ID: 1104729074

View in Genome Browser
Species Human (GRCh38)
Location 12:131095064-131095086
Sequence CTGAGTGAGCCCTGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 343}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104729069_1104729074 0 Left 1104729069 12:131095041-131095063 CCTGTGCCTCTCTGAGTGGAGAG 0: 1
1: 0
2: 0
3: 22
4: 228
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729063_1104729074 16 Left 1104729063 12:131095025-131095047 CCCCTGTACCCTGTGGCCTGTGC 0: 1
1: 0
2: 2
3: 20
4: 286
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729064_1104729074 15 Left 1104729064 12:131095026-131095048 CCCTGTACCCTGTGGCCTGTGCC 0: 1
1: 1
2: 4
3: 27
4: 308
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729070_1104729074 -6 Left 1104729070 12:131095047-131095069 CCTCTCTGAGTGGAGAGCTGAGT 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729057_1104729074 28 Left 1104729057 12:131095013-131095035 CCCCAGGGCCCTCCCCTGTACCC 0: 1
1: 0
2: 2
3: 75
4: 577
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729066_1104729074 8 Left 1104729066 12:131095033-131095055 CCCTGTGGCCTGTGCCTCTCTGA 0: 1
1: 0
2: 4
3: 38
4: 317
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729058_1104729074 27 Left 1104729058 12:131095014-131095036 CCCAGGGCCCTCCCCTGTACCCT 0: 1
1: 0
2: 2
3: 45
4: 414
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729056_1104729074 29 Left 1104729056 12:131095012-131095034 CCCCCAGGGCCCTCCCCTGTACC 0: 1
1: 0
2: 4
3: 55
4: 547
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729067_1104729074 7 Left 1104729067 12:131095034-131095056 CCTGTGGCCTGTGCCTCTCTGAG 0: 1
1: 0
2: 2
3: 34
4: 339
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729061_1104729074 20 Left 1104729061 12:131095021-131095043 CCCTCCCCTGTACCCTGTGGCCT 0: 1
1: 0
2: 3
3: 49
4: 431
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729065_1104729074 14 Left 1104729065 12:131095027-131095049 CCTGTACCCTGTGGCCTGTGCCT 0: 1
1: 0
2: 3
3: 30
4: 305
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729059_1104729074 26 Left 1104729059 12:131095015-131095037 CCAGGGCCCTCCCCTGTACCCTG 0: 1
1: 0
2: 3
3: 84
4: 543
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343
1104729062_1104729074 19 Left 1104729062 12:131095022-131095044 CCTCCCCTGTACCCTGTGGCCTG 0: 1
1: 0
2: 2
3: 39
4: 360
Right 1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG 0: 1
1: 0
2: 0
3: 35
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104729074 Original CRISPR CTGAGTGAGCCCTGGGAACA GGG Intronic
901399657 1:9007187-9007209 CTGCGTGAGCACGGGGACCAAGG + Intronic
902679649 1:18033992-18034014 CTGAGGGAACCTTGGGAACCAGG - Intergenic
902879117 1:19359451-19359473 CTGAGGGAGCCCTGGGCAGGGGG - Intronic
902917311 1:19646440-19646462 CAGAGTGAGCCCAGGAAACCCGG + Intronic
903739407 1:25549920-25549942 CTCAGTGGGGCCTGGGAACATGG + Intronic
904583663 1:31566606-31566628 CTGGGTGAGCCCTTGGAAAATGG + Intergenic
904989540 1:34580596-34580618 CTGATTGACCACTTGGAACATGG + Intergenic
905254398 1:36670830-36670852 CTGAGGGAGCCTTGGGGACTGGG + Intergenic
905664178 1:39752528-39752550 CACAGTGAGGCCTGGTAACATGG - Intronic
906315916 1:44786382-44786404 CTGGGAGAGTCCTGGGAGCAGGG - Intronic
906584645 1:46965649-46965671 CTGAGTGAGACCTCCCAACAGGG - Intergenic
906725442 1:48041010-48041032 CTGAGGAAGCCCAGGGAAGAAGG - Intergenic
907265159 1:53254826-53254848 CTGTATGATCCCTAGGAACAGGG - Intronic
907381826 1:54096985-54097007 ATAAGTGAGCTCTGGGAAGAAGG - Exonic
907443267 1:54491162-54491184 CTGTGTGAGCCCAGGGAGCGTGG - Intergenic
908007830 1:59744912-59744934 ATCAGTGAGCTTTGGGAACATGG + Intronic
910673372 1:89795233-89795255 CTGAGGGAGCCCTGGGGGCGTGG - Intronic
912448892 1:109757853-109757875 CTGGGTGAGACCTGGGAGAAGGG + Exonic
912460667 1:109828797-109828819 CTGAGAGAGCCCAGGGAACTCGG + Intergenic
912523727 1:110265526-110265548 CTCAGTGTTGCCTGGGAACAGGG - Intronic
912944792 1:114075963-114075985 CAGAGAGAACCCTGGGGACAAGG - Intergenic
913074831 1:115333124-115333146 CTAAGTGAGCCCAGGGAGGATGG - Intronic
913227456 1:116712738-116712760 CTGAGGCAACCCTGGGAAGATGG + Intergenic
913589207 1:120306834-120306856 CTGAGTAAGCACTGAGACCATGG - Intergenic
913618977 1:120591532-120591554 CTGAGTAAGCACTGAGACCATGG + Intergenic
914402617 1:147337434-147337456 CAGAGTGGACCCTGGGAGCACGG + Intergenic
914454742 1:147825209-147825231 CAGACTTAGCCCTGGGAAGATGG + Intergenic
914571229 1:148918702-148918724 CTGAGTAAGCACTGAGACCATGG - Intronic
914601602 1:149211560-149211582 CTGAGTAAGCACTTGGACCATGG + Intergenic
915070270 1:153260824-153260846 CTGAAGGAGCCCTGGGAGGATGG + Intronic
915580063 1:156808243-156808265 CTGAGGGAGCCCTGGGATTCTGG + Intronic
915748250 1:158181601-158181623 CTGAACGTGCCCTGGGACCAAGG - Exonic
916589440 1:166176177-166176199 CAAAGTGGGCCTTGGGAACAAGG - Intergenic
917305277 1:173617824-173617846 CTGAGTGAGACCTCCCAACACGG + Intronic
917805949 1:178613868-178613890 CTGAGTAAGCCCTGGAAGCCTGG + Intergenic
919770187 1:201153785-201153807 CTGAGTCAGCCCTGTAGACAGGG + Intronic
920297721 1:204969219-204969241 CTGAGGGAGCGCTGGCACCAAGG - Intronic
920505631 1:206513444-206513466 CTGACTGAGCCCCAGGAACATGG - Intronic
920563193 1:206953849-206953871 GTAAGTGAGCAGTGGGAACAAGG + Intergenic
922619121 1:226979743-226979765 CGGACTGAGTCCTGGGGACACGG + Intronic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
923070829 1:230562913-230562935 CCAGGTGACCCCTGGGAACATGG - Intergenic
1062960916 10:1573220-1573242 CTCAGTGAGCCAGGGGACCAGGG + Intronic
1066712664 10:38252433-38252455 CTGAGGCTGCCCTGGGGACAAGG - Intergenic
1066997978 10:42581075-42581097 CTGAGTAAGCCCTGGGATACAGG + Intronic
1067077885 10:43198353-43198375 CTGGCTGAGCCCTGGGGCCAGGG + Intronic
1067475186 10:46560216-46560238 CTGCCTCAGCCTTGGGAACAGGG - Intergenic
1067804582 10:49384143-49384165 CTGAGAGAGGCCTGGGTAAAAGG - Intronic
1068073841 10:52229471-52229493 CTGAGTAAGCCCCAGGAAAATGG + Intronic
1070773962 10:79099286-79099308 TTGAGAGTGCCCTGGGCACAGGG + Intronic
1070909609 10:80106333-80106355 CTGAGGGAGACCTTGAAACATGG + Intergenic
1072627852 10:97125332-97125354 CTGTGTGAGCCTGGGCAACATGG + Intronic
1073200777 10:101733431-101733453 TTCAGTGAGGCCTGGGGACATGG - Intergenic
1074219382 10:111421218-111421240 CTTAGGGAGTCCTAGGAACATGG - Intergenic
1074545337 10:114398010-114398032 CACAGTGAGGCCAGGGAACACGG - Intronic
1074827103 10:117222660-117222682 CTGAAGGAGCTCTGGGAGCAAGG - Intergenic
1075145203 10:119876778-119876800 CTGAGAGAGCACTGGAAATATGG + Intronic
1075507131 10:123033928-123033950 CTGAGTGGGCCCAGGGAGCTGGG - Intronic
1075631053 10:124000891-124000913 CAGAGAGAGCCCTGGGGAAATGG + Intergenic
1075780700 10:125015508-125015530 CGGAGGGAGCCCTGGGAGCCCGG - Intronic
1076369320 10:129941507-129941529 CTGGGTGAGCACTGGGCACTGGG + Intronic
1076591771 10:131588466-131588488 CAGAGAGAGCCCAGGGAACAGGG + Intergenic
1076645417 10:131950840-131950862 CTTTGTGAGCTCTGGAAACAAGG + Intronic
1077228110 11:1447129-1447151 CTGACTGGGCCCTGGGAAGGAGG - Intronic
1077347897 11:2072793-2072815 CTCACAGGGCCCTGGGAACAGGG + Intergenic
1078470123 11:11579829-11579851 AGGAGAGAGCCCTGGGAGCAGGG + Intronic
1078567689 11:12431089-12431111 GTGAGTCAGCCCTGGGAGCAGGG - Intronic
1080191671 11:29557620-29557642 CCGAGGGAGGCCTGGAAACATGG - Intergenic
1080214763 11:29827766-29827788 CTGAGTGAGACCTCCCAACAGGG + Intergenic
1080953736 11:37067528-37067550 GTGTGTGAGCTCTGGGGACAAGG + Intergenic
1081278878 11:41184038-41184060 CTGTGTGCAGCCTGGGAACATGG - Intronic
1081671211 11:44943643-44943665 CTGGGAGGGCCCTGGGAAGAGGG - Intronic
1081869047 11:46375046-46375068 GTGAGTGGGCCCTGGGCCCATGG + Intronic
1081965442 11:47166457-47166479 CCAAGTGAGGCCTGGGAGCAGGG - Intronic
1082022963 11:47550444-47550466 CTGCTTGAGCCCGGGGGACAGGG + Intronic
1082095680 11:48127356-48127378 CAGAGTGAGCCCTGGAACCCAGG + Intronic
1083525375 11:63360234-63360256 CTGAGGGAGCCCTGTGGACCAGG - Intronic
1084474098 11:69378918-69378940 CCGGGTGAGCCCTGGACACAGGG + Intergenic
1085416311 11:76321322-76321344 CTGAGAGAGGCCTTGGAAGAGGG + Intergenic
1087781567 11:102306362-102306384 CTCAGTGTGCCCTGGGGAAAGGG + Intergenic
1087900207 11:103631919-103631941 CTCAGGGGGCCCTGAGAACATGG - Intergenic
1088558646 11:111089806-111089828 CTGAGTGCACGCTGGGGACATGG - Intergenic
1088824697 11:113483820-113483842 CTGAGGGAAGGCTGGGAACATGG - Intergenic
1088941841 11:114467515-114467537 CTAAATGAGCCCTGGAAATAGGG + Intergenic
1090876290 11:130791610-130791632 TGGATTCAGCCCTGGGAACATGG + Intergenic
1091233219 11:134001751-134001773 CTGAGTGAGCCCTTAGTGCAGGG + Intergenic
1091294438 11:134463737-134463759 CTCAGTGTACCCTGGGAACCTGG - Intergenic
1092238203 12:6822539-6822561 TTCAGTGAGCCCTGGGAAGGGGG - Intronic
1094273711 12:28645570-28645592 CTGGGTGAGACCTCCGAACAGGG - Intergenic
1095945443 12:47751004-47751026 CTGTGTGAGGCCTGGGGTCACGG + Intronic
1096364080 12:51013653-51013675 CTGCTTGAGCCCTGGGGTCAAGG + Intronic
1096969507 12:55654532-55654554 TTAAGTGGGCTCTGGGAACAGGG + Intergenic
1099954914 12:89344352-89344374 CTAAGTGAGCAGTGAGAACACGG + Intergenic
1100390619 12:94143412-94143434 CTGGGGAAGCCCTGGGAATATGG - Intergenic
1102486424 12:113260764-113260786 CTCAGTGTGCCCTGAGAAGAGGG - Intronic
1104360283 12:128126540-128126562 ATGAGTGAGCCATGGGGAGACGG + Intergenic
1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG + Intronic
1104734842 12:131130504-131130526 CTGAGAGAGCCCTGGGCGGAGGG + Intronic
1107033593 13:35878364-35878386 CTGAGTGAACCCTGACACCATGG + Intronic
1107260133 13:38480820-38480842 CTCAGTGAGCCCTTGGATCCTGG + Intergenic
1108003445 13:45925187-45925209 CTGAGAGGCCCCTGGGGACAGGG - Intergenic
1108260967 13:48655828-48655850 CTGGTTGAGCCCAGGGCACATGG + Intronic
1109944966 13:69420961-69420983 TGGAGTGAGCACTGGGAGCAGGG + Intergenic
1110900913 13:80823138-80823160 GTGAGTGAGCCCTGGGGACTAGG - Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1112246818 13:97742848-97742870 CTGAGTGTGTCCTGGGGACCTGG - Intergenic
1113412824 13:110105321-110105343 CAGTCTGTGCCCTGGGAACAGGG - Intergenic
1113502996 13:110793137-110793159 CTGAGTGGGTACTGGGAGCAGGG - Intergenic
1113793709 13:113044604-113044626 CAGAGTGAGCCCACGGAAGAGGG + Intronic
1113903409 13:113808450-113808472 CAGAGTAAACCCTGGGACCACGG - Intronic
1114266410 14:21074924-21074946 CCCACTGAGCCCTGGGGACAAGG + Exonic
1115115871 14:29880241-29880263 CTGAGTGCAGCCTGGGAACTTGG + Intronic
1116566381 14:46449235-46449257 CTGAGTGAGGCCTGGGTAGCAGG + Intergenic
1118237393 14:64020577-64020599 CTGAGTGAGGCCTGTGAAATAGG - Intronic
1119614071 14:76086794-76086816 CGGAGTGCTCCCTGGGAACTCGG + Intergenic
1119709158 14:76809019-76809041 TTGAGTGAGCCAAGGGAACAGGG - Intronic
1119882668 14:78113501-78113523 CTCAGTGAGCCAAGGGGACATGG - Intergenic
1121667942 14:95686626-95686648 CAGAGTGAGTCCTGGGCACGAGG + Exonic
1121949541 14:98158803-98158825 CTGTGTCAGCCCTTGGATCATGG - Intergenic
1122401564 14:101470392-101470414 CTGAGTAGGCCCTGGGTAGAGGG + Intergenic
1122444000 14:101755840-101755862 CCCAGTGAGGCCTGGGAACAAGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1122981425 14:105193904-105193926 CTGAGTGAGCCCAGAGCCCATGG + Intergenic
1123795104 15:23763244-23763266 CTGCGTCAGCACTGGGAACTTGG + Intergenic
1127981953 15:64041899-64041921 GAGAGTAAGCCCTGGGAACCAGG - Intronic
1128643760 15:69360018-69360040 TTGAGTGAGGCCTGGTAACAGGG + Exonic
1128681329 15:69654092-69654114 TTGAGTGGGCCCTGGGAAATGGG + Intergenic
1129325503 15:74798413-74798435 CTGACTGAGTGCTGGGAAAAAGG - Intronic
1130030336 15:80308201-80308223 CTGAGTGAGACCTCCCAACAGGG - Intergenic
1130113818 15:80989222-80989244 GTCAGTGAGCCCTGCAAACAGGG - Intronic
1130319461 15:82828580-82828602 CTGAGTGAGGCCTGAGGAGATGG - Intronic
1130532138 15:84755518-84755540 CTGAGTTAGCCCTGGGATGTAGG - Intronic
1130725294 15:86432910-86432932 CTGAGGGAGACATGGGGACAGGG - Intronic
1130795761 15:87207705-87207727 CTGAGTGAGGCTTGGGCAGATGG - Intergenic
1130880091 15:88047408-88047430 GTGAGTTAGCCCTGGTACCAAGG + Intronic
1131029372 15:89173693-89173715 CTGAATGGGCCCTGAGGACAGGG - Intronic
1132300413 15:100771884-100771906 TTGAGTGAGACCTGGGAACCAGG + Intergenic
1132470131 16:97956-97978 CTGAGTCAGACCTGGGTTCAGGG - Intronic
1132522599 16:398364-398386 CCAGGTGAGCCCTGGAAACACGG - Intronic
1132584943 16:702027-702049 CAGAGTGAGCCTAGGGAGCACGG + Intronic
1132600265 16:769976-769998 CTGAGAGGGCCCTGGGCAGAGGG + Intronic
1135955384 16:26952525-26952547 CAGAGTGAGTGCTGGGAACAGGG - Intergenic
1137034285 16:35556119-35556141 ATGAGTGGGCCCTGTGAACAAGG - Intergenic
1137562890 16:49514396-49514418 CTGAGACAGAACTGGGAACAAGG - Intronic
1138846460 16:60573117-60573139 CTGGGTGAGCCCAGGAAACCAGG - Intergenic
1139147953 16:64345373-64345395 CTGAGGGAGCCAAGGCAACAGGG - Intergenic
1141097028 16:81170222-81170244 CTGTCAGAACCCTGGGAACACGG + Intergenic
1141861476 16:86719506-86719528 GTGAGTGGGCCTTGGGAAAATGG + Intergenic
1142182198 16:88676740-88676762 CTCAGTGGGCTCTGGGAGCAAGG + Intergenic
1144081286 17:11766599-11766621 CTGTGAGAGCCCAGGGGACATGG + Intronic
1144560271 17:16315487-16315509 GGGAGTGAGCCCTGGGGACAGGG - Intronic
1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG + Intronic
1145901667 17:28494076-28494098 CTGGGTCAGCCCTGGGAACTTGG - Exonic
1146506311 17:33408882-33408904 CTCAGAGAGCCCAGGGAAGAGGG + Intronic
1146932158 17:36785105-36785127 GTGATTTAGCCCTGGGATCATGG - Intergenic
1147165120 17:38588988-38589010 CTGAGTGTGTGCTGGGAACCCGG - Intronic
1147246623 17:39125353-39125375 CTAAGAAAGCCCTGGAAACAGGG + Intronic
1149549993 17:57533032-57533054 CTGAATGGGCCCTGGGAGCCTGG - Intronic
1149798284 17:59542006-59542028 CTGAGTTAGGCCTGTGACCAGGG - Intergenic
1150201606 17:63362726-63362748 CAGAGTGGGCACTGGGAACAGGG + Intronic
1151347343 17:73510175-73510197 CCCAGTGAGGCCTGGAAACAAGG - Intronic
1151668645 17:75559470-75559492 CTGACAGAGTCCTGGGACCAAGG - Intronic
1152239370 17:79153504-79153526 CTGACAGGGCCCTGGGAACCAGG + Intronic
1152695758 17:81793789-81793811 CTGAGTGAGACTGGGGGACACGG - Intergenic
1152772959 17:82181368-82181390 CTGAGTCAGCCCTGGTGAAAAGG + Intronic
1152831995 17:82503243-82503265 CTGAGTGGGGCTTGGGATCAGGG - Intergenic
1152877485 17:82795341-82795363 CTGAGAGAGACCGGGGAACACGG + Intronic
1153340119 18:3964840-3964862 GAGAGTTTGCCCTGGGAACAAGG + Intronic
1154063050 18:11081604-11081626 CTGGGTTAGCACTGGGAACTCGG - Intronic
1155056174 18:22185580-22185602 CCGTGTGTGCCCTCGGAACAAGG - Intronic
1155170309 18:23262353-23262375 ATCTGTGAGCCCTGGGAACCTGG - Intronic
1156267934 18:35505141-35505163 GTGACCCAGCCCTGGGAACAGGG + Intergenic
1156492978 18:37507231-37507253 CTGAGTGAGTGCTAGGAACAGGG + Intronic
1157493426 18:48139222-48139244 CTGAGTGAACCCTCTGAACCAGG - Intronic
1157891939 18:51426351-51426373 TTGAGTGAGCCCTAGGGACAGGG + Intergenic
1160827807 19:1088859-1088881 CTGTGTGACCGCTGGGCACAAGG - Intronic
1160919131 19:1511795-1511817 CTGAGGGAGCCCTGGGGCCGGGG - Intronic
1161226870 19:3150889-3150911 CAGAGTCACCCCCGGGAACAGGG - Intronic
1161257257 19:3316295-3316317 CTGAGTGAGCCCAGGCAATCTGG + Intergenic
1163672168 19:18635987-18636009 CTGAGAGAGGCCTGGGAAGGAGG + Intergenic
1163726215 19:18924552-18924574 CTGTGTGAGGCCTCGGGACAGGG - Intronic
1164196173 19:22962803-22962825 CAGAGTGATTACTGGGAACATGG - Intergenic
1165074880 19:33275255-33275277 CTGAGTGAGCCCAGGGCCCAAGG + Intergenic
1165184448 19:34004991-34005013 CTGAGGGCGCCCTGGGAAGATGG - Intergenic
1165267864 19:34676966-34676988 TTGAGTGAGCACTGGGAGGATGG - Intergenic
1165826547 19:38709023-38709045 CTGAGAGAGCACTGGGGACTGGG - Intronic
1166140372 19:40802189-40802211 ATGAGTGAGCCCTGGGCTGAGGG + Intronic
1166254467 19:41592406-41592428 TTGACTGAGCCCTGGGAAGGAGG - Intronic
1166268903 19:41701583-41701605 CTGTGTGGGCACTGGGGACATGG - Intronic
1166545537 19:43632671-43632693 AGGAGTCAGCCCTGGGAAGATGG - Intronic
1167736968 19:51300723-51300745 CTTAGTGAGAACTGGGATCATGG + Intergenic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168336697 19:55600924-55600946 CTGAGTGGGCGCCGGGAAGATGG + Intronic
926224966 2:10961072-10961094 CTGACTGAGCCCCGGGTCCAGGG + Intergenic
926253468 2:11169617-11169639 GTGCTGGAGCCCTGGGAACACGG - Intronic
928088696 2:28361105-28361127 CTGAGTCAGCCCTGGGAAAGGGG - Intergenic
929242682 2:39667678-39667700 CTGAGTTAGCCATGGGAAGGAGG - Intronic
929433354 2:41907426-41907448 CTGAGTGGTGGCTGGGAACAGGG + Intergenic
929558975 2:42943789-42943811 CTGTCTGAGCTCTGGGCACATGG - Intergenic
929610973 2:43270386-43270408 CAGAGTGTGCCCTGGGGAAAGGG - Intronic
930946729 2:57084618-57084640 TGGAGTGAGCGCTGGGAGCAGGG + Intergenic
931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG + Intergenic
931345251 2:61440067-61440089 CTCAGTGAGCCCTCAGAACCGGG - Intronic
932160155 2:69452602-69452624 CTGTGTGAGCCCTGAGCCCAGGG + Intergenic
935188415 2:100755686-100755708 GTTGGTGAGCCCTGGGCACAGGG - Intergenic
935889094 2:107656191-107656213 CTGTGAGAGACCTGGGAGCAGGG + Intergenic
937355847 2:121197622-121197644 CTTACTGTGCCCAGGGAACAGGG - Intergenic
937449464 2:121989860-121989882 CTGGGCCAGCCCTGGGAATAGGG + Intergenic
938904579 2:135825941-135825963 CTGAGCCTGCCCTGAGAACAGGG - Intronic
939022052 2:136969673-136969695 CCTAATGTGCCCTGGGAACAGGG - Intronic
939371463 2:141306855-141306877 CTGAGTGACCCCTGGGTCAAAGG - Intronic
940615048 2:156039043-156039065 CTGAGTGAGACCTCCCAACAGGG + Intergenic
942215664 2:173716922-173716944 CTGAGTAAGACCTGGGGCCATGG - Intergenic
942506748 2:176649863-176649885 ATGAGTGAGCCCAGGGCTCATGG - Intergenic
944222262 2:197314190-197314212 CTGAGCGAGTACTGGGAAAAAGG + Intergenic
944637218 2:201686040-201686062 CTGAGCAAGGCCTGGGCACAGGG + Exonic
945010995 2:205463525-205463547 CTCAGTGAGCTCTGAGAACGGGG + Intronic
946187808 2:217991074-217991096 CAGAGTCAGCCCTGGGTAGAAGG + Intronic
947591812 2:231390165-231390187 CTGAGTGAGCCTCTGGAACCAGG + Intergenic
948036447 2:234862073-234862095 CTGACTGCTCCCTGGGGACACGG + Intergenic
948832737 2:240606165-240606187 CTCAGGGATCCCAGGGAACATGG + Intronic
1170565959 20:17605426-17605448 CTGAGTGAGCCAAGGTCACAAGG + Intronic
1171229965 20:23476130-23476152 CTGCAGGAGCCCTGGGCACAGGG + Intergenic
1173849642 20:46209940-46209962 CTGGGGGAGTCCTGGGCACAGGG + Intronic
1173905872 20:46628338-46628360 CTGAGCGGGCCCAGGGAAGAAGG + Intronic
1174354250 20:49987826-49987848 CCGAGTGAGCCGTGGGACAACGG - Intronic
1175523564 20:59618442-59618464 CAGAGTGAGACCAGGGAAGAGGG + Intronic
1175879674 20:62250011-62250033 CAGAGTGAGCCTTGGGGGCAGGG - Intronic
1175881776 20:62263418-62263440 CCCAGGAAGCCCTGGGAACATGG + Intronic
1176043752 20:63081969-63081991 CTTAGTGAGCCATGGGATGAAGG + Intergenic
1176126958 20:63479890-63479912 CTGTGTGAGACCAGGGAAGAGGG - Intergenic
1176214145 20:63940355-63940377 GTGAGTGAGCCCTGGGTAGGCGG - Intronic
1179566111 21:42250253-42250275 CTGCTTGTCCCCTGGGAACATGG - Intronic
1179604065 21:42501271-42501293 CTGAGAGAGCCCTCGGAAAATGG - Intronic
1180043671 21:45293081-45293103 CTGAGTGAGCCCTGGGCCGGAGG + Intergenic
1180898300 22:19353289-19353311 CTAAGTGAGGCCTGGGAGGATGG + Intronic
1181676326 22:24455850-24455872 CGGAGGGAGCCCTGGGAAGCTGG - Intergenic
1181696235 22:24594138-24594160 CTGAGGGAGCCCTGGGAAGTGGG - Intronic
1181784935 22:25220218-25220240 CTGAGTGTGTTCTGGGACCACGG + Intronic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1183453224 22:37907568-37907590 CTGGGGGAGCCCTGGCAAGAGGG - Intronic
1183494249 22:38133399-38133421 CTGGCAGAGCCTTGGGAACAGGG + Intronic
1183741357 22:39670341-39670363 GTGGCTGAGCCCTGGGCACAGGG - Intronic
1184529307 22:45044422-45044444 CTGAGTGAAACCTGGGAACCAGG - Intergenic
950078721 3:10206115-10206137 CTGGGAGAGCCTTGGGACCATGG + Intronic
950423281 3:12911035-12911057 CTGGGTGAGGCCTGGGGACCTGG - Intronic
950453807 3:13080582-13080604 CAGACAGAGCCCTGGGGACATGG + Intergenic
950613659 3:14141821-14141843 CTGCGTGAGCCCTAGGATCCAGG + Exonic
950725694 3:14915481-14915503 CAGAGTGAGCCCTGGACACATGG - Intronic
952361072 3:32630558-32630580 CTGACTGATGCCTGGGAAAATGG - Intergenic
953494061 3:43371486-43371508 CTAAGTGTGGCCTGGGCACAGGG + Intronic
957575709 3:82005472-82005494 CTGACTGATACCTGGGAACTTGG + Intergenic
958871505 3:99564255-99564277 CTGGGTGTTCCCAGGGAACAAGG - Intergenic
959079124 3:101781020-101781042 CTGAGTAAGACCTTGAAACAGGG - Intronic
959252464 3:103965866-103965888 CTGAGTGGGCGCTGGGAGCTGGG - Intergenic
959754555 3:109882368-109882390 CTTTGAGAGCCCTGTGAACAAGG + Intergenic
961939407 3:130622118-130622140 CTGAGGGATCTCAGGGAACAAGG + Intronic
962914902 3:139892212-139892234 AGGAGTGGGCCCTGGGAACTGGG - Intergenic
965117939 3:164515436-164515458 CAGAGTGAGTGCTGGGAGCAGGG + Intergenic
966912147 3:184565623-184565645 AGGAGTGACCCCTGAGAACACGG + Intronic
968733774 4:2284734-2284756 CTCTGTGAGTCCTGGGATCAGGG + Intronic
968986036 4:3874908-3874930 CTAAGTGTGCCCTTGGTACAAGG - Intergenic
969301326 4:6299089-6299111 CTGTGTGAGCACTGGCACCATGG + Intronic
970546507 4:17135591-17135613 CTGAGTGGGTCCTGGGCTCAAGG - Intergenic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
975299635 4:72774872-72774894 CAGAGTGGGCACTGGGAGCAGGG - Intergenic
976334576 4:83870675-83870697 CCCAGTGAGCTCTGGAAACATGG - Intergenic
976527807 4:86114630-86114652 CTGAGTGAGACCTCCCAACAGGG - Intronic
977603076 4:98955146-98955168 GTGAGTGAGCCATGGAAACATGG + Intergenic
978281760 4:107025123-107025145 CTGAGAGAGGACTGGGAAGATGG + Intronic
978440162 4:108725922-108725944 CTGTGTGAGTCCTGTGAAGAGGG + Intergenic
978723737 4:111946022-111946044 CTGAGTGAGCCATGCAGACAAGG - Intergenic
981584410 4:146285699-146285721 CTCAGTGAGCCTTGGGAAGGAGG + Intronic
982118499 4:152117174-152117196 CTGAGTGAAGCCAGGGAGCACGG - Intergenic
983027852 4:162759189-162759211 CTGACTGAGCCCTGGTGGCACGG - Intergenic
985764136 5:1768045-1768067 CTGAGGGAGCCCTGGGCTGAGGG + Intergenic
985772938 5:1824495-1824517 CTCAGTGACCCCCGGGCACAGGG - Intergenic
986253655 5:6083608-6083630 CTGAGTGAGCCAGGGGATGAAGG - Intergenic
986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG + Intergenic
986641752 5:9878864-9878886 CTGAGTGAGTGCTGGCCACAAGG + Intergenic
987313997 5:16707319-16707341 TTGGCTGAGTCCTGGGAACATGG - Intronic
988873154 5:35413073-35413095 CAGAGTGAGCCCCTGGAAGAGGG - Intergenic
990502379 5:56409517-56409539 ATCAGTGAGTCCTGAGAACAGGG - Intergenic
991533156 5:67637571-67637593 CTGGGTGTGCCCTGGGGAGATGG + Intergenic
992446803 5:76841596-76841618 ATGAGTGATCCATGAGAACAAGG + Intergenic
994247009 5:97489411-97489433 TGGAGTGGGCACTGGGAACAGGG + Intergenic
995331995 5:110956595-110956617 CGGAGTGGGCGCTGGGAGCAGGG - Intergenic
995578976 5:113574405-113574427 CTGGGTGAGACCTCAGAACAGGG - Intronic
997234803 5:132266579-132266601 CAGAGTGAGCCCAGGGCAGAGGG + Intronic
997260789 5:132464275-132464297 CTGAGGGTGCCCAGGGAGCAGGG + Exonic
997350195 5:133225501-133225523 CTGTGTGAGCCCAGATAACAGGG + Intronic
997766927 5:136514027-136514049 CTGAGAGAGCCATTGGATCATGG - Intergenic
998708903 5:144798272-144798294 CTGATTGAGCCCTGAGTACTAGG + Intergenic
1001414554 5:171535800-171535822 CTGAGTGAGTCAGGGGAAGAAGG + Intergenic
1003380910 6:5623958-5623980 TTGAGAGAGCCATGGGTACAGGG + Intronic
1006168093 6:32077298-32077320 CTCAGTCAGCCCTGAGAAGAGGG - Intronic
1006394093 6:33775862-33775884 CTGAGTGCTCCCTGGGAGCCGGG - Intronic
1006692036 6:35896751-35896773 CTGACTGATTCCTGGGGACAGGG + Intronic
1007976532 6:46107322-46107344 CACGGTGAGGCCTGGGAACAGGG + Intergenic
1008082707 6:47210433-47210455 CTGAGTGAGACCTCCCAACAGGG + Intergenic
1008298535 6:49806171-49806193 CTGAGTGAGACCTCCCAACAGGG + Intergenic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1010816352 6:80362154-80362176 CTGAGGCAGCCCTGGGAAAGCGG + Intergenic
1010923887 6:81719880-81719902 TTGACTGAGCCTTGGAAACATGG - Intronic
1013371335 6:109473374-109473396 CAGGGGGAGCCCTGGGCACAGGG - Intronic
1013371957 6:109478495-109478517 CTCAGTGTGATCTGGGAACAAGG + Intronic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1018712218 6:166505307-166505329 CTGAGTGAGCCCCCGGGACATGG - Intronic
1019200887 6:170314144-170314166 ATGAGCCAGCCCTAGGAACAAGG + Intronic
1019284926 7:218670-218692 CTGAGTGAGCCCTGGGATGGAGG - Intronic
1019603205 7:1895617-1895639 CTGAGCCAGCCCCCGGAACACGG + Intronic
1020100930 7:5394074-5394096 CGGAGTGAGCCCTGAGTTCAGGG - Intronic
1022107818 7:27209443-27209465 CTGAGAGAGCCTGGGCAACATGG + Intergenic
1022602960 7:31779062-31779084 CTTAGTGAGGCCTGGGAAACTGG - Intronic
1023243923 7:38179849-38179871 CTGAGTCAGCCATGAGAAAATGG + Intronic
1023981731 7:45074409-45074431 GTGAGTGGGCCCTGGAAAGAGGG + Intronic
1024962733 7:54994581-54994603 CTGGGAGAGCCCTGGGCAAATGG - Intergenic
1026744352 7:72999452-72999474 TTAAGTGAGTCCTGGGAAGAGGG - Intergenic
1026809507 7:73451043-73451065 CTGAGAGAGAACTAGGAACAGGG + Intronic
1027030458 7:74884125-74884147 TTAAGTGAGTCCTGGGAAGAGGG - Intergenic
1027099385 7:75365640-75365662 TTAAGTGAGTCCTGGGAAGAGGG + Intergenic
1027140527 7:75653782-75653804 CTGAGTGATCGCTGGGGCCAAGG + Intronic
1029378639 7:100198163-100198185 TTAAGTGAGTCCTGGGAAGAGGG + Exonic
1029608754 7:101615399-101615421 CTGCGTCTGCCCTGGGAGCATGG - Intronic
1030672575 7:112353291-112353313 CTGAGTGATACATGGGGACAAGG + Intergenic
1030830163 7:114210593-114210615 CTGGGTGAGACCTCCGAACAGGG - Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1032098800 7:128955611-128955633 CTGAGTGTGCTGTGGAAACAAGG + Intronic
1032658400 7:133955876-133955898 CAGAGTGGGCACTGGGAGCAGGG + Intronic
1033085761 7:138340269-138340291 CTGAGGGAGACCTTGAAACACGG + Intergenic
1033308179 7:140239901-140239923 CTGGGTGATCCCTGGGTGCAGGG - Intergenic
1033312763 7:140273704-140273726 CTCAGTGGGCCCTGGAAATACGG - Intergenic
1033584746 7:142765862-142765884 CTGAGTTAGCCCTGTGAGAAGGG + Intergenic
1035555762 8:565928-565950 CTGAGTCTGCCCTGGGAAAGTGG + Intergenic
1035587463 8:786828-786850 CTCAGTGAGACCTGTGAACGTGG + Intergenic
1036454945 8:8898313-8898335 TTGAGTGAGGCCTTGAAACATGG + Intergenic
1037313936 8:17583238-17583260 CTAGGGGAGCCATGGGAACAGGG + Intronic
1037883243 8:22583028-22583050 CTGGGAGAGCCATGGGATCAGGG - Intronic
1037980676 8:23251010-23251032 CTGACTGAGCCCTGGAGACCAGG - Intronic
1039842075 8:41301148-41301170 CTCTGTGAGCTCCGGGAACAAGG - Intronic
1040112305 8:43571942-43571964 TTGAGGGAGGCCTGGGAAAAAGG - Intergenic
1041393626 8:57369505-57369527 CTGTGTGAGTCCTGTGAAGAGGG - Intergenic
1043058471 8:75469943-75469965 TTGAGTGAGCCCTTTAAACAGGG - Intronic
1044070999 8:87759684-87759706 TTGAGAGAGCCCAGGGAAAAAGG - Intergenic
1044171469 8:89057646-89057668 ATGCGTTAGCCCTGGGAAAAGGG - Intergenic
1044276048 8:90300485-90300507 CTGAAAGAGCCCTGGGCTCAGGG - Intergenic
1045151006 8:99408044-99408066 CAGAGAGAGCACTGGGAAGAGGG + Intronic
1045418883 8:101994399-101994421 CTCAAGGAGCCCTGGGAACAGGG - Intronic
1048284490 8:133131151-133131173 TGGAGTGAGCACTGGGAACCAGG - Intronic
1049274360 8:141712248-141712270 CTGAGTCACCCCTGGGAATCAGG + Intergenic
1049403475 8:142441269-142441291 CTTAGTGAGCCATAGGAATAGGG - Intergenic
1049443868 8:142621340-142621362 CTGAGCTTGCCCTGGGCACACGG + Intergenic
1049446582 8:142634229-142634251 CTGAGCTGTCCCTGGGAACAAGG + Intergenic
1050279546 9:4035901-4035923 CTGAGTGAGCCTTGAGTAAATGG - Intronic
1053310959 9:37019422-37019444 CGGAATGAACCCTGGGATCAAGG + Intronic
1055777886 9:79785719-79785741 CTGAGTTAGCCATGGTAACTGGG - Intergenic
1056569316 9:87802135-87802157 CTGAGGGAGCCCTGGATAGAAGG - Intergenic
1056817061 9:89809715-89809737 CTGAGGAAGCCCAGGGCACAAGG + Intergenic
1056853839 9:90108066-90108088 GTGACTCAGCCCTTGGAACATGG + Intergenic
1059307422 9:113365666-113365688 CTGAGTGAGGCCTAGAAGCAAGG - Intronic
1060860236 9:126948101-126948123 CTGTGTTAACCCTGGGGACAGGG + Intronic
1061791182 9:133059973-133059995 CTGAGTGCACCCTGGGGAGATGG - Intergenic
1062274007 9:135722140-135722162 CTGAGCCAGCCCTGGGCCCAGGG - Intronic
1062504267 9:136865471-136865493 CTGAGTGGGAGCTGGGGACAGGG - Intronic
1185487054 X:490069-490091 CTAAGTGAGCCCTGGGGAGAAGG + Intergenic
1185791052 X:2928628-2928650 CTTAGTGGACCCGGGGAACACGG + Intronic
1186782969 X:12931614-12931636 ATGAGTGGGCAATGGGAACATGG - Intergenic
1189805609 X:44732694-44732716 CTGAGTGTGCTTTGGGAACTGGG + Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1199606808 X:149584947-149584969 CTCAGTGCCCCCTGGGATCAAGG + Intronic
1199632315 X:149784421-149784443 CTCAGTGCCCCCTGGGATCAAGG - Intronic
1199883206 X:151993149-151993171 CTGAGTGAGGCCAGGTAACAAGG - Intergenic
1200867596 Y:8061611-8061633 CTGCCTGGGCCCTGGAAACAGGG + Intergenic
1202253257 Y:22894428-22894450 CTGCCTGAGCCCTGCCAACAGGG - Intergenic
1202255747 Y:22918431-22918453 CTGCCTGGGCCCTGGTAACAGGG + Intergenic
1202406247 Y:24528177-24528199 CTGCCTGAGCCCTGCCAACAGGG - Intergenic
1202408738 Y:24552180-24552202 CTGCCTGGGCCCTGGTAACAGGG + Intergenic
1202462045 Y:25117900-25117922 CTGCCTGGGCCCTGGTAACAGGG - Intergenic
1202464535 Y:25141904-25141926 CTGCCTGAGCCCTGCCAACAGGG + Intergenic