ID: 1104727389

View in Genome Browser
Species Human (GRCh38)
Location 12:131086364-131086386
Sequence GCCCAGGAATGCAGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 369}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104727382_1104727389 12 Left 1104727382 12:131086329-131086351 CCATCCTGGGAGACTTTTCCTAT 0: 1
1: 0
2: 0
3: 22
4: 241
Right 1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG 0: 1
1: 0
2: 1
3: 36
4: 369
1104727386_1104727389 -6 Left 1104727386 12:131086347-131086369 CCTATTCCAGAAAGAGGGCCCAG 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG 0: 1
1: 0
2: 1
3: 36
4: 369
1104727380_1104727389 19 Left 1104727380 12:131086322-131086344 CCTTCTCCCATCCTGGGAGACTT 0: 1
1: 0
2: 2
3: 17
4: 278
Right 1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG 0: 1
1: 0
2: 1
3: 36
4: 369
1104727383_1104727389 8 Left 1104727383 12:131086333-131086355 CCTGGGAGACTTTTCCTATTCCA 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG 0: 1
1: 0
2: 1
3: 36
4: 369
1104727377_1104727389 29 Left 1104727377 12:131086312-131086334 CCTAGCTTCGCCTTCTCCCATCC 0: 1
1: 0
2: 4
3: 78
4: 329
Right 1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG 0: 1
1: 0
2: 1
3: 36
4: 369
1104727381_1104727389 13 Left 1104727381 12:131086328-131086350 CCCATCCTGGGAGACTTTTCCTA 0: 1
1: 0
2: 1
3: 33
4: 215
Right 1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG 0: 1
1: 0
2: 1
3: 36
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104727389 Original CRISPR GCCCAGGAATGCAGCCTCCC AGG Intronic
900172134 1:1274220-1274242 GCCCGGGCATGGAGCGTCCCGGG + Intergenic
900226461 1:1535546-1535568 GCCCGGGAGTGCTGCCGCCCTGG - Intronic
900710916 1:4113217-4113239 GCCTTGAAATGCTGCCTCCCAGG - Intergenic
900762313 1:4481631-4481653 CCCCACGACTGCAGCCTCCAGGG + Intergenic
900986982 1:6078832-6078854 GATCAGAAATGCGGCCTCCCAGG - Intronic
900987714 1:6082903-6082925 GCCCAGGCCTGCAGCCTGCCCGG - Intronic
901678868 1:10901811-10901833 GCCCAGGCATGTGGCTTCCCTGG + Intergenic
902042900 1:13505497-13505519 GCCAAGGAATGCACACTCCTAGG - Intronic
902466870 1:16624021-16624043 GCCCTGGGACTCAGCCTCCCTGG + Intergenic
902507730 1:16948753-16948775 GCCCTGGGACTCAGCCTCCCTGG - Intronic
902686452 1:18080634-18080656 GCCCAGGAAAGCAGCGAGCCGGG - Intergenic
903789026 1:25880097-25880119 GCCCAGGAATCCAGGCTTGCTGG - Intergenic
903933305 1:26877050-26877072 GCCCAGGAATCCTGACGCCCAGG - Exonic
904056204 1:27671997-27672019 ACCCAGGAGTGCTGCCTCCCAGG + Intronic
905300016 1:36980609-36980631 GCCCAGGCCTGCAGCATCCCAGG - Intronic
905675867 1:39824682-39824704 GCCGAGGAATGCAGGCCACCTGG + Intergenic
906106290 1:43294864-43294886 GCAGATGAAAGCAGCCTCCCTGG + Intergenic
906684594 1:47755403-47755425 ACCCAGGAGTCCAGACTCCCAGG - Intergenic
908555715 1:65254748-65254770 GCCTAGGCATCCAGGCTCCCAGG - Intronic
908823503 1:68112425-68112447 GCCCAGGTGTCCAGCCTCCACGG + Intronic
909585191 1:77281751-77281773 GCCCAGGGATGCAGCTACCGGGG - Intergenic
910414283 1:86981727-86981749 GCCCAGGAAAGCAGCCACAAGGG - Intronic
910522049 1:88134069-88134091 GCCCAAGAATGCAATCTACCAGG + Intergenic
910744931 1:90563073-90563095 GCCCAGCAGAGCAGCCTCCATGG + Intergenic
911890941 1:103371204-103371226 GCCCAGGAACCCAGCCTCTTGGG - Intergenic
912472044 1:109912660-109912682 GCTCAGGAAGACAACCTCCCTGG - Intronic
912823094 1:112882935-112882957 GCCCAGGAATGGAAGCTCCTGGG - Intergenic
913062808 1:115223408-115223430 GGCAAAGAAAGCAGCCTCCCTGG - Intergenic
915224354 1:154401739-154401761 GTGGAGGAATGCAGCATCCCTGG - Intergenic
915733467 1:158070115-158070137 GCTGAAGAGTGCAGCCTCCCAGG + Intronic
916998135 1:170323909-170323931 GCCTAGGAATACAGCCAGCCAGG - Intergenic
919772372 1:201170875-201170897 GACCCGGAGTGGAGCCTCCCGGG - Intronic
920229914 1:204463445-204463467 TCTCTGGAAAGCAGCCTCCCTGG - Intronic
920766657 1:208840123-208840145 GCCCAGGAAATGAGCCTCCCTGG + Intergenic
922153311 1:223022890-223022912 CCCCAGGGTTGCAGCTTCCCAGG + Intergenic
922797671 1:228348954-228348976 GCCAAGGAATGCTTCCTTCCCGG - Intronic
923892949 1:238235831-238235853 GACAAGGAATGCAGGCTGCCTGG + Intergenic
924518974 1:244789223-244789245 GCTCAGAAATGCCGGCTCCCAGG + Intergenic
924539082 1:244964229-244964251 GCCCACAAATGCTGCCACCCGGG + Intergenic
1063122849 10:3116817-3116839 TCCCAAGAATGGAGCCTCCTTGG - Exonic
1063418119 10:5889905-5889927 GCCCAGGAACGCCGGCCCCCAGG - Intronic
1063432292 10:6000805-6000827 GCCCAGGAAGGCTGCCTTGCAGG + Intergenic
1063970793 10:11380025-11380047 GGCCAGGAGTGCAGCCAGCCAGG - Intergenic
1065286914 10:24195191-24195213 TCCCTGGACTGCAGCATCCCTGG + Intronic
1067568239 10:47353250-47353272 GCCCAGGAAAGCAGGCGCCATGG - Intronic
1067790123 10:49281571-49281593 GCCCAGGCCTGCAGGGTCCCTGG + Intergenic
1069858798 10:71457476-71457498 GCCCTGCAATGCTGCCTCCCAGG + Intronic
1069882601 10:71603097-71603119 GCCCAGGGATGAAGCTTCTCGGG - Intronic
1072566206 10:96618859-96618881 CAGCAGGACTGCAGCCTCCCAGG + Intronic
1072616063 10:97049532-97049554 ACCCAGGACTGCAGGCGCCCAGG + Intronic
1074134998 10:110618297-110618319 GCCCAGGAGAGCTGCCTCCAGGG - Intergenic
1074426322 10:113354650-113354672 ACACAGGCATGGAGCCTCCCAGG - Intergenic
1075173967 10:120142619-120142641 GCCCAAGAATACAGACTCCGTGG + Intergenic
1075405401 10:122192451-122192473 GCCCAGGAATGCAGAAGCCAGGG + Intronic
1075709278 10:124522102-124522124 CCCCAGGAAAGCATCATCCCCGG + Intronic
1076357554 10:129864162-129864184 GCCAAGGAAGGCATCCTACCTGG + Intronic
1076498685 10:130917083-130917105 GCCAAGGAATGCAGCAGCCATGG + Intergenic
1076499922 10:130929282-130929304 GACAAGGAGAGCAGCCTCCCAGG - Intergenic
1076522736 10:131091047-131091069 GACCAGGAATTGAGTCTCCCTGG + Intergenic
1077018789 11:408284-408306 GCCCAATTCTGCAGCCTCCCTGG - Intronic
1077225589 11:1437852-1437874 GCCCAGGAAGGCAGGCAGCCTGG - Intronic
1077485059 11:2834807-2834829 CCCCAGGAATGCAGGTTCCGGGG + Intronic
1078456170 11:11477237-11477259 GCCCAGGAAGGCATCTTTCCAGG + Intronic
1078547945 11:12259876-12259898 ACCCTGGAAGGCAGCCCCCCAGG + Exonic
1079584473 11:22108695-22108717 GCTCAGGTATGCTGTCTCCCTGG - Intergenic
1082996692 11:59261163-59261185 ACCCAGGCGTCCAGCCTCCCAGG - Intergenic
1083174256 11:60939386-60939408 CCCCAGGGATGCAGCCCCCAGGG - Intronic
1083343137 11:61971894-61971916 TCCCAGGACAGCCGCCTCCCAGG + Intergenic
1083858259 11:65404589-65404611 GCCCAGGAAGGCTGACTCCATGG - Intronic
1084771219 11:71343957-71343979 GGCTAGAAATACAGCCTCCCTGG + Intergenic
1084931853 11:72562196-72562218 CCCTAGGAATACTGCCTCCCAGG - Intergenic
1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG + Intergenic
1087932984 11:103999727-103999749 GCACAGGTATCCAGCATCCCAGG - Intronic
1088830174 11:113530186-113530208 GCACAGGAATACAGCTTCCCTGG + Intergenic
1088897559 11:114089908-114089930 GCCCCTGCTTGCAGCCTCCCTGG + Intronic
1090419547 11:126564761-126564783 AGGCAGGAATGCAGCCTTCCAGG + Intronic
1090993748 11:131845467-131845489 GCCCAGAAATGCAGAGTCTCAGG + Intronic
1091026190 11:132143272-132143294 TGTCAGAAATGCAGCCTCCCAGG + Intronic
1091356268 11:134940158-134940180 GCCCAGGCAAGCAGCCCACCAGG - Intergenic
1091394113 12:143135-143157 GCCCATACACGCAGCCTCCCAGG - Intronic
1091591799 12:1846809-1846831 TCCCAGGAACCCAGCCTTCCTGG - Intronic
1091611477 12:2014096-2014118 GACCAGGACTGCAGCCAGCCAGG + Intronic
1092095295 12:5837189-5837211 ACCCAGGAGTGCAGCATCCACGG + Intronic
1092243317 12:6849009-6849031 CCCCAGCAATGCAGTCACCCAGG - Exonic
1093468111 12:19471326-19471348 GCCCAGGAATGAGGCCAGCCTGG - Intronic
1095633004 12:44399938-44399960 GCCCAGGGACACAGTCTCCCTGG + Intergenic
1096086617 12:48869374-48869396 ACCCTGAAATGCAGCCACCCAGG - Intergenic
1096304653 12:50463707-50463729 GCCCATGAGAGCAGCCTCCAGGG - Intronic
1096614909 12:52826742-52826764 GGGCAGGAAGGCAGCCTCCATGG - Intronic
1096978803 12:55716667-55716689 GCCCAGGACTCCTGACTCCCAGG - Intronic
1098578420 12:72070738-72070760 GCCCAGGAAAGCAGCCTGGAGGG - Intronic
1098988933 12:77043637-77043659 GCCCAGGAGTGCAGCCTGGCAGG - Intronic
1101999045 12:109545269-109545291 GCCCAGGAAGCCAGACTGCCAGG + Intergenic
1102587532 12:113933578-113933600 GCCCTGGAAAGCAGCCCCTCTGG + Intronic
1103059500 12:117847432-117847454 GCCCAGGCAGGCAAGCTCCCAGG + Intronic
1103705374 12:122868365-122868387 GGCCAGGAGTGGTGCCTCCCAGG - Intronic
1104371612 12:128228582-128228604 GCCCAAGGATGCAGCTTCCCTGG + Intergenic
1104619588 12:130301343-130301365 GCCCACGAGTCCTGCCTCCCTGG + Intergenic
1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG + Intronic
1104775290 12:131387193-131387215 GCCCAGGAATGAGCTCTCCCGGG - Intergenic
1104906614 12:132216818-132216840 GCCCAGAAACGCCGCCTCACAGG - Intronic
1104946055 12:132415332-132415354 CGTCAGGAATGCAGACTCCCTGG - Intergenic
1105767961 13:23579496-23579518 GCCCGGACCTGCAGCCTCCCAGG + Exonic
1106107794 13:26749342-26749364 GCTCTGGAAGGCAGACTCCCTGG - Intergenic
1106339365 13:28814406-28814428 GCCCAAGAATACACCTTCCCTGG + Intergenic
1107079851 13:36363061-36363083 TTCCAGAAATGCAGCCTCTCAGG - Intronic
1108055360 13:46479853-46479875 GGCCAGGAATCCAGCCACCTGGG + Intergenic
1109476117 13:62882283-62882305 GCCCATGAAAGCAGCCTCAAGGG - Intergenic
1113643550 13:111976034-111976056 GCCCAGGCCTCCAGTCTCCCTGG - Intergenic
1113931638 13:113971917-113971939 GCCCAGGAGCGCATCCTCCCTGG - Intergenic
1115325046 14:32128589-32128611 GCCCAGGGAGGCAGCGTCCATGG - Intronic
1115692734 14:35861725-35861747 CACCAGGAATGCAGCCTACATGG + Intronic
1117500213 14:56343901-56343923 ACCCAGCAATGCTGACTCCCAGG - Intergenic
1118321326 14:64754929-64754951 ACCAAGGAAGGCAGCCTCACTGG + Intronic
1118499464 14:66345260-66345282 GCCTAGAAATGCAGCCTTTCTGG - Intergenic
1119445701 14:74661741-74661763 CCACAGGGATGCAGCTTCCCTGG + Exonic
1121618754 14:95331842-95331864 GGGCAGGCCTGCAGCCTCCCAGG - Intergenic
1122236461 14:100333190-100333212 GCCCAGGCCTCCAGCCTCCAGGG + Intergenic
1122556659 14:102584219-102584241 GCCCAGGTATCCCACCTCCCAGG + Intergenic
1122801322 14:104231090-104231112 GCTCAGGTCTGCAGCTTCCCAGG + Intergenic
1122866725 14:104609083-104609105 ACCCAGGAATGCAACCTCGGTGG + Intergenic
1124633655 15:31351664-31351686 GCCCAGGTATGCACCCTGGCAGG + Intronic
1124656242 15:31510169-31510191 GGCCAGGACTGCAGCCGGCCGGG - Intronic
1125241529 15:37582315-37582337 GCACAGGAATGCAGGCACCATGG + Intergenic
1126490612 15:49231880-49231902 GCCCATGAAAGCAGCCTCAGGGG - Intronic
1126518643 15:49563262-49563284 ACCCAGGAATGCAGCTAACCAGG + Intronic
1126911126 15:53418159-53418181 GCCCAGAGATGCAGAATCCCTGG - Intergenic
1129701445 15:77770819-77770841 GCCCTGGATGGCAGCCTGCCAGG - Intronic
1131096118 15:89655283-89655305 TCCCAGGAGTGCCGGCTCCCAGG + Intronic
1132663595 16:1072076-1072098 TCTCAGGAATGCAGATTCCCAGG + Intergenic
1132899695 16:2246503-2246525 TCCCAGGAAGGCGGTCTCCCAGG + Intronic
1132945327 16:2529012-2529034 GTGCAGGGATGCAGCCTCCAGGG - Exonic
1133270260 16:4607872-4607894 TCCCAGGAATGGGCCCTCCCAGG - Intergenic
1133597246 16:7304503-7304525 CCCCAGGAAAGCAGCCACCGAGG - Intronic
1133926893 16:10200563-10200585 GCCCAGGAAAAAAGCATCCCTGG + Intergenic
1134103733 16:11470806-11470828 GCCCAGGAAGGCTGCCTCTGAGG + Intronic
1134208953 16:12259948-12259970 CCCCATGAATGCAGCCGCTCAGG + Intronic
1134776539 16:16858484-16858506 GACCAAGAATGCAGCCTGTCAGG - Intergenic
1135396076 16:22132619-22132641 TGCCAGAAATGCAGACTCCCAGG - Intronic
1136103300 16:28011010-28011032 TCCAAGGAGTGCAGCCTGCCCGG - Intronic
1136285151 16:29236401-29236423 GCCCAGGCCTGCAGCCCCCAGGG + Intergenic
1136458995 16:30398400-30398422 CCCCAGGACTTCAGCTTCCCAGG + Exonic
1137585477 16:49661748-49661770 CCCCCGGAATGCAGCCTCCATGG - Intronic
1137592087 16:49699953-49699975 GGCCAGGATATCAGCCTCCCTGG + Intronic
1137720261 16:50623501-50623523 GCCCAGGCATCCTGCCTCCCTGG + Intronic
1139916499 16:70431444-70431466 GCCCCGCAATGCCACCTCCCAGG + Intronic
1140141651 16:72264044-72264066 GCCTAGAAATGCAGCCTTCGGGG - Intergenic
1140503723 16:75456659-75456681 GCCCAGAGACGCACCCTCCCTGG + Intronic
1140511018 16:75508631-75508653 GCCCAGAGACGCACCCTCCCTGG + Intergenic
1142090214 16:88206025-88206047 GCCCAGGCCTGCAGCCCCCAGGG + Intergenic
1142427776 16:90009743-90009765 GCACTGGAATGCAGCCACGCGGG - Intronic
1142762278 17:2049781-2049803 GCGCAGGGAGGCGGCCTCCCGGG - Intergenic
1143563664 17:7709174-7709196 CACCAGCAATGCAACCTCCCGGG + Exonic
1144499253 17:15771002-15771024 GCCCATCGATGCAGCCTCCAGGG + Intergenic
1145162644 17:20586035-20586057 GCCCATCGATGCAGCCTCCAGGG + Intergenic
1145276699 17:21435698-21435720 GTCAAGTGATGCAGCCTCCCGGG - Intergenic
1145817221 17:27804289-27804311 GGCCAGGAATGCGGCCTGCTGGG - Exonic
1145911762 17:28547256-28547278 GCCCAGAACTGGAGCCTCCTGGG + Exonic
1147036796 17:37687579-37687601 GGCCAGGAAAGCCGGCTCCCGGG - Intronic
1147560697 17:41507229-41507251 GACCCTGAATGCAGACTCCCAGG + Intergenic
1147572399 17:41579503-41579525 GAACAGGAATGAAGCCACCCAGG + Intergenic
1147911078 17:43856636-43856658 GACCAGGAATGCTCCCACCCTGG - Intronic
1148502357 17:48101348-48101370 GCCCAGGAAGGCAGCAAGCCGGG + Intronic
1148617692 17:49013456-49013478 TCTAAGGAATGCCGCCTCCCGGG + Intronic
1149526271 17:57358285-57358307 GCCCATGAATGCAACCACCCAGG - Intronic
1150592830 17:66578360-66578382 GCCAAGGACTTCAGGCTCCCTGG - Intronic
1150641900 17:66954951-66954973 GCCCAGCAAGGCAGCCGGCCAGG + Intergenic
1150940189 17:69684666-69684688 TCCCAGGAATGAAGCCTACTTGG + Intergenic
1152747376 17:82047663-82047685 GCTCAGGAAGGCGGCCTCTCAGG + Intergenic
1152805879 17:82356071-82356093 GCCCAGGAAGGCACCAGCCCAGG + Intergenic
1153924106 18:9817952-9817974 TCCCATGCATCCAGCCTCCCTGG + Intronic
1155191686 18:23436450-23436472 GTCCATAAATGCAGCCTTCCTGG - Intronic
1156503723 18:37575960-37575982 CCCCAGCAAGGCAGGCTCCCAGG - Intergenic
1157425437 18:47580560-47580582 GGCCAGGAAGGGGGCCTCCCTGG + Intergenic
1157483652 18:48072405-48072427 GCCAATGGATGCAGCCACCCAGG - Intronic
1160936520 19:1598756-1598778 GCCCAGGACAGCAGCCTGGCAGG + Intronic
1161080960 19:2309928-2309950 GGCCTGGCCTGCAGCCTCCCAGG - Intronic
1161293200 19:3506608-3506630 CCCCTCGAATGCCGCCTCCCAGG + Intronic
1161854208 19:6754269-6754291 GCCCATGACTGCAGCCAGCCCGG + Exonic
1162333628 19:10046463-10046485 GTCCAGGAAAGCAGCCACACAGG - Intergenic
1162800271 19:13106282-13106304 GCCCAGGAATGAAACCAGCCTGG - Intronic
1163117519 19:15197496-15197518 TCACAGGCAGGCAGCCTCCCGGG + Exonic
1163598475 19:18233912-18233934 GCCCAGGAAGGTAGGCTCCGCGG + Intronic
1165454398 19:35902376-35902398 GACCAGGCCAGCAGCCTCCCTGG + Intergenic
1166916188 19:46197319-46197341 GAACAGGCATGCAGCCCCCCAGG - Intergenic
1167264891 19:48478590-48478612 GCCCAGGAGTCCAGGCTCACTGG - Exonic
1167752161 19:51387770-51387792 ACCCAGGAATCCAGGCTCCTGGG - Intronic
1168077681 19:53990369-53990391 GACCAGGAGTCCAGGCTCCCCGG + Intergenic
1168239969 19:55083983-55084005 GCCCAGGCATGGTGCTTCCCAGG - Intronic
1168294910 19:55373620-55373642 ACCCAGGAGTCCAGGCTCCCAGG + Intergenic
925180550 2:1814369-1814391 GCCCTGGAGCGCAGCCTCCCGGG + Intronic
925772527 2:7297437-7297459 GCGGAGGAATGCTGCCACCCGGG - Intergenic
927495149 2:23546979-23547001 GCCCAGGAGGACAGCCTGCCAGG + Intronic
928181005 2:29068660-29068682 GCCCAGGCATGCAGCCGCAATGG - Intronic
928461773 2:31481037-31481059 GCCCAGGAATACAGCTAACCAGG - Intergenic
928922596 2:36541102-36541124 GGACAGGAATACAGCCTTCCTGG - Intronic
930914007 2:56665613-56665635 GCCCAGGCAGGAAGCCTCTCCGG - Intergenic
931805386 2:65798809-65798831 GCCCAGACATGCAGGCTCTCAGG - Intergenic
932338941 2:70947655-70947677 GCACAGGAATGCTGCCTCTAAGG - Intronic
932585942 2:73028991-73029013 GCCCATAAATGCAGACTGCCAGG - Intronic
932976004 2:76600338-76600360 GCTAAAGACTGCAGCCTCCCAGG - Intergenic
933642158 2:84775345-84775367 TCCCAGGAATGAAGCCTACTTGG + Intronic
934229456 2:90165182-90165204 ACCCAGGAAAGCAGCCACTCTGG - Intergenic
936089337 2:109490829-109490851 GCACAGGAAGGCAGGCTCCTTGG + Exonic
938662790 2:133504749-133504771 CCCCAGGAATGCACCAACCCTGG - Intronic
940131737 2:150389511-150389533 CAGCAGGAATGCAGCATCCCAGG + Intergenic
940923870 2:159342098-159342120 ACCTAGGAATGCAGCCAACCAGG + Intronic
941588316 2:167387073-167387095 GACCAGCAATGAAGACTCCCTGG - Intergenic
942346169 2:175005047-175005069 GTCCCGGCCTGCAGCCTCCCCGG - Exonic
943489855 2:188537519-188537541 TCCCAGGAATGAAGCCTTCTTGG + Intronic
946621650 2:221569898-221569920 CCCCAGGAATTCAGACTCCCCGG - Intronic
947588989 2:231373992-231374014 GCCCAGGAGTGTACTCTCCCAGG - Intronic
947715254 2:232335972-232335994 CCCCAGCACTGCAGCCTCCCGGG + Intronic
947720764 2:232368045-232368067 CCCCAGCACTGCAGCCTCCCGGG + Intergenic
947723372 2:232382101-232382123 CCCCAGGAAGGGAGCCTGCCTGG - Exonic
947734304 2:232446762-232446784 CCCCAGCACTGCATCCTCCCGGG + Intergenic
947753364 2:232544256-232544278 GCCCCGGTATGCTGCCTCCATGG + Intronic
948199570 2:236119975-236119997 GCCCAGAAATGCAGATTCTCAGG - Intronic
948269497 2:236663458-236663480 GTCCACGAACGCAGCCTCCCTGG + Intergenic
948416064 2:237805261-237805283 GCCTAGGAATACAGCTTACCAGG + Intronic
948458994 2:238120213-238120235 GCCCAGGAGTGCCGGCTGCCTGG + Intronic
948803152 2:240441887-240441909 GCCCAGAGCTGCAGCCTCCTTGG + Intronic
948887262 2:240890503-240890525 GCCCAGGGCGGCAGCCTCCAGGG + Intronic
948988664 2:241541134-241541156 GCCAAGGAAAGCAGCAGCCCCGG + Intergenic
1169529723 20:6472007-6472029 GGCCAGAAATGCAGACTCCTAGG - Intergenic
1169566005 20:6854343-6854365 GCCCAGGAATTCAGCCTGTTAGG + Intergenic
1169980593 20:11379830-11379852 ACCAAGGAATCCAGCCTCTCTGG - Intergenic
1170585783 20:17732917-17732939 GCCCACGACTCCAGCTTCCCTGG + Intronic
1171059691 20:21944334-21944356 GACCAGGACTGCTGCCTCCAGGG + Intergenic
1171116065 20:22525870-22525892 GCCCTTGAGTGCAGCCTCCTTGG + Intergenic
1171521153 20:25774899-25774921 GCCCTGGTCTGCAGCCTTCCTGG + Exonic
1171555770 20:26081579-26081601 GCCCTGGTCTGCAGCCTTCCTGG - Intergenic
1172656812 20:36542675-36542697 GCCCAGGAATCCTGTCTTCCAGG + Intronic
1172697827 20:36834552-36834574 GGCCAGGATCTCAGCCTCCCAGG - Intronic
1173732173 20:45336653-45336675 GCCCTGGAGTGTAGCATCCCAGG - Intronic
1174587186 20:51618411-51618433 GCTCAAGAGTGCAGCCTTCCAGG - Intronic
1174956724 20:55106054-55106076 GCCCATGCATGCTGCCTTCCAGG - Intergenic
1175684898 20:61021742-61021764 ACCCTGGAATGCAGATTCCCTGG - Intergenic
1176098403 20:63354258-63354280 CCCCAGGACTACAGCCCCCCAGG - Intronic
1176167581 20:63682099-63682121 TCCCTGGAATACAGCTTCCCAGG + Intronic
1176246694 20:64100799-64100821 CCCCAGGGTTGCAGCCTCCTGGG - Intergenic
1176884171 21:14234254-14234276 TCCCAGGAATGCTTCCTCCGTGG - Intergenic
1178093851 21:29193213-29193235 GCCAGGGAAAGCAGCCTCCTGGG + Intergenic
1179545568 21:42110698-42110720 GCCCATGTTTGCAGCCTCCCCGG - Intronic
1180798146 22:18617749-18617771 GCCCAGGAACCCAGACTCCATGG - Intergenic
1181223572 22:21377517-21377539 GCCCAGGAACCCAGACTCCATGG + Intergenic
1181255170 22:21558105-21558127 GCCCAGGAACCCAGACTCCGTGG - Intronic
1181444089 22:22955579-22955601 GCCCACGCATGCTGCCTGCCTGG - Intergenic
1181668501 22:24414368-24414390 GGCCAAGAATGCTTCCTCCCTGG - Intronic
1182550551 22:31098772-31098794 GCCCAAGACCTCAGCCTCCCAGG + Exonic
1182758442 22:32700301-32700323 GCCTTGGACAGCAGCCTCCCTGG + Intronic
1182849055 22:33455822-33455844 GCACAAGAATGCAGACTCCGAGG - Intronic
1183069728 22:35387695-35387717 GCCCAAGAATTCATCCTTCCAGG - Intronic
1183308306 22:37095816-37095838 GGCCTGGCAGGCAGCCTCCCCGG + Intronic
1183321471 22:37167484-37167506 GCCCAGGCCTGCGGCCTCTCTGG + Intronic
1183932144 22:41241176-41241198 GCCCAGGACTGCTGACTCCCGGG - Intergenic
1184646485 22:45898033-45898055 GCCAAGGAATATCGCCTCCCAGG + Intergenic
1184750818 22:46485484-46485506 GGCCCCGCATGCAGCCTCCCAGG - Intronic
1184889560 22:47371516-47371538 CCCCAGCACTGCACCCTCCCAGG + Intergenic
1184978792 22:48081562-48081584 GCTCATGCAGGCAGCCTCCCAGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG + Intergenic
952605928 3:35146458-35146480 GCCCAGGAAACCATCCTCCAAGG + Intergenic
952919610 3:38275700-38275722 CCACAGGGCTGCAGCCTCCCTGG + Intronic
953296098 3:41718641-41718663 GCCCTGTAAGGCAGTCTCCCTGG + Intronic
953349799 3:42206959-42206981 GCCCAGACCTCCAGCCTCCCTGG + Intronic
953875333 3:46663459-46663481 GCCCAGGCATGCTGTCACCCAGG + Intergenic
954660581 3:52224793-52224815 GCCCAGGCCGGCTGCCTCCCAGG + Intronic
954813383 3:53261829-53261851 ACTCAGGAATGCAGCTGCCCAGG - Intergenic
955984096 3:64555430-64555452 GCCCCGGGAGGCAGCCTCCATGG + Intronic
960013027 3:112853902-112853924 ACCTAGGAATGCAGCTACCCAGG + Intergenic
962065340 3:131973921-131973943 GCCCAGGAATGCAGACTTTGTGG - Intronic
966941546 3:184751019-184751041 ACCCAGGAAGGCAGGTTCCCCGG - Intergenic
967166521 3:186784232-186784254 GCCCGGAAAGGCAGCCCCCCAGG - Intronic
967556175 3:190861782-190861804 GGGCAGGTATGCAGCCTTCCTGG + Intronic
967965753 3:194959042-194959064 GTCAAGGGATGCAGGCTCCCAGG + Intergenic
968187180 3:196640786-196640808 TCCTAGGAATGGAGCCTCTCCGG + Intronic
968741129 4:2332279-2332301 GCCCAGGAATGCAGGCTAGAGGG + Intronic
968922138 4:3527758-3527780 GCCCAGGACTTCAGCAGCCCTGG - Intronic
968983521 4:3863500-3863522 GCCCAGGAAGGCACCCCCACAGG - Intergenic
969051512 4:4376619-4376641 GGCAAGGAACGGAGCCTCCCCGG - Intronic
970692982 4:18641504-18641526 AGCCAGGACTGCAGCCTCCTGGG + Intergenic
971360651 4:25935272-25935294 GACCAGCACTGCAGCCTCCTGGG - Intergenic
972655299 4:41058096-41058118 GCCCTGGAAAGAAGCCTACCTGG - Intronic
978809796 4:112837577-112837599 GCCCATGAAAGCAGCCTCAGGGG + Intronic
982569247 4:157027395-157027417 GCCCAGGAATACACCATGCCCGG - Intergenic
985330124 4:188822886-188822908 GCAAAGGAATGCGGCCTCCTGGG + Intergenic
986013804 5:3740439-3740461 GCCCAGGCCTTGAGCCTCCCTGG - Intergenic
988097705 5:26638776-26638798 ACCCAGGAATGCAGCTAACCAGG - Intergenic
988448040 5:31310385-31310407 GCCCATGAAAGCAGCCTCGGGGG - Intronic
993193877 5:84715307-84715329 GCACAGGACTGCAGTCTCCAAGG - Intergenic
993246116 5:85455170-85455192 TCCCAGGAATGTAGCCTACTTGG + Intergenic
994381972 5:99081879-99081901 ACCTAGGAATGCAGCCAGCCAGG - Intergenic
994696631 5:103079867-103079889 GTCCAGCCATCCAGCCTCCCTGG + Intergenic
995085297 5:108101983-108102005 GTCCTGGAGTGCAGCCACCCTGG - Intronic
995667763 5:114563173-114563195 TCCTAGGAATTCAGCCTACCTGG + Intergenic
996829458 5:127723733-127723755 GCACAAGGATGCAGCCTCTCAGG + Intergenic
997790392 5:136754394-136754416 GCCCAGGCAAGCAGCCTTCTGGG - Intergenic
998401697 5:141851906-141851928 CCCCAGGAATGCCGCCTGTCTGG + Intergenic
998797289 5:145833978-145834000 GTCCAGGAGTCCTGCCTCCCAGG + Intronic
1001071284 5:168587428-168587450 GCCCAGGAATGCATCCTACCAGG + Intergenic
1001146772 5:169191895-169191917 GTCCAGCATTCCAGCCTCCCAGG + Intronic
1001203165 5:169737751-169737773 GTCCAGGAATGCCACCTTCCAGG - Intronic
1001299780 5:170525146-170525168 GCCCAGGACAGCTGGCTCCCAGG - Intronic
1002261516 5:177996574-177996596 ACCCAGGAGTGGAGCCTGCCTGG + Intergenic
1002418493 5:179133204-179133226 GCCCAGGCAGGCACCGTCCCTGG + Intronic
1003532615 6:6950319-6950341 GCCCAGGAATTCACCCAGCCTGG - Intergenic
1003788608 6:9516407-9516429 TCCCAGGAATGCTGACTCACAGG - Intergenic
1004583210 6:16974266-16974288 GCTCAGGAAGGGAGCTTCCCAGG + Intergenic
1004651656 6:17615800-17615822 ACCCAGGAATGGAGCCTGCACGG - Exonic
1006741776 6:36313807-36313829 GCCCAGGAATGCTTGTTCCCTGG + Intergenic
1006927321 6:37664246-37664268 GCCCAGGAAAGAATCCTCCCAGG + Intronic
1006928566 6:37673466-37673488 GCCCAGGAAAGCCTCCTCCCAGG - Intronic
1008198244 6:48553050-48553072 GCTCAAGAAGGCAGCCTGCCTGG + Intergenic
1008610851 6:53183329-53183351 GCCCAGGATAGAAGCCTCCATGG + Intergenic
1016886644 6:148965340-148965362 GACCAGGATTTCAGCCTCCTGGG - Intronic
1017629275 6:156380730-156380752 GCCCAGAAATGGAGTCTTCCAGG + Intergenic
1017685137 6:156906034-156906056 CCTCAGGACTGCATCCTCCCTGG - Intronic
1017765722 6:157605583-157605605 GAACTGGAAGGCAGCCTCCCAGG + Intronic
1017876582 6:158529792-158529814 GCCCAGCGATGCAGCCTCCTGGG - Intergenic
1018231373 6:161679293-161679315 GCCCCAGGATACAGCCTCCCTGG - Intronic
1018670201 6:166170563-166170585 GCCCAGGAAAACTGCCTCTCTGG - Intergenic
1019410310 7:903888-903910 GTGCAGGAAGGCAGCTTCCCAGG - Intronic
1019455271 7:1123520-1123542 GCCCAGGAATGCTGCTCCCCAGG + Intronic
1019540143 7:1547637-1547659 GCCCAGGAATGCCAGCTCGCTGG - Intronic
1019614092 7:1951071-1951093 GGCCAGGGGAGCAGCCTCCCGGG - Intronic
1019718709 7:2555235-2555257 GCCCGGGAAGGCTGCGTCCCGGG + Intronic
1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG + Intronic
1020125973 7:5532647-5532669 GGCCAGGAATGCTGCAGCCCGGG - Intronic
1022903993 7:34838139-34838161 AGCCAGGAAGTCAGCCTCCCTGG - Intronic
1023537661 7:41230966-41230988 CCCTAGGAATGGAGCTTCCCAGG + Intergenic
1024036289 7:45510061-45510083 GCCCAGGTCTGCAGTCTCTCAGG + Intergenic
1029367618 7:100126888-100126910 GCCCAGCCAGGCAGCCTCCTCGG + Exonic
1030773559 7:113505080-113505102 GCCCAGGAATACTGCCCCCTTGG + Intergenic
1031626918 7:124002780-124002802 GCCCAGGAATACAGCTAACCAGG - Intergenic
1032509110 7:132457846-132457868 GCCAAGGAATGCAGCCCCAGAGG + Intronic
1033418287 7:141183873-141183895 GCCCCGGCATGCGGCCTCCTTGG + Intronic
1034444884 7:151108742-151108764 GCCCAGGACTCCAGAATCCCAGG - Intronic
1034892875 7:154855970-154855992 TCACAGCATTGCAGCCTCCCGGG + Intronic
1035183534 7:157108272-157108294 GCCCGGGACTGCAGCCGACCAGG + Intergenic
1035388453 7:158489838-158489860 GGCCAGGAAGGCAGCCTCGGGGG - Intronic
1035950601 8:4016469-4016491 GCCCAAGAATGCAAGCTTCCTGG + Intronic
1036451360 8:8870765-8870787 TCCCTGGACTGCAGCTTCCCGGG + Intronic
1037935470 8:22912515-22912537 GCCCCGGATGGCAGCTTCCCTGG - Intronic
1038780432 8:30564988-30565010 TCCTAGAAATACAGCCTCCCGGG + Intronic
1039688701 8:39838029-39838051 CCTCAGGAAAGCATCCTCCCAGG + Intronic
1039951409 8:42175726-42175748 CTCCAGGAATGCCTCCTCCCTGG - Exonic
1040843394 8:51808702-51808724 GCTCAGGACTTCACCCTCCCAGG + Intronic
1041854522 8:62435411-62435433 GCCCAGCAATTCAGTCCCCCTGG - Intronic
1042660315 8:71147891-71147913 ATCCAGGAATTCTGCCTCCCAGG + Intergenic
1045065115 8:98437443-98437465 ACCCAGGAATGCAGCCTACACGG + Intronic
1046838614 8:118830923-118830945 ACCTAGGAATACAGCCTACCTGG + Intergenic
1047231359 8:123000709-123000731 GCCCAGGGAAGCAGCCTCCAAGG - Intergenic
1047546492 8:125822416-125822438 TCCCAAGAATGAAACCTCCCAGG + Intergenic
1047965365 8:130042391-130042413 CCCCAGGAATCCTGCCTCGCAGG + Intergenic
1048232642 8:132659048-132659070 GCCCAGGCATGCAGCCCACTGGG + Intronic
1049028526 8:140014673-140014695 GTCCAGGACTCCAGGCTCCCAGG + Intronic
1049048329 8:140170824-140170846 GGCCAGGCCTGCAGCCTCACAGG + Intronic
1049147618 8:141013152-141013174 GCCCAGGCCTGCTGCCTACCTGG - Intergenic
1049454767 8:142681258-142681280 CCCCAGGAATGGGGGCTCCCAGG - Intronic
1049537024 8:143187241-143187263 GCCAAGGGACGCACCCTCCCTGG + Intergenic
1049654815 8:143792837-143792859 GCCTGGGCCTGCAGCCTCCCCGG - Exonic
1049749479 8:144276523-144276545 GGGCTGGACTGCAGCCTCCCGGG + Intronic
1049798166 8:144505817-144505839 ACCCAGCACTGCTGCCTCCCCGG + Intronic
1050402507 9:5271115-5271137 GCCCATGAAAGCAGCCTCAGGGG + Intergenic
1057819184 9:98318225-98318247 GCTTAGAAATGCAGCATCCCAGG - Intronic
1057860470 9:98636897-98636919 GCCCATAAATGCAGAGTCCCGGG + Intronic
1058167794 9:101639819-101639841 CCCCAGGAAACCAGCCTCACAGG + Intronic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060791591 9:126489098-126489120 GCCCAGGAGCGCATGCTCCCTGG - Intronic
1060981398 9:127794429-127794451 GCCCAGGGACTTAGCCTCCCTGG - Intergenic
1061258786 9:129467790-129467812 TCCCAGGACACCAGCCTCCCTGG + Intergenic
1061374343 9:130215235-130215257 GCCCATGACTCCAGACTCCCAGG - Intronic
1062324367 9:136005139-136005161 GCCCAGGAATCCTGCCACTCTGG - Intergenic
1062351952 9:136143689-136143711 GGCCAGGCCTGCAGCCTCCCTGG + Intergenic
1062425441 9:136504046-136504068 GCCCAGCAATGCCCCCTCCCAGG + Intronic
1062426835 9:136510024-136510046 CCCCAGCCATGCAGCCTTCCCGG - Intronic
1062570580 9:137183277-137183299 GCCCGGGACCACAGCCTCCCAGG + Intronic
1062683182 9:137795354-137795376 GCCCAGGACTGCTTCCTGCCAGG - Intronic
1185892272 X:3832316-3832338 GCCCAGGAATGGGGACTCCCAGG - Intronic
1185897380 X:3870735-3870757 GCCCAGGAATGGGGACTCCCAGG - Intergenic
1185902499 X:3909167-3909189 GCCCAGGAATGGGGACTCCCAGG - Intergenic
1190725895 X:53190378-53190400 GCCCAGGACGGAGGCCTCCCTGG - Intergenic
1192075899 X:67996269-67996291 GCCCAGGAATACAGCTATCCAGG - Intergenic
1192340194 X:70257946-70257968 ACCCTGGCATGCAGGCTCCCTGG + Intergenic
1192696797 X:73425076-73425098 CCCCAGGGATGAAGCCTACCTGG - Intergenic
1193048376 X:77076967-77076989 GCCAAGCAATCCAGCCTCCCTGG + Intergenic
1194520383 X:94910879-94910901 GCCTAGGAATGCAGCCAACCAGG + Intergenic
1196942759 X:120793747-120793769 TCCCAGCAATGCAGTCTCACAGG - Intergenic
1197030115 X:121803014-121803036 ACCAAGTCATGCAGCCTCCCTGG + Intergenic
1198641674 X:138762898-138762920 GCCCAGGAATGCTGGATCTCAGG + Intronic
1198658550 X:138941475-138941497 ACCCAGGAATGCAGCTAGCCAGG + Intronic
1199301679 X:146220867-146220889 GCCCATGAATGCAGCCAGCAGGG - Intergenic
1199802735 X:151267534-151267556 GCCCCGCCATGCAGCCTCCAAGG - Intergenic
1200213217 X:154356087-154356109 GCACATGAGTGAAGCCTCCCAGG - Intronic
1200229870 X:154438517-154438539 CCCCAGGAATGCATCCTGTCGGG + Exonic
1200958926 Y:8979630-8979652 GCCTAGGAACACTGCCTCCCAGG - Intergenic
1201856864 Y:18554120-18554142 GCCCAGGAATAGAGCCACACTGG - Intronic
1201876457 Y:18766260-18766282 GCCCAGGAATAGAGCCACACTGG + Intronic
1202177823 Y:22113867-22113889 CCCCAGGATTGCAGTCTCCCAGG - Intergenic
1202213538 Y:22472528-22472550 CCCCAGGATTGCAGTCTCCCAGG + Intergenic
1202220967 Y:22548919-22548941 GCCCAGGAATAGAGCCACACTGG - Intergenic
1202233220 Y:22678028-22678050 GCCTAGGAACCCTGCCTCCCAGG - Intergenic
1202309936 Y:23518130-23518152 GCCTAGGAACCCTGCCTCCCAGG + Intergenic
1202322145 Y:23646744-23646766 GCCCAGGAATAGAGCCACACTGG + Intergenic
1202548623 Y:26023312-26023334 GCCCAGGAATAGAGCCACACTGG - Intergenic
1202560865 Y:26152463-26152485 GCCTAGGAACCCTGCCTCCCAGG - Intergenic