529 10:82540855-82540877 GTTCTAACCCCCAGTACCTCAGG + Intronic
1072105667 10:92271056-92271078 AGTCCCAGCCCCAGTCACTCAGG + Intronic
1073754879 10:106571027-106571049 GCCCCCACCCCTAGTCACTCTGG + Intergenic
1074445834 10:113520331-113520353 CTTCCTATACCCAGTGACTCAGG + Intergenic
1074601690 10:114920618-114920640 GTTCTCACTCCCAGTGACTCAGG + Intergenic
1074761365 10:116669714-116669736 GTTCGCACCCCCTTTCACTCTGG - Intronic
1074908770 10:117888313-117888335 ATTTCCACCCCATGTGACTCTGG + Intergenic
1075242395 10:120791126-120791148 GTTCCCACCCCCACTTCATCTGG + Intergenic
1075795330 10:125116105-125116127 GGTCCCTGCCCCAGGGACTCAGG + Intronic
1077978634 11:7276121-7276143 AGTCCCACCCTCAGTCACTCAGG + Intronic
1078374893 11:10785545-10785567 CTTCCCAGCCACGGTGACTCTGG - Intergenic
1079247293 11:18761939-18761961 GTTCCCACGCACAGTCACCCGGG - Intronic
1080304544 11:30822168-30822190 GTACCCTCCCACAGTGAATCAGG + Intergenic
1080423944 11:32139015-32139037 GTCCCCACCCACTATGACTCTGG + Intergenic
1082209418 11:49480317-49480339 ATTCCCACCTCCAGAGATTCTGG - Intergenic
1083741276 11:64712861-64712883 GTGCCCAGCCCCCGTGCCTCAGG + Intronic
1084772064 11:71349731-71349753 GTTCACTCCCACAGTGAGTCAGG + Intergenic
1085168581 11:74427549-74427571 GTTCCCGCCCACATTGACTCTGG + Intergenic
1085759654 11:79230969-79230991 TTCCCCAACCCCAGTGAGTCCGG - Intronic
1086507272 11:87518818-87518840 GTGCCTAATCCCAGTGACTCAGG - Intergenic
1086640202 11:89144897-89144919 ATTCCCACCTCCAGAGATTCTGG + Intergenic
1087995954 11:104809486-104809508 GTTCCCATGCCCAGAGACTATGG + Intergenic
1088742700 11:112780112-112780134 TTTCCCCACCCCAGGGACTCTGG - Intergenic
1089757625 11:120697974-120697996 CACCCCACCCCCAGAGACTCGGG - Intronic
1090639966 11:128721858-128721880 AATCCCAAGCCCAGTGACTCAGG + Intronic
1091357956 11:134952449-134952471 ATTCCCACCCTCAGTGAATAAGG + Intergenic
1091646617 12:2276870-2276892 GGTCCCTGCCCCAGTGATTCAGG - Intronic
1092773732 12:11922602-11922624 ATTACCTCTCCCAGTGACTCTGG - Intergenic
1096576168 12:52554205-52554227 GATGCCAGCCCCAGAGACTCTGG + Intergenic
1096578837 12:52571468-52571490 GTTGCATCCCCCAATGACTCTGG - Intronic
1096595083 12:52690028-52690050 GTTCCAACCCCAAGTCAGTCAGG - Exonic
1098250077 12:68560393-68560415 GTTCCCACCCCCAGTCAGCAGGG - Intergenic
1099396246 12:82144668-82144690 GTCCCCTCCCCCATTGACTCTGG + Intergenic
1099548948 12:84018948-84018970 GTCTCCACCCCCATTGACTGGGG - Intergenic
1101799980 12:108013327-108013349 GGTCCCATCCCCAGAGACTTTGG + Intergenic
1104289337 12:127454539-127454561 GCTCCCACCCTCACTGTCTCTGG - Intergenic
1104596843 12:130125940-130125962 TTTCCCAGCCCCCGTGACTCCGG - Intergenic
1104668286 12:130663000-130663022 TTTCCCACCCACAGAGATTCTGG - Intronic
1104723651 12:131061201-131061223 GTTCCCACCCCCAGTGACTCAGG + Intronic
1107786088 13:43959394-43959416 GTCCTCAACCCCAGGGACTCTGG + Intergenic
1107982689 13:45748639-45748661 TCTCCCACCCCCAGGTACTCTGG + Intergenic
1110469241 13:75840414-75840436 GATCCCACACCCAGCGACTCGGG - Exonic
1112165363 13:96912935-96912957 GTTCCCACCAACAGTGAATGAGG + Intergenic
1114522821 14:23349455-23349477 TTTCCCACCACCAGAGAGTCTGG - Intronic
1114720362 14:24874861-24874883 GTTCCCACTCACAGGGAGTCAGG - Intronic
1115568635 14:34646954-34646976 GTTCCCACACCCACTGCCTCAGG - Intergenic
1116104443 14:40483273-40483295 CTTCCCACCATCAGTGGCTCTGG - Intergenic
1116770528 14:49122332-49122354 TTTCCCCCTCCCAGTTACTCTGG - Intergenic
1118357196 14:65024271-65024293 GGTCCCACCCATAGTGATTCCGG + Intronic
1120558136 14:85955678-85955700 GTTCTCACCCCCAGTGTTACTGG - Intergenic
1121475307 14:94195305-94195327 GGTCCCACCCCCAGAGATTCTGG - Intronic
1122049245 14:99043957-99043979 GTTCCCACCCCCAAAGAGACAGG + Intergenic
1122285449 14:100649077-100649099 GATCCCCACCCCAGTGAGTCTGG + Intergenic
1122623532 14:103072982-103073004 TGGCCCAGCCCCAGTGACTCTGG - Intergenic
1123805150 15:23863128-23863150 GTTCTCTCCCACACTGACTCTGG - Intergenic
1124198968 15:27660243-27660265 GTTCCCTCCCCCGGTGATTCTGG - Intergenic
1124646258 15:31439547-31439569 CTTCCCACCCACAGTGACCATGG + Intergenic
1125932684 15:43611650-43611672 GTAACCATCCTCAGTGACTCAGG + Intronic
1125945783 15:43711112-43711134 GTAACCATCCTCAGTGACTCAGG + Intergenic
1126097677 15:45100817-45100839 GCTCCCACCCCCAGGGACTGGGG - Exonic
1127583296 15:60357226-60357248 GTTCCCAGCCCCTGTGAACCAGG + Exonic
1127675977 15:61239405-61239427 GGTCCCACCCCCAGAGATTGTGG + Intergenic
1129603663 15:77014385-77014407 GTTCACACCTCCCGTGACCCTGG - Intronic
1129666014 15:77579741-77579763 TTTCCCAGCCCCAGTGAGCCTGG - Intergenic
1130681878 15:86004095-86004117 GTCTCCAGCCCCACTGACTCAGG + Intergenic
1130957886 15:88639860-88639882 GTTCCCCCACACAGTGACTTGGG + Intronic
1131047859 15:89327327-89327349 GTGTCCCCACCCAGTGACTCTGG - Exonic
1131356811 15:91752392-91752414 GTTCCCACCCACACTCACACAGG + Intergenic
1132184534 15:99792034-99792056 GGTCCCAGCCCCAGTGACTAGGG + Intergenic
1132432442 15:101772625-101772647 GGTCCCAGCCCCAGTGACTGGGG - Intergenic
1133247006 16:4455641-4455663 GCTCCCACCCGCAGAGCCTCTGG + Exonic
1133829667 16:9310086-9310108 GTCCCCACCCTCTGTGACACTGG + Intergenic
1134265601 16:12690170-12690192 GTACCCACCCCCGCAGACTCTGG - Intronic
1135751951 16:25065379-25065401 GTCCCCACCCCCAGAGATACGGG - Intergenic
1135898258 16:26430362-26430384 GATCCCACACCCACAGACTCTGG - Intergenic
1136176469 16:28520472-28520494 GGTCCCAGCTACAGTGACTCAGG + Intergenic
1136586408 16:31188548-31188570 GGTTCCACCCCCAGTGATTTAGG + Intronic
1137620933 16:49876413-49876435 CCTCCCACCCCCCGTGGCTCTGG - Intergenic
1138419869 16:56892271-56892293 GTTCCCAACTCCAGTTACTCAGG - Intronic
1138635066 16:58331640-58331662 GGCTCCACCCCCAGAGACTCAGG + Intronic
1139661527 16:68424145-68424167 GTTCCCACAGCCAGTGACCAGGG - Intronic
1140044759 16:71432975-71432997 TTTGCCACCCCCACTGAGTCAGG + Intergenic
1140424951 16:74853141-74853163 GTTCCCACCCCAACTCCCTCAGG + Intergenic
1141658809 16:85430641-85430663 GGTGCCACCCCCAGAGGCTCTGG + Intergenic
1143770878 17:9167950-9167972 GATCCCACCCCCAGAAATTCTGG + Intronic
1144208323 17:12994632-12994654 GTCCCCACCCTCAGAGTCTCTGG - Intronic
1144582458 17:16466596-16466618 CTCCCCACCAGCAGTGACTCAGG - Intronic
1147032178 17:37647736-37647758 ATTCCCACCCCCAGAAATTCTGG + Intergenic
1147553813 17:41463732-41463754 GGTCCCACCTCCAGAGACTCTGG + Intronic
1148049247 17:44761014-44761036 CACCCCACCCCCAGTGACTGCGG - Intronic
1148122772 17:45222324-45222346 GTCCCCGCCCCCGGGGACTCAGG + Intronic
1149002032 17:51767303-51767325 GTACTCATCCTCAGTGACTCTGG + Intronic
1149219866 17:54404315-54404337 GTTCTCACCTCCAATGCCTCTGG + Intergenic
1150542545 17:66118044-66118066 ATTCCCACCACCAGTGTCTAGGG - Intronic
1152097003 17:78278319-78278341 CTGCCCACCCCCAGGGCCTCAGG + Intergenic
1154496956 18:14968692-14968714 ATTCCCACCCACAGTGAATAAGG - Intergenic
1156355091 18:36333747-36333769 GATCCCACCCCCAGAGTTTCAGG - Intronic
1159958554 18:74537718-74537740 GTGCCCAGGCCCAGTCACTCCGG + Intronic
1160663291 19:311434-311456 GTTCCCTCCTCCAGGGACCCAGG - Intronic
1161591918 19:5132842-5132864 GTTCTCATCCCCAGGGCCTCGGG + Intronic
1161716755 19:5880593-5880615 GTCCTCACCCCCAGTGACACAGG + Intronic
1161995278 19:7707799-7707821 GACCCCACCCTCAGGGACTCAGG + Intergenic
1163366752 19:16879791-16879813 GTCCCCAGCCCCAGTCACTTGGG - Exonic
1164600492 19:29560205-29560227 GTGCCCTCCCACACTGACTCTGG - Intronic
1165349154 19:35267215-35267237 GGTCCCATCCCCTGGGACTCCGG - Exonic
1165386584 19:35513721-35513743 GTCCCTCCCCGCAGTGACTCAGG + Intergenic
1166407689 19:42532989-42533011 GTGCCCACCCACAGTGAGTGAGG - Intronic
1166423638 19:42656987-42657009 CATCCCACCTCCTGTGACTCTGG + Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1166775122 19:45307724-45307746 GTTCCCACGCCCTGTCCCTCCGG - Intronic
1167103567 19:47418486-47418508 GTTCCCATCCCCAGGGAGACAGG + Intronic
1167219275 19:48186923-48186945 TCCCCCACCCCCAGTGACTGGGG - Intronic
1167351152 19:48975552-48975574 GTCTCCACCCCCATTGACTGGGG - Intronic
1167587175 19:50381871-50381893 GTTCCCAGCCCCAGAGACTGTGG + Intronic
925759256 2:7168507-7168529 CTTCACACCCTCAGTGATTCTGG - Intergenic
926017670 2:9469128-9469150 GTTCCCACCCCTGGAGCCTCTGG + Intronic
926143358 2:10381801-10381823 GTTCCCACCAGCAGTGAGTGAGG - Intronic
926153931 2:10440158-10440180 GGTCCCACCACCAGAGGCTCTGG + Exonic
926582883 2:14650281-14650303 GTTCCCAGCTCCAGGAACTCAGG + Intronic
928571416 2:32613017-32613039 GTTCTCAACGCCAGTGACCCTGG + Intronic
929928997 2:46237725-46237747 GTCCCCACCCCCACAGACACAGG - Intergenic
931780332 2:65573787-65573809 GTTCCCATTCCCAGAGATTCTGG - Intergenic
933856963 2:86423954-86423976 GTTCCCACACACAGTGGCACAGG + Intergenic
934968362 2:98742910-98742932 GCTCCCAACCTCAGTGCCTCCGG - Intergenic
940261605 2:151785609-151785631 GTTGCTACCCCAAGTCACTCAGG - Intergenic
942856911 2:180559964-180559986 GTTCCCACCCTCTCTCACTCAGG + Intergenic
946225937 2:218264185-218264207 CTTTCCACCCCCAGAGACTTGGG + Exonic
946417959 2:219550052-219550074 GTTCACACCCCGAGTTCCTCAGG - Exonic
947578992 2:231300056-231300078 GTTCTCACCCCCAGTGACTCAGG + Intronic
947843155 2:233221817-233221839 GTGCCCACCCACAGTGAGTGTGG + Intronic
947874081 2:233457131-233457153 CTTCCCACCGCCAGGGGCTCAGG - Intronic
948516106 2:238504833-238504855 CTTCCCACCCCAAATGTCTCAGG + Intergenic
948771431 2:240253084-240253106 TTTCCCACTCCCAGAGCCTCCGG - Intergenic
1170055505 20:12198640-12198662 ATTCCCACCCACTCTGACTCTGG - Intergenic
1170694794 20:18648349-18648371 GGTCCCATCCCCAGAGAATCTGG - Intronic
1171945183 20:31370181-31370203 GTTCCTACCCCAAGGGATTCTGG + Intronic
1172971189 20:38874093-38874115 GTTCCCTCCCCCAGTGAACAGGG - Intronic
1173851455 20:46220929-46220951 ATTCCCTCCCACACTGACTCTGG + Intronic
1173910952 20:46670417-46670439 GTCCCCTCCCACACTGACTCTGG + Intronic
1174039858 20:47691458-47691480 GGGCCCACCCCCAGAGATTCTGG + Intronic
1179337711 21:40473661-40473683 GTCCCAACCCCCAGTACCTCGGG + Intronic
1179558123 21:42193714-42193736 GTTGCCACCTCCAGTGGCTCAGG + Intergenic
1181439087 22:22926652-22926674 GTCCCCTTCCCCACTGACTCTGG + Intergenic
1182451470 22:30424280-30424302 GTTCCCACCCCCTGAAACACCGG - Exonic
1182696372 22:32201823-32201845 GGCCCCACCCACAGTGACACAGG - Intronic
1182951495 22:34380477-34380499 GTTCCTTCCCACACTGACTCTGG + Intergenic
1183705055 22:39470949-39470971 GTGCCCACCCCCAATCTCTCAGG - Intronic
1184761939 22:46549870-46549892 GAACCCACCCACAATGACTCTGG + Intergenic
1185146579 22:49140209-49140231 TGTCCCACCCACAGGGACTCGGG + Intergenic
1185285078 22:49996482-49996504 GTTCCAACCGCCAGTGACTTGGG - Exonic
950452067 3:13071114-13071136 GGTCCCACCCCCAGACATTCTGG - Intronic
950842372 3:15979789-15979811 GTTCCCTCCCACATTGACTGTGG - Intergenic
954294150 3:49664895-49664917 ACCCCCACCCCCAGTGCCTCGGG - Intronic
954666672 3:52257606-52257628 GTGCCCAACCCCAGTGGCTCTGG + Intronic
956744009 3:72297260-72297282 GGCCCCACCCCCAGTCAGTCTGG - Intergenic
956941479 3:74166899-74166921 GTGCCTACCCCCAGTAACCCTGG - Intergenic
962385890 3:134932361-134932383 CTGCCCACCTCAAGTGACTCAGG + Intronic
963837989 3:150076372-150076394 GTTCCCTCTCCCATTGACTCTGG + Intergenic
963914217 3:150842571-150842593 ATTCTGGCCCCCAGTGACTCTGG - Intergenic
964166937 3:153719114-153719136 ATTCCCACCCCCAGACAGTCTGG - Intergenic
967990892 3:195129918-195129940 ATTCCCACCACCAGTGAGTGCGG + Intronic
968424527 4:513471-513493 CTTCCCACACCCCTTGACTCTGG - Intronic
968518912 4:1027024-1027046 GTTCTCAGCCCCTGTGGCTCTGG - Intergenic
968704954 4:2073410-2073432 CCTCCCAGCCCCAGTGGCTCTGG - Intronic
970396022 4:15666494-15666516 ATTCCCACCCCCACAGCCTCTGG - Intronic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
973805548 4:54522889-54522911 GTTCTCACCCCCAGTAGCTCAGG + Intergenic
978020503 4:103804776-103804798 ATTCCCACCACCAGTGTCTGAGG + Intergenic
978022574 4:103832004-103832026 GCTCCCAGCCTAAGTGACTCAGG - Intergenic
980991230 4:139740326-139740348 TTTCCCAGCCCTGGTGACTCAGG - Exonic
985150931 4:186946329-186946351 GCTCCCAAACCCAGTGCCTCTGG - Intergenic
985872949 5:2572246-2572268 CTTTCCATCCCCAGTGTCTCTGG - Intergenic
986711058 5:10488174-10488196 GTCCCAACCCCCAGTATCTCAGG + Intergenic
987244825 5:16038042-16038064 GGCCCCACCCACAGTGACTGTGG - Intergenic
987283941 5:16437641-16437663 TTTCCTACCCACAGGGACTCAGG - Intergenic
989112002 5:37915364-37915386 GGCCCCACACCCAGCGACTCAGG - Intergenic
993467368 5:88265590-88265612 GTTCCCAACCCCTGGGACTGTGG - Intronic
997720571 5:136075448-136075470 GTTCCCACCCCAGGTGATACAGG + Intergenic
998444760 5:142189962-142189984 GCTCCCACCCCCTTTGAATCTGG - Intergenic
998515582 5:142750848-142750870 CATCCCTTCCCCAGTGACTCAGG + Intergenic
998569484 5:143244572-143244594 GTTGCCTCTCCCAGTGACTCAGG + Intergenic
1001572128 5:172736832-172736854 CCCCCCACCCCCAGTGACTCTGG + Intergenic
1002343061 5:178529327-178529349 GTTCCCTCCCACACTGACTCTGG - Intronic
1002343068 5:178529367-178529389 GTTCCCTCCCACACTGACTCTGG - Intronic
1002447954 5:179301644-179301666 CTTCTCTCCCCCAGTTACTCAGG - Intronic
1002455792 5:179344941-179344963 GTCCCCACCCTCCGCGACTCAGG + Intronic
1003021728 6:2515556-2515578 GTTCCCACCCGCAAAGACGCAGG + Intergenic
1003173578 6:3738534-3738556 CAGCCCACCCCCAGTGACACAGG + Intronic
1004052801 6:12104689-12104711 GTTGCCACTCCCAGCTACTCAGG - Intronic
1004351794 6:14896615-14896637 GATCCCTCCCACACTGACTCTGG + Intergenic
1004613645 6:17269213-17269235 CATCACCCCCCCAGTGACTCTGG + Intergenic
1005273173 6:24187672-24187694 GTTCCCAACACCACTGACTCTGG + Intronic
1006099964 6:31680496-31680518 GTTCGCACCCACAGCCACTCTGG + Intronic
1006801932 6:36765224-36765246 GCTCCCCCCCGCAGTGGCTCTGG - Intronic
1007495526 6:42257850-42257872 TTTCTCATCCCCAGTGACACAGG - Intronic
1007723299 6:43898906-43898928 CTTCCCTCCCACAGTAACTCTGG + Intergenic
1009446588 6:63749752-63749774 TTCCTGACCCCCAGTGACTCTGG - Intronic
1020107488 7:5428819-5428841 GTTCCCACCCTCCGTGCCGCTGG + Intergenic
1022136917 7:27457664-27457686 GTTCCCTCTGTCAGTGACTCTGG + Intergenic
1022206707 7:28171496-28171518 GTTTCCTCCCCCAGAAACTCAGG - Intronic
1024519742 7:50294587-50294609 GTTCCCACCCCAAGTTACAGAGG + Intergenic
1025212969 7:57031549-57031571 GTTCCTACCCCCAGGAGCTCAGG - Intergenic
1025658984 7:63545275-63545297 GTTCCTACCCCCAGGAGCTCAGG + Intergenic
1026926225 7:74195785-74195807 GTTCCCTCTGTCAGTGACTCTGG - Exonic
1028423567 7:90660969-90660991 GTTTCTACCTCCTGTGACTCAGG - Intronic
1029676094 7:102069953-102069975 GTTCCTACCCCCAGAAGCTCAGG - Intronic
1031979608 7:128116189-128116211 GCTCCCACCTCCAGTCACTCCGG - Intergenic
1032519129 7:132529528-132529550 CACCCCACCCCCAGTAACTCTGG + Intronic
1032737229 7:134703501-134703523 GGTCCCATCCCCAGTGGCCCTGG - Intergenic
1034561473 7:151882306-151882328 GTTCCCAACCTCAGTGACAGTGG + Intergenic
1036275518 8:7348459-7348481 CTTCCCACCCCCTGTGTTTCTGG - Intergenic
1037553903 8:20003919-20003941 GTTCCTACCCACACTGACTCTGG - Intergenic
1037768108 8:21784114-21784136 GTCCACACCCACAGTGCCTCAGG + Intronic
1038475456 8:27863219-27863241 TTTGCCACCCCTAGAGACTCAGG - Intergenic
1038893234 8:31751362-31751384 GTTCCCTCCCCTTGTTACTCAGG - Intronic
1041033982 8:53768317-53768339 GTTCCCACCAACAGTGAATGAGG - Intronic
1041391729 8:57353093-57353115 GTTGCCTCCCCCATTGACACCGG - Intergenic
1042167151 8:65957148-65957170 ATACCCGGCCCCAGTGACTCGGG + Intergenic
1042760845 8:72269961-72269983 GTTCCCACCCTCATTGGATCAGG - Intergenic
1044785573 8:95788848-95788870 GTTCCCTCCCTCATTGATTCTGG - Intergenic
1046092739 8:109522305-109522327 CTCCCCAGCCCAAGTGACTCTGG + Exonic
1051504497 9:17812411-17812433 GTTCCAACCAGCAGTGCCTCTGG - Intergenic
1051741581 9:20257804-20257826 GTTCCCATCCCCTGAGCCTCTGG + Intergenic
1052965185 9:34335156-34335178 GGTCCCAAGCTCAGTGACTCAGG - Intronic
1056918600 9:90765530-90765552 GTTCCCACCCACACTGGATCAGG + Intergenic
1057473560 9:95379915-95379937 GGACCCACCAGCAGTGACTCGGG - Intergenic
1057880110 9:98786882-98786904 GTCCTGACACCCAGTGACTCTGG + Intronic
1060020949 9:120130625-120130647 GTCCCCACCCACAGTGACTCTGG - Intergenic
1061568615 9:131461424-131461446 ATTGCCACACCTAGTGACTCTGG + Intronic
1062210489 9:135361000-135361022 CTTCCCACCCCCAGTCAGCCAGG + Intergenic
1187124764 X:16444860-16444882 GTCCCCTCCCACATTGACTCTGG - Intergenic
1187686120 X:21817444-21817466 GTTCCCACTCCCACTCACCCTGG - Intergenic
1187761070 X:22585962-22585984 GTGCCCACCCACAGTGACCCTGG + Intergenic
1189283803 X:39837876-39837898 GTTCCCTCCCACACTGACTGTGG - Intergenic
1189976173 X:46462972-46462994 GTTACCACCCTCAGTGAGTTTGG + Intronic
1189982897 X:46528663-46528685 GTTACCACCCTCAGTGAGTTTGG - Intronic
1190025539 X:46918908-46918930 GTCACCACCCACAATGACTCTGG - Intronic
1190386494 X:49886830-49886852 GGTCCCACCCCCAGAGTTTCTGG + Intergenic
1193326175 X:80180767-80180789 GTTCCCACCCCCAGTTGATCAGG - Intergenic
1195106660 X:101609484-101609506 GTCCCCTCCCGCATTGACTCTGG - Intergenic
1195277851 X:103299675-103299697 GTTCCCACCCACACTGGATCAGG + Intergenic
1196746206 X:119073422-119073444 GTTCCCACCCCCGGGGGCTGCGG - Intergenic
1196815949 X:119665747-119665769 CAGCCCACCCCAAGTGACTCAGG + Intronic
1197180078 X:123525511-123525533 GTTCCCTCCCACATTGACTCTGG + Intergenic
1201490857 Y:14540002-14540024 GGTCCCATCCCCACTGAGTCCGG + Intronic