ID: 1104731955

View in Genome Browser
Species Human (GRCh38)
Location 12:131111803-131111825
Sequence ATTCTGTGTTTGATGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 638}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104731953_1104731955 27 Left 1104731953 12:131111753-131111775 CCAGAATTTTCATTTGGCTCTTT 0: 3
1: 11
2: 50
3: 242
4: 839
Right 1104731955 12:131111803-131111825 ATTCTGTGTTTGATGAGACAGGG 0: 1
1: 0
2: 2
3: 37
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104731955 Original CRISPR ATTCTGTGTTTGATGAGACA GGG Intronic
900725598 1:4214406-4214428 ATTCTTTTTTTGTTGAGACAAGG + Intergenic
901372024 1:8807056-8807078 ATTTTGTTGTTGTTGAGACAGGG + Intronic
901500346 1:9649093-9649115 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
902258892 1:15209074-15209096 TTTCTATGTTTGTTGAGACAGGG + Intronic
902347549 1:15829487-15829509 ATTCTATTTTTTTTGAGACAGGG + Intergenic
903117146 1:21187695-21187717 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
903611905 1:24621121-24621143 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
904080755 1:27871351-27871373 ATTCTTTTTTTTAAGAGACAGGG + Intergenic
904167773 1:28569386-28569408 ATTTTGTTTTTTAAGAGACACGG - Intronic
904850519 1:33455737-33455759 ATCCTGTTTTAGATGAGACTGGG + Intergenic
905777723 1:40680121-40680143 TTTGTTTGTTTTATGAGACAGGG - Intergenic
906016944 1:42590566-42590588 ATTATTTTTTTGTTGAGACAAGG - Intronic
906375423 1:45292814-45292836 TTTATGTATTTAATGAGACAGGG - Intronic
906472560 1:46143448-46143470 GTTTTGTGTTTTTTGAGACAGGG + Intronic
907002421 1:50874951-50874973 TTTCTGTTTTTGTAGAGACAGGG + Intronic
907224150 1:52928764-52928786 TTTTTGTTTTTGTTGAGACAAGG - Intronic
907348255 1:53802669-53802691 CTTCTGTATTTTAAGAGACAGGG - Intronic
908000866 1:59677531-59677553 TTTATGTGCTTGAGGAGACAGGG + Intronic
909189541 1:72535360-72535382 TTTTTGTATATGATGAGACATGG + Intergenic
909332383 1:74428934-74428956 ATTCTGTTTTTACAGAGACAGGG - Intronic
909560657 1:77006159-77006181 TTTATTTGTTTGTTGAGACAGGG + Intronic
909797093 1:79754515-79754537 TTTCTTTGTTTTTTGAGACAGGG - Intergenic
909916188 1:81322862-81322884 TTTGTTTGTTTGTTGAGACACGG + Intronic
910672746 1:89789447-89789469 ATTTTGTTCTTTATGAGACAGGG - Intronic
911609470 1:99944827-99944849 GTTCATTGTTTGTTGAGACAAGG + Intergenic
912317322 1:108678029-108678051 TTTATTTGTTTGTTGAGACAAGG + Intergenic
912586366 1:110770531-110770553 ATTGTGTGTCTGAGCAGACAGGG + Intergenic
914389045 1:147201782-147201804 ATTCTGTGTGTGATATGATAAGG + Intronic
915110280 1:153560136-153560158 ATTCTTTTTTTTTTGAGACAGGG - Intergenic
916552292 1:165860433-165860455 ATTCTTTTTTTTTTGAGACAGGG + Intronic
916860936 1:168804336-168804358 GTTTTGTGTTTGGTGTGACAGGG + Intergenic
917147656 1:171910060-171910082 ATTCTGTCTTCCATGAGAAAAGG - Intronic
917392033 1:174547691-174547713 ATTCTGTGTTCTTTTAGACATGG + Intronic
917760455 1:178151558-178151580 ATTCGGTGTTTGCAGTGACATGG + Intronic
917943490 1:179946471-179946493 ATTTTATGTTTTTTGAGACAGGG - Intergenic
918234635 1:182569021-182569043 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
918453314 1:184682289-184682311 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
918726575 1:187933139-187933161 ATTCTTTTTTTTTTGAGACAGGG - Intergenic
919999449 1:202786014-202786036 TTTCTGTTTTTTAAGAGACAAGG + Intronic
921056269 1:211544904-211544926 ATACTTTGTTTTTTGAGACAGGG + Intergenic
921320404 1:213933020-213933042 ATTCAGTGTTTGTAGAGTCATGG + Intergenic
921376962 1:214484556-214484578 GTTCCATGTTTGATGAAACAAGG + Intronic
921426704 1:215011297-215011319 TTTCTTTTTTTGTTGAGACAGGG + Intronic
922017419 1:221664778-221664800 ATTTTTTTTTTTATGAGACATGG + Intergenic
922128943 1:222757603-222757625 TTTTTGTTTTTGTTGAGACAGGG - Intergenic
922165595 1:223113210-223113232 TTTCTGTTTTTTTTGAGACAGGG + Intronic
922481632 1:225943395-225943417 AGTGTGTGTTTGAGGAGGCATGG + Intergenic
922660180 1:227423238-227423260 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
923164515 1:231346933-231346955 ATTCTTTTTTTTTTGAGACAGGG - Intronic
923558224 1:235018606-235018628 ATTCTTTTTCTGTTGAGACATGG - Intergenic
923679100 1:236104706-236104728 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
923844910 1:237719248-237719270 ATTTTGTGTTTTTTGAGACAGGG - Intronic
924206998 1:241723144-241723166 ATTCTGTGATTGATGTGCTAAGG - Intronic
1062796684 10:350092-350114 ATTCGCTGTTTTTTGAGACAGGG + Intronic
1063071882 10:2674971-2674993 ATTTTGTGTTTAATGGGAAACGG - Intergenic
1063476904 10:6336740-6336762 TTTCTTTTTTTGTTGAGACAGGG + Intergenic
1063568135 10:7190720-7190742 ATTATGTGCTTGATCAGAGAGGG + Intronic
1063639311 10:7814870-7814892 CGTCTGTGTATGATGACACAGGG - Intergenic
1063996211 10:11622434-11622456 ATTTTGTTTTTTTTGAGACAGGG - Intergenic
1064076823 10:12275613-12275635 GTTTTTTGTTTTATGAGACAGGG + Intergenic
1064757397 10:18583652-18583674 ATTCTCTATTTGATGAAACATGG - Intronic
1065173258 10:23052784-23052806 AATCTGAGTTTTATAAGACACGG - Intergenic
1065415622 10:25482188-25482210 ATTCTTTTTTTTAAGAGACAGGG + Intronic
1066073280 10:31844537-31844559 CTTGTTTGTTTGTTGAGACAGGG + Intronic
1066077849 10:31898115-31898137 ATTCTGTAGTTGTTGAGACAAGG - Intronic
1066130755 10:32391095-32391117 ATTATGTTTTTGTAGAGACAGGG + Intergenic
1066382293 10:34911877-34911899 TTTATTTGTTTGTTGAGACATGG - Intergenic
1066474894 10:35737650-35737672 ATTCTGTGTCTGGTGAGAATTGG + Intergenic
1066499217 10:35973854-35973876 ATTCTGCATTTGATGGGCCAGGG + Intergenic
1067111312 10:43403015-43403037 ATTCTGTTTTTGAAAAGATAGGG + Intronic
1068108337 10:52647904-52647926 ATTTTGTGTGTGTAGAGACAGGG - Intergenic
1068862903 10:61865967-61865989 ATTTTGTATTTGTAGAGACAGGG + Intergenic
1069091906 10:64209676-64209698 GTTTGGTGTTTGATGAGCCAAGG + Intergenic
1069382937 10:67859269-67859291 TTTCTTTCTTTGTTGAGACAGGG + Intergenic
1069468255 10:68661496-68661518 ATTTTCTGTTTTTTGAGACAGGG + Intronic
1069492202 10:68870709-68870731 ATTCTGTGTTTGAAGATGAAGGG + Intronic
1069580780 10:69565012-69565034 ATTTTTTGTTTTTTGAGACAGGG - Intergenic
1070615382 10:77965846-77965868 ATTTTTTGTTTTTTGAGACAGGG + Intergenic
1070996868 10:80792330-80792352 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1071049210 10:81426252-81426274 CTCCTGTATTTGATGAGTCAAGG - Intergenic
1071178469 10:82955208-82955230 ATTCTGTGTCTGAGGAAAGATGG + Intronic
1071229255 10:83565497-83565519 GTTTTTTGTTTGTTGAGACAGGG - Intergenic
1071396256 10:85226983-85227005 AGACTGTATTTGAGGAGACAAGG + Intergenic
1072475009 10:95751544-95751566 ATTTTGTGTTAGGAGAGACAGGG - Intronic
1072572618 10:96672030-96672052 TTTCTTTGTTTTTTGAGACAGGG - Intronic
1073752877 10:106549755-106549777 GTTGTTTGTTTGCTGAGACAAGG - Intergenic
1073802713 10:107060039-107060061 ATTCTGTGTATGAGGACACATGG - Intronic
1075251359 10:120877608-120877630 GTTTTGTGTTTTTTGAGACAGGG - Intronic
1075293309 10:121249802-121249824 ATTTTATGTTTGATGAAATATGG - Intergenic
1075758250 10:124833456-124833478 GTTTTCTGTTTGTTGAGACAGGG - Intronic
1075856678 10:125635878-125635900 ATTTTTTGTTTTTTGAGACAAGG + Intronic
1076003014 10:126927443-126927465 ATTCTTTTTTTTTTGAGACAGGG + Intronic
1076173661 10:128346263-128346285 ATTTTGTTGTTGTTGAGACAGGG + Intergenic
1076246777 10:128953198-128953220 TTTCTTTCTTTGTTGAGACAAGG + Intergenic
1077629619 11:3802302-3802324 ATTCTGGGAATGATGAGCCATGG - Intronic
1077865260 11:6217043-6217065 ATTCTGTGTTTGATGTTTCCTGG - Intronic
1078123630 11:8536783-8536805 TTTGTTTGTTTGAAGAGACAAGG + Intronic
1079050706 11:17156391-17156413 TTTCTTTGTTTTTTGAGACAAGG + Intronic
1079057310 11:17217383-17217405 ATTCTTTTTTTTAAGAGACATGG - Intronic
1079113220 11:17619263-17619285 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1080430942 11:32199126-32199148 ATTCTGTCGTTGTTGAGACAGGG - Intergenic
1080792149 11:35531045-35531067 GATCTGTGATTGATGATACATGG + Intergenic
1081439268 11:43062503-43062525 ATTCTGCAGTTGGTGAGACAAGG - Intergenic
1081848306 11:46257219-46257241 CTTTTGTTTTTAATGAGACAGGG + Intergenic
1082938295 11:58676924-58676946 ATTCTGTGTTTTTAGACACAGGG + Intronic
1083064001 11:59904917-59904939 ATTTTGTTTTTCAAGAGACAGGG + Intergenic
1083212994 11:61200717-61200739 TCTCTCTGTTTTATGAGACAGGG - Intergenic
1083697558 11:64452913-64452935 ATTTTTTGTTTTTTGAGACAGGG + Intergenic
1083979884 11:66158526-66158548 TTTCTGTTTTTGTAGAGACAGGG - Intronic
1084026921 11:66456413-66456435 ATTCTGAGGTAGATTAGACAGGG + Intronic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1084875954 11:72133667-72133689 CTTCTTTTTTTGCTGAGACAGGG + Intronic
1085006580 11:73097006-73097028 TTTTTTTTTTTGATGAGACAGGG + Intronic
1085126648 11:74006713-74006735 ATTCTTTGCATGATGTGACAGGG - Intronic
1086003484 11:82007956-82007978 ATTCTGTGTTAAAAGAGAAAAGG - Intergenic
1087084629 11:94204113-94204135 ATTTTATGTTTTAAGAGACAGGG - Intergenic
1087943715 11:104132716-104132738 ATTCTGGGTTAGATGAGAAAAGG - Intronic
1088118611 11:106340995-106341017 ATCCTGTGCTTTAAGAGACAAGG - Intergenic
1088774154 11:113066014-113066036 TTACTGTGATTCATGAGACAGGG + Intronic
1089042181 11:115462527-115462549 ATTCTGTGTGAGATGAGATGCGG - Intronic
1089464460 11:118675708-118675730 TTTGTTTGTTTGTTGAGACAGGG + Intronic
1089644695 11:119871081-119871103 TTTCTGTGTTTGAGGAGCAAAGG + Intergenic
1091240331 11:134047723-134047745 TTTGTGTGTGTGATGAGTCAGGG - Intergenic
1091472024 12:737047-737069 ATTCTTTATTTGCTGAGGCATGG + Intergenic
1092522385 12:9288204-9288226 CTTCTGTGTTTCATTAGCCATGG - Intergenic
1092544898 12:9443658-9443680 CTTCTGTGTTTCATTAGCCATGG + Intergenic
1092678578 12:10950881-10950903 AATGTGTGTTTGTTCAGACATGG - Intronic
1092959022 12:13578309-13578331 ATTGTGGGATTGCTGAGACAAGG + Intronic
1093473810 12:19533175-19533197 TTTTTGTGTTTTTTGAGACAAGG - Intronic
1094015073 12:25854261-25854283 TTTGTTTGTTTTATGAGACAAGG + Intergenic
1094022432 12:25928323-25928345 TTTGTTTGTTTTATGAGACAGGG - Intergenic
1094048333 12:26192619-26192641 AATCTGTGTTTGAGGAGGCCTGG - Intronic
1094082574 12:26553610-26553632 TTTCTGTTTTTTAAGAGACAGGG - Intronic
1094119743 12:26958352-26958374 TTTCTGTTTTTTAAGAGACAGGG - Intronic
1094406734 12:30124324-30124346 ATTCATTGTTGGAGGAGACAAGG - Intergenic
1094508052 12:31078392-31078414 CTTCTGTGTTTCATTAGCCATGG - Exonic
1094686089 12:32716339-32716361 ATTTTTTGTTTATTGAGACAGGG + Intronic
1095390014 12:41694920-41694942 ACTATGTGTATGATAAGACAGGG + Intergenic
1095618150 12:44217263-44217285 ATTATTTGTTTTATGAGCCATGG + Intronic
1096456516 12:51791869-51791891 ATTTTGTATTTTTTGAGACAGGG - Intronic
1097109519 12:56647887-56647909 TTTCTTTTTTTGTTGAGACAGGG - Intergenic
1097532033 12:60813604-60813626 ATTCTGTTTTTACTAAGACAAGG - Intergenic
1099660430 12:85551486-85551508 AGTCTGTGTTTGATGTGATGCGG - Intergenic
1100527174 12:95430741-95430763 GTTGTTTGTTTGTTGAGACACGG + Intergenic
1100874249 12:98945486-98945508 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1101195550 12:102378249-102378271 ATACTGTGATTGAGGAGACAAGG - Intergenic
1101586990 12:106093803-106093825 TTTGTTTGTTTGTTGAGACAGGG + Intronic
1101720760 12:107348716-107348738 TTTCTCTTTTTTATGAGACAGGG - Intronic
1102285048 12:111649159-111649181 ATTTTATTTTTGTTGAGACAGGG + Intronic
1102356332 12:112239362-112239384 ATTTTGTGTTTGATTGCACATGG - Intronic
1102671246 12:114620909-114620931 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
1102886035 12:116522685-116522707 GTTTTGTTTTTGTTGAGACAGGG + Intergenic
1103060090 12:117851579-117851601 ATTTTTTGTTTTTTGAGACAGGG - Intronic
1103078117 12:118001336-118001358 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
1103876201 12:124129282-124129304 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1104731955 12:131111803-131111825 ATTCTGTGTTTGATGAGACAGGG + Intronic
1105015003 12:132781256-132781278 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1105212979 13:18268250-18268272 AGCCTTTGTTTTATGAGACAGGG + Intergenic
1105369364 13:19789117-19789139 GTTTTTTTTTTGATGAGACAGGG - Intergenic
1106134925 13:26966944-26966966 TTTCTGAGCTTGGTGAGACAAGG - Intergenic
1107212969 13:37880435-37880457 TTTCTTTGTTTCTTGAGACAGGG + Intergenic
1107783589 13:43931704-43931726 TTTCTTTGTTTTTTGAGACAGGG + Intergenic
1108607013 13:52049777-52049799 ATACTGTGTATGATGAGGAATGG + Intronic
1109014113 13:56986617-56986639 TTTCTGTGTCTTATGAAACATGG + Intergenic
1109495396 13:63164243-63164265 TTTGTTTGTTTTATGAGACAGGG - Intergenic
1109912140 13:68927650-68927672 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
1111015363 13:82372993-82373015 TTTATTTGTTTTATGAGACAGGG - Intergenic
1111238071 13:85434488-85434510 ATTTTGAGTTTGATGAGAGCTGG - Intergenic
1111643830 13:91005194-91005216 ATTCTGTATTCAATGAGCCATGG + Intergenic
1112141437 13:96648289-96648311 AATCTGAGTTTGGTGAGAGATGG - Intronic
1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG + Intergenic
1113516061 13:110900037-110900059 TTTGAGTGTTTGAAGAGACAGGG - Intronic
1114151669 14:20047420-20047442 ATTCTTTATTTGCTAAGACATGG + Intergenic
1114680899 14:24482682-24482704 ATTTTGTGTTTTTAGAGACAGGG + Intergenic
1115801930 14:37004439-37004461 ATGCTGTGTTTGAGGACACCTGG + Intronic
1116818498 14:49604902-49604924 TTTTTCTTTTTGATGAGACAAGG + Intronic
1117298490 14:54399807-54399829 ATTCAGTGTGTGTTTAGACAAGG + Intronic
1118141571 14:63089618-63089640 CTTTTGTGTTTTCTGAGACAGGG + Intronic
1118572327 14:67206173-67206195 GTTTTGTGTTTTTTGAGACAGGG - Intronic
1118928800 14:70220404-70220426 ATTTTGTATTTGTAGAGACAGGG - Intergenic
1119307023 14:73615725-73615747 TTTGTTTGTTTGTTGAGACAAGG - Intronic
1120562224 14:86009303-86009325 ATTCTTAGTGTGATGAGACAAGG + Intergenic
1121094727 14:91208740-91208762 ATTCTATTTTTTTTGAGACAGGG - Intronic
1121203527 14:92140905-92140927 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1121789503 14:96688429-96688451 ATTTTTTGTTTTTTGAGACAGGG - Intergenic
1121969283 14:98341823-98341845 TTTCTGAGTTTGGTGAGACCAGG - Intergenic
1122165595 14:99821189-99821211 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1122236134 14:100331589-100331611 GGTCAGTGTTTGATGAGCCATGG - Intergenic
1123026173 14:105425284-105425306 ATTATGTTTTTTTTGAGACAGGG + Intronic
1124190449 15:27571473-27571495 GTTGTTTGTTTGTTGAGACAGGG + Intergenic
1124952051 15:34332611-34332633 ATTTTGTGTTTTAGGAGAGATGG - Intronic
1125582609 15:40797361-40797383 TTTTTGTGGTTGATGAAACAGGG - Intronic
1126066454 15:44829785-44829807 ATAGTGTTTGTGATGAGACATGG - Intergenic
1127595237 15:60474946-60474968 GTTTTGTTTTTGAAGAGACATGG - Intronic
1127778501 15:62289521-62289543 TTTATGTGTTTATTGAGACAAGG - Intergenic
1128166078 15:65466143-65466165 TTTCTTTATTTGTTGAGACAAGG + Intronic
1129059289 15:72848028-72848050 ATTCTGAGTTGGATCAGTCAGGG + Intergenic
1129130655 15:73490686-73490708 ATTCTTTATTTTTTGAGACAAGG - Intronic
1129141691 15:73604446-73604468 TTTCTTTCTTTGTTGAGACAGGG - Intronic
1129339983 15:74879369-74879391 TTTCTGTTTTTTTTGAGACAGGG + Intergenic
1129343826 15:74904137-74904159 ATTCTGTGTGTGTTGAGGGAAGG + Intronic
1129457995 15:75685892-75685914 ATTTTTTGTTTTTTGAGACAGGG + Intronic
1130155105 15:81343717-81343739 TTTTTGTGTTTTTTGAGACAGGG - Intronic
1131236653 15:90702763-90702785 ATTTTGTTTTTGTAGAGACAGGG + Intergenic
1131276827 15:90989254-90989276 ATTTTTTGTTTTTTGAGACAGGG + Intronic
1131573175 15:93559986-93560008 AATCAGTGAATGATGAGACATGG - Intergenic
1131788081 15:95934539-95934561 TTTCTGTTTTTGTAGAGACAAGG + Intergenic
1131957418 15:97751087-97751109 ACTGTGTGTTTGTTGAGAAATGG - Intergenic
1133107469 16:3522050-3522072 TTTTTTTGTTTGTTGAGACAGGG - Intronic
1133168821 16:3967564-3967586 ATTTTTTTTTTGAAGAGACAGGG + Intronic
1133751457 16:8729295-8729317 TTTTTGTTTTTGTTGAGACAGGG - Intronic
1133939573 16:10297132-10297154 ATCCTGTGTTTTGGGAGACACGG + Intergenic
1134518428 16:14905719-14905741 GTTGTTTGTTTGTTGAGACAGGG - Intronic
1134555501 16:15160502-15160524 GTTGTTTGTTTGTTGAGACAGGG + Intergenic
1134706099 16:16304372-16304394 GTTGTTTGTTTGTTGAGACAGGG - Intergenic
1134747884 16:16602000-16602022 ATTCTTTTTTTGTTGAGACAGGG + Intergenic
1134961441 16:18407738-18407760 GTTGTTTGTTTGTTGAGACAGGG + Intergenic
1134965741 16:18490341-18490363 GTTGTTTGTTTGTTGAGACAGGG + Intronic
1134995861 16:18738107-18738129 TTTCTGTTTTTGTAGAGACAGGG - Intergenic
1134997585 16:18751659-18751681 ATTCTTTTTTTGTTGAGACAGGG - Intergenic
1135019005 16:18947962-18947984 TTTTTGTGTTTTTTGAGACAAGG + Intergenic
1135274034 16:21095769-21095791 ATACTGTTTTTTTTGAGACAGGG + Intronic
1135781662 16:25308209-25308231 TTTCTTTGTTTGTTGAAACAGGG - Intergenic
1136042937 16:27594623-27594645 ATTTTGTTTTTGTAGAGACAGGG + Intronic
1136181642 16:28556818-28556840 ATTTTGTTTTTGTAGAGACAGGG + Intronic
1136219445 16:28818963-28818985 TTTTTGTGGTTGTTGAGACAGGG - Intergenic
1136509993 16:30731687-30731709 TTTCAGTTTTTGAGGAGACAGGG - Intronic
1137510472 16:49095322-49095344 GTTCTACGTTTAATGAGACATGG + Intergenic
1137599837 16:49749143-49749165 CTTCTGTCTTTGGTGAGACTTGG - Intronic
1137640289 16:50023131-50023153 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
1138921267 16:61532132-61532154 ATTCTGTTTTTGATGATTTATGG + Intergenic
1139076934 16:63462980-63463002 ATTCTGTGATCGATAAGAAAAGG + Intergenic
1139389715 16:66599492-66599514 TTTGTTTGTTTGTTGAGACAAGG + Intergenic
1140081068 16:71747974-71747996 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1140445006 16:75019729-75019751 TTTGTTTGTTTGTTGAGACAGGG + Intronic
1140486541 16:75298144-75298166 ATTCTGTGTTTGTTTAAACTTGG + Intronic
1141958004 16:87385000-87385022 TTTGTTTGTTTGAAGAGACAGGG - Intronic
1142281715 16:89152144-89152166 ACTCTGTGTTGAATGAGACTGGG - Intronic
1142649605 17:1339356-1339378 ATTTTGTGTTTTAGGAGAGACGG - Intergenic
1142840593 17:2625934-2625956 TTTCTGTTTTTCTTGAGACAGGG - Intronic
1143084673 17:4406722-4406744 TTTTTGTGTTTTTTGAGACAGGG + Intergenic
1143231401 17:5358760-5358782 GTTTTGTGTTTTTTGAGACAGGG + Intronic
1144819533 17:18062032-18062054 CTTTTGGGTTTGATGAGCCAAGG - Intronic
1145247768 17:21280704-21280726 ATTTTTTGTTTTTTGAGACAGGG + Intergenic
1145849697 17:28080894-28080916 ATTGTGTTTTTTTTGAGACAGGG + Intronic
1146595231 17:34162638-34162660 TTTGTTTGTTTGTTGAGACAGGG + Intronic
1146774345 17:35599131-35599153 ATATTGTGTTTGATGAAATAGGG + Intronic
1146975001 17:37103701-37103723 TTTGTGTGTTTGTAGAGACAGGG - Intronic
1147349087 17:39826047-39826069 TTTTTTTGTTTGTTGAGACAGGG + Intronic
1147589477 17:41672588-41672610 GTTTTGTTTTTGAAGAGACAAGG + Intergenic
1147724503 17:42558222-42558244 TTTCTTTCTTTTATGAGACAGGG - Intergenic
1148168015 17:45497219-45497241 ATTTTGTTTTTTTTGAGACAGGG - Intergenic
1148280802 17:46345738-46345760 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1148303030 17:46563673-46563695 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1148807514 17:50271524-50271546 TTTCTTTGTTTGCAGAGACAGGG + Intronic
1149808267 17:59639945-59639967 ATTCTTTATTTATTGAGACAGGG - Intronic
1149886850 17:60348600-60348622 TTTCTGTTTTTGTAGAGACAGGG - Intronic
1150090609 17:62321629-62321651 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1150254302 17:63731869-63731891 CTTTTGTTTTTTATGAGACAGGG + Intronic
1150542886 17:66121848-66121870 ATTCTGTATTTGATGTGATATGG + Intronic
1150678259 17:67263451-67263473 TTTTTGTTTTTAATGAGACAGGG + Intergenic
1150727711 17:67665097-67665119 TTTGTTTGTTTGTTGAGACAGGG + Intronic
1150883174 17:69054347-69054369 ATTTTGTTTTTGTAGAGACAGGG - Intronic
1151366741 17:73622525-73622547 ATTCAGTGTTTGAGGAGGGAGGG + Intronic
1151751803 17:76043256-76043278 TTTCTGTCTTTCTTGAGACAGGG - Intronic
1152431575 17:80251122-80251144 ATTTTTTGTTTTTTGAGACAGGG - Intronic
1152692236 17:81724195-81724217 CTTCTTTGTTTATTGAGACAGGG - Intergenic
1153078899 18:1197489-1197511 ATTCTGTGTTTCCTCTGACAGGG + Intergenic
1153686237 18:7548558-7548580 ATTCTGTGTTTGAAAAGTAAAGG + Intergenic
1155467316 18:26152329-26152351 TTTTTGTGTTTTTTGAGACAGGG + Intronic
1155822854 18:30400013-30400035 ATTTTTTTTTTTATGAGACAGGG + Intergenic
1156086322 18:33409101-33409123 ATTGTTTGTTTTTTGAGACAGGG + Intronic
1157679063 18:49589466-49589488 ATTCTTTTTTTATTGAGACAGGG + Intronic
1158349680 18:56552328-56552350 CTTGTTTGTTTGTTGAGACACGG + Intergenic
1158908687 18:62038756-62038778 ATTTTGTTTTTGTAGAGACAGGG - Intergenic
1159348462 18:67237814-67237836 ATTCTGTGAATGATGAGAGTGGG + Intergenic
1160303890 18:77713197-77713219 ATTTTATGTTTTTTGAGACAGGG - Intergenic
1160736715 19:666095-666117 ATTCTATTTTTGTAGAGACAGGG - Intergenic
1160855811 19:1217218-1217240 ATTTTTTCTTTTATGAGACAGGG + Intronic
1161645219 19:5449125-5449147 GTTTTTTGTTTGTTGAGACAGGG + Intergenic
1161646875 19:5458509-5458531 TTTTTGTTTTTGTTGAGACAGGG - Intergenic
1161662754 19:5557336-5557358 ATTTTATTTTTGTTGAGACAGGG - Intergenic
1162239249 19:9335552-9335574 CTTCTTTTTTTGTTGAGACAAGG + Intronic
1162934863 19:13976987-13977009 TTTCTGTTTTTTTTGAGACAGGG - Intronic
1163045602 19:14639408-14639430 ATTCTTTTTTTTTTGAGACATGG + Intronic
1163523137 19:17803987-17804009 GTGCTGTGTTTTAAGAGACAGGG - Intronic
1163621390 19:18362850-18362872 ATTTTTTGTTTATTGAGACAGGG - Intronic
1164052669 19:21596432-21596454 ATACTGTGTATTATGACACATGG + Intergenic
1164187684 19:22885444-22885466 TTTCTGTGTTTGCTGCTACAAGG + Intergenic
1164826432 19:31287939-31287961 TTTCTGTTTTTTTTGAGACAGGG + Intronic
1164948960 19:32320062-32320084 ATTTTGTTTTTGTGGAGACAGGG + Intergenic
1165237056 19:34429827-34429849 TTTCTTTGTTTTTTGAGACAGGG - Intronic
1165440143 19:35821368-35821390 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
1165484488 19:36087199-36087221 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1166067615 19:40369353-40369375 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1166707734 19:44917569-44917591 TTTCTTTTTTTGTTGAGACAGGG - Intronic
1166822045 19:45586561-45586583 ATTTTATGTTTTTTGAGACAGGG - Intronic
1166891111 19:45994002-45994024 TTTCTTTGTTTGCTGAGACAGGG - Intergenic
1167015864 19:46840621-46840643 TTTTTGTGTTTTTTGAGACAGGG - Intronic
1167168135 19:47813319-47813341 GTTGTTTGTTTGTTGAGACAGGG - Intronic
1167589469 19:50395848-50395870 ATCCTCTGGTTGATTAGACAAGG - Intronic
1168256862 19:55171591-55171613 ATTCTGTATGGGATGAGATAAGG + Exonic
1168292708 19:55364656-55364678 ATTCTTTCTTTTTTGAGACAGGG + Exonic
925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG + Intronic
926191430 2:10730957-10730979 ATTTTTTTTTTCATGAGACAGGG + Intronic
927169784 2:20359503-20359525 ATTTTTTGTTTGTAGAGACAGGG + Intergenic
927535188 2:23851149-23851171 ATTTTTTGTTTTCTGAGACAGGG + Intronic
927735381 2:25516251-25516273 TTTCTTTCTTTGTTGAGACAGGG + Intronic
927808153 2:26166471-26166493 TTTGTTTGTTTTATGAGACAGGG + Intergenic
928070746 2:28213048-28213070 ATTTTTTGTTTGTAGAGACAGGG - Intronic
928353935 2:30590555-30590577 ATTCTGGGAGTGATGAGGCATGG + Intronic
928642873 2:33319091-33319113 ATTTTTTGTTTTAAGAGACAGGG - Intronic
928929322 2:36607887-36607909 TTTTTGTGTTTTAAGAGACAGGG - Intronic
929940650 2:46331347-46331369 GGTCTTTGTTTGATGAGCCAGGG - Intronic
930065801 2:47326654-47326676 TTTATTTGTTTGTTGAGACAAGG - Intergenic
930075419 2:47402152-47402174 ATTTTGTATTTTTTGAGACAGGG + Intergenic
930472338 2:51834022-51834044 ATTCTGAGTTTGTTTAGAAAAGG + Intergenic
931375001 2:61699080-61699102 ATTATTTGTTTTTTGAGACAGGG + Intergenic
932726424 2:74183492-74183514 AATATTTGTTTGTTGAGACAGGG - Intergenic
933413362 2:81952332-81952354 ATTCAGTCTTGGATGAGACTTGG - Intergenic
933574113 2:84047573-84047595 CTTCTATTTTTGTTGAGACAAGG - Intergenic
933825135 2:86152751-86152773 ATTCTTTTTTTTTTGAGACAAGG - Intronic
933874951 2:86610339-86610361 ATTCTGTATTAGCTGAGAAATGG - Intronic
934601694 2:95663102-95663124 AATCTGCCTTTAATGAGACAGGG - Intergenic
935042440 2:99446264-99446286 ATTTTGTATTTGAGGAGACAGGG - Intronic
937396277 2:121538241-121538263 ATTTTGTATTTGATTAGAGACGG - Intronic
937944888 2:127323679-127323701 ATTTTTTGTTTTAAGAGACAAGG - Intronic
940358984 2:152777030-152777052 ATTTTGTGTTTTTTGAGACAGGG + Intergenic
941290661 2:163669386-163669408 ATTTTGTATTTGTTGAGACAGGG + Intronic
941304108 2:163839849-163839871 TTTCTTTGTTTTACGAGACAGGG - Intergenic
941886592 2:170534450-170534472 TTTGTTTGTTTGTTGAGACAGGG + Intronic
942677949 2:178448583-178448605 ATTCTTTTTTTTTTGAGACAGGG - Intronic
943267510 2:185753469-185753491 ATTCAGTTTCTGATCAGACAGGG - Intronic
944510869 2:200464650-200464672 ATTATCAGTTTGATGAGACAGGG + Intronic
944626928 2:201580018-201580040 ATTCTATGTGTGTAGAGACAGGG + Intronic
944822704 2:203446748-203446770 ATCTTGTGTTTTGTGAGACAGGG + Exonic
945156394 2:206844043-206844065 ATTCTGTGTTTGCAGTGAGAGGG + Intergenic
946303405 2:218840306-218840328 ATTTTTTTTTTGAAGAGACAGGG - Intergenic
946429018 2:219614820-219614842 CTTCTGTGACTGATGAGGCAGGG - Intronic
947111682 2:226725423-226725445 ATTCTGTGATTGCAGAGAAATGG - Intergenic
1168992477 20:2106320-2106342 ATTCTGAGTTTTAGGAGGCAGGG - Intronic
1169386514 20:5154652-5154674 TTTGTTTGTTTTATGAGACAAGG + Intronic
1169557266 20:6764619-6764641 TTTTGGTGTTTGATTAGACATGG - Intergenic
1169759710 20:9078151-9078173 TTTCTGTTTTTGTAGAGACAGGG + Intronic
1170238232 20:14132218-14132240 ATTTTTTTTTTGTTGAGACAGGG + Intronic
1170777044 20:19384483-19384505 ATTCTTTGTTTGCTAAAACATGG - Intronic
1170812828 20:19687903-19687925 CTCCTGTGTATGAGGAGACATGG + Intronic
1172085717 20:32380737-32380759 TTTCTTTGTTCGTTGAGACAGGG - Intronic
1172290390 20:33771841-33771863 TTTCTATTTTTGTTGAGACAAGG - Intronic
1172492319 20:35349984-35350006 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1172675526 20:36668233-36668255 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1172849525 20:37950836-37950858 ATTCTGGGGTTGAAGAGACTGGG - Intergenic
1173269758 20:41522337-41522359 ATTTTGTTTTTTTTGAGACAGGG - Intronic
1173957335 20:47044007-47044029 AATCTGTGTTTTTGGAGACAGGG + Intronic
1173993573 20:47321022-47321044 CTTCTGGGTTTGCAGAGACATGG + Intronic
1174530787 20:51212003-51212025 ATTGTGTGTTTGTTGAGAGTGGG + Intergenic
1175352862 20:58337930-58337952 ATTTTGTTTTTGATGTGAAATGG + Intronic
1175666659 20:60867170-60867192 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1176165885 20:63673443-63673465 TTTGTTTGTTTGTTGAGACAGGG + Intronic
1176175276 20:63719649-63719671 ATTCTCTATTTGGTTAGACATGG + Intronic
1176224875 20:63991249-63991271 ATTTTGTTTTTGTAGAGACAGGG - Intronic
1176851341 21:13918564-13918586 ATTTTGTGTTTTTTGAGATAGGG - Intergenic
1177172696 21:17671436-17671458 AATCAGTGTTTCATGTGACATGG - Intergenic
1178403672 21:32307865-32307887 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1179013058 21:37571384-37571406 GTTCTGTATTTGGTGAGACATGG + Intergenic
1179171083 21:38973292-38973314 TTTCTGTGTCTACTGAGACATGG - Intergenic
1179360485 21:40703510-40703532 TATGTGTGTTTTATGAGACAGGG - Intronic
1179648517 21:42791275-42791297 TTTCTTTTTTTGTTGAGACAGGG - Intergenic
1179778242 21:43681947-43681969 ATTCTTTCTTTTTTGAGACAGGG - Intronic
1179804545 21:43828919-43828941 TTTCTTTGTTTTTTGAGACAAGG - Intergenic
1180815803 22:18788576-18788598 AGCCTTTGTTTTATGAGACAGGG + Intergenic
1181201991 22:21222911-21222933 AGCCTTTGTTTTATGAGACAGGG + Intronic
1181699759 22:24614041-24614063 AGCCTTTGTTTTATGAGACAGGG - Intronic
1181981018 22:26766495-26766517 ATTTTGTTTTTGTAGAGACAGGG + Intergenic
1183572639 22:38665456-38665478 GTTTTGTGTTTCTTGAGACAGGG - Intronic
1183900761 22:41004229-41004251 ATTTTGTTTTTTGTGAGACAGGG + Intergenic
1183920115 22:41159679-41159701 TTTCTTTCTTTGTTGAGACAGGG + Intronic
1184561235 22:45264032-45264054 ATTCTGTGTGAGATGAGAACAGG - Intergenic
1184622553 22:45693171-45693193 GTTCTGTATTTCATGAGATAGGG + Intronic
1203224920 22_KI270731v1_random:72517-72539 AGCCTTTGTTTTATGAGACAGGG - Intergenic
1203265908 22_KI270734v1_random:14269-14291 AGCCTTTGTTTTATGAGACAGGG + Intergenic
949259631 3:2090425-2090447 ATTCTGTATTTGAAGCAACATGG + Intergenic
949341498 3:3035561-3035583 CTGCTGTGTTTTTTGAGACAGGG + Intronic
949399555 3:3651752-3651774 ATTCAGTGAGTGAGGAGACATGG - Intergenic
949572547 3:5307443-5307465 TTTCTGTCTTTTTTGAGACAGGG - Intergenic
949637836 3:6003272-6003294 ATTGTTTGTTTTTTGAGACAGGG - Intergenic
950722684 3:14895578-14895600 TTTGTTTGTTTTATGAGACAGGG + Intronic
950831776 3:15881888-15881910 ATTATGTTTTTGTAGAGACAGGG + Intergenic
951236792 3:20245556-20245578 ATTTTCTGTTTGATGACACTTGG - Intergenic
952173389 3:30834632-30834654 ATTCAGTGTATGATGAGACATGG + Intronic
952404492 3:32993360-32993382 ATTCTTTCTTTTTTGAGACAGGG + Intergenic
952416988 3:33098118-33098140 TTTTTGTGTTTTTTGAGACAGGG + Intergenic
952868588 3:37876235-37876257 ATTTTTTTTTTAATGAGACACGG - Intronic
953090157 3:39716541-39716563 TTTTTTTGTTTTATGAGACAGGG - Intergenic
953133768 3:40165426-40165448 ATTCTTTGTGGAATGAGACAGGG - Intronic
953876392 3:46669205-46669227 ATTTTGTATTTGTAGAGACAGGG + Exonic
954062390 3:48079156-48079178 TTTGTGTGTTTTTTGAGACAGGG - Intronic
954252960 3:49382627-49382649 AATCTTTATTTGGTGAGACAGGG - Intronic
954903067 3:54036326-54036348 TTTGTTTGTTTGTTGAGACAAGG - Intergenic
955121586 3:56065228-56065250 TTTCTTTATTTTATGAGACAGGG + Intronic
955368265 3:58330141-58330163 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
955830722 3:63000355-63000377 ATTCTGGTTTTGATGTAACAGGG + Intergenic
955920278 3:63947845-63947867 TTTCTGGGTTTGAGGAGAGAAGG + Intronic
956854488 3:73262533-73262555 TTTGTGTTTTTGAAGAGACAGGG + Intergenic
957204775 3:77182482-77182504 ATTCTGTCTGAGATGGGACAGGG + Intronic
957470281 3:80650189-80650211 ATTCTGTAATTGATAAGACCAGG + Intergenic
957473553 3:80693516-80693538 TTTGTGTGTTTGTTGAGACAAGG + Intergenic
957695530 3:83634052-83634074 TTTCTGTTATTCATGAGACAGGG - Intergenic
957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG + Intergenic
958170624 3:89935118-89935140 GTTCTCTGTTTTTTGAGACAGGG + Intergenic
958564353 3:95789144-95789166 ACACTGTGTTTGAAGAAACATGG - Intergenic
958630755 3:96680239-96680261 TTTTTGTATATGATGAGACATGG + Intergenic
959430960 3:106254559-106254581 ATTCTGTGTTTGATGAGTGGAGG - Intergenic
959873612 3:111356691-111356713 ATTTTGTGGTTCATGAGAGAAGG + Intronic
960373425 3:116868971-116868993 AGTCTGTTCTTGATGATACATGG + Intronic
960391176 3:117079318-117079340 ATTTTGTGATTGAAAAGACAAGG + Intronic
960436576 3:117634001-117634023 TTTATTTGTTTGTTGAGACAGGG + Intergenic
960638279 3:119805187-119805209 TTTCTGTGTTTGATAACTCAGGG + Intronic
961023743 3:123533153-123533175 ATTCTCTCTTTGATTGGACAGGG + Intronic
961405628 3:126677889-126677911 ATTCTTTTTTTGTAGAGACAGGG + Intergenic
961693957 3:128691123-128691145 TTTGTTTGTTTTATGAGACACGG + Intergenic
961838781 3:129689242-129689264 ATAGTGTGTGTGATGATACAGGG - Intronic
962184353 3:133242695-133242717 GTTCCGTGTTTGATGAGAAGAGG + Intronic
963470327 3:145733051-145733073 ATACTGTATTTGATGAGAACAGG + Intergenic
963909382 3:150802452-150802474 ATTTTGTGTTCGATGACAAAAGG - Intergenic
963972383 3:151444099-151444121 ATTTTTTGTTTGTAGAGACAGGG - Intronic
964201839 3:154126226-154126248 ATTCTGTAGTTGATGAGAAAAGG + Intronic
964538415 3:157752117-157752139 TTTCTTTGTTTTTTGAGACAGGG + Intergenic
966404152 3:179578136-179578158 TTTCTGTTTTTGTAGAGACAGGG - Intronic
966478917 3:180382948-180382970 AATCTGCCTTTGATGTGACAAGG + Intergenic
966777910 3:183559140-183559162 TTTGTTTGTTTGTTGAGACAAGG - Intergenic
967160704 3:186735309-186735331 ATTCTTTTTTTGTAGAGACAGGG - Intronic
968095046 3:195923406-195923428 CTTCTGTCTTTTTTGAGACAGGG - Intergenic
968821795 4:2858812-2858834 ATTCTTTGTTTGTTGAGCCATGG - Intronic
969326157 4:6445180-6445202 ATTTTGCTTTTGTTGAGACAGGG - Intronic
969358228 4:6644042-6644064 TTTTTGTTTTTGGTGAGACAGGG + Intergenic
969547190 4:7838005-7838027 TTTCTTTGTTTGTTGAAACAAGG - Intronic
971127103 4:23765968-23765990 CCTCTGTGGTGGATGAGACAAGG - Intronic
971662029 4:29431003-29431025 ACTATTTGTTTGATGAAACAAGG + Intergenic
971663030 4:29445144-29445166 TTTCTTTCTTTGAAGAGACAAGG + Intergenic
972083896 4:35188696-35188718 ATTCTTTGTTTTATCAGACACGG + Intergenic
972086954 4:35229841-35229863 ATTTGGTGTTTGATGAGAAGAGG + Intergenic
972480827 4:39494229-39494251 ATTCACTGTCTGAAGAGACATGG - Intergenic
972792799 4:42389108-42389130 TTTATTTGTTTGTTGAGACAGGG - Intergenic
973545618 4:51978673-51978695 CTTCTGTCTTTGATCATACAAGG - Intergenic
973800315 4:54471194-54471216 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
973958388 4:56086282-56086304 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
975576541 4:75868688-75868710 TTTTTGTGTTTTTTGAGACAGGG - Intronic
976405911 4:84660064-84660086 ATTCTTTATTTTTTGAGACAGGG - Intergenic
977379755 4:96257236-96257258 ATTCTATTTTTGTAGAGACAGGG + Intergenic
978162061 4:105560883-105560905 CTTCTGTGTTTGTTGTGAAATGG + Intronic
978346477 4:107775385-107775407 TTTCTTTTTTTGGTGAGACAGGG - Intergenic
979683849 4:123489695-123489717 TTTCTTTGTTTGTAGAGACATGG + Intergenic
980143143 4:128946563-128946585 ATTCTATTTTTTAAGAGACAAGG - Intronic
981017967 4:139994014-139994036 TTTTTGTGTTTCATGTGACATGG + Intronic
981539179 4:145831244-145831266 ATTCTGTATTTGACCATACAAGG + Intronic
981903624 4:149894282-149894304 TTTCTTTTTTTTATGAGACAGGG - Intergenic
981944941 4:150330643-150330665 ATGCTGTGGCTGATGTGACAGGG + Intronic
982038196 4:151367897-151367919 TTTCTGTATTTGATAGGACATGG - Intergenic
982638966 4:157932941-157932963 ATCATGAGTTTTATGAGACACGG - Intergenic
983355444 4:166651477-166651499 TTTCTTTGTTTTTTGAGACAGGG + Intergenic
985010627 4:185578968-185578990 ATTTTTTATTTTATGAGACAGGG + Intergenic
985050398 4:185985421-185985443 TTTCTGTTTTTGTAGAGACAGGG + Intergenic
985822963 5:2172824-2172846 ATCCAGTGTTTGATGGGCCACGG - Intergenic
986561494 5:9064718-9064740 CTTGTTTGTTTGTTGAGACAGGG - Intronic
986613180 5:9590205-9590227 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
987845034 5:23272713-23272735 ATTCTCTGTTTTGTGAGACCAGG - Intergenic
987851893 5:23365148-23365170 ATTTTGTATCTGATGTGACATGG - Intergenic
988659057 5:33244642-33244664 ATTGTGTTGTTAATGAGACAAGG - Intergenic
988723093 5:33898527-33898549 TATCTGTGGTTGGTGAGACATGG - Intergenic
988884959 5:35546678-35546700 ATTCATTGTTTTTTGAGACAGGG + Intergenic
989233952 5:39122397-39122419 ATTCTGTCTTTTGTTAGACATGG - Exonic
989477616 5:41892266-41892288 AACCTCTGTTTGATGTGACATGG - Intergenic
990894006 5:60677541-60677563 TTTCTTTTTTTTATGAGACAAGG + Intronic
991311903 5:65252898-65252920 ATTTTTTATTTGTTGAGACAGGG + Intronic
991928839 5:71731679-71731701 TTTGTTTGTTTGTTGAGACAAGG - Intergenic
991930015 5:71745124-71745146 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
993140501 5:84027086-84027108 TTTCTTTGTTTATTGAGACAGGG - Intronic
993722397 5:91334535-91334557 TTTCTGTTTTTTTTGAGACAGGG - Intergenic
994548032 5:101193563-101193585 ATTCTGTGATGTATGAGAAAAGG - Intergenic
994661290 5:102657445-102657467 ATTTTTTGTTTTTTGAGACAGGG + Intergenic
995825431 5:116292138-116292160 ATTTTTTTTTTAATGAGACATGG - Intronic
996367221 5:122715935-122715957 ATTTTTTTTTTGAGGAGACAGGG + Intergenic
997118430 5:131150408-131150430 ATTTTGTTTTTGTAGAGACAGGG + Intergenic
997145415 5:131428094-131428116 GTTGTTTGTTTGTTGAGACAAGG - Intronic
997174510 5:131760839-131760861 ATTCTGAGTTTGATGACAGGAGG + Intronic
998196674 5:140079263-140079285 ATTTTCTGTTTTTTGAGACAGGG - Intergenic
998938116 5:147252138-147252160 TTTTTGTTTTTGGTGAGACAGGG - Intronic
999031418 5:148297216-148297238 ATTCTGTGTGTCATGTGTCATGG - Intergenic
999342825 5:150787818-150787840 ATCCTGTGTTTGAGGAAATAAGG + Intronic
999725936 5:154437777-154437799 ATTCTTTTTTTTATGAGACAGGG - Intergenic
999901188 5:156088504-156088526 TTTGTTTGTTTGTTGAGACAAGG + Intronic
1000238214 5:159383342-159383364 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
1000457353 5:161467399-161467421 CTTCTGTCTTTCATAAGACAAGG + Intronic
1000985061 5:167857297-167857319 ATTCTGTTTTTCATAGGACATGG + Intronic
1001321142 5:170682799-170682821 TTTTTTTTTTTGATGAGACAGGG + Intronic
1002801285 6:523688-523710 ATTGTTTGTTTTTTGAGACAGGG + Intronic
1002866905 6:1129866-1129888 ATTTTGTTTTTGTAGAGACAGGG - Intergenic
1002872538 6:1179768-1179790 GTTCTGTCTTAGATGAGACTTGG + Intergenic
1002968415 6:1990582-1990604 ATTCTTTTTTTGTTGAGACAGGG + Intronic
1003211672 6:4073851-4073873 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1003893536 6:10585186-10585208 AGTAAGTGTTTGAAGAGACAGGG + Intronic
1003923648 6:10856463-10856485 TTTGTTTGTTTGTTGAGACAAGG - Intronic
1004584756 6:16988706-16988728 TTTCTTTGTTTTTTGAGACAGGG - Intergenic
1006270460 6:32961947-32961969 TTTTTGTATTTGATGAGAGATGG - Intronic
1006558060 6:34886280-34886302 AGTTTTTGTTTGTTGAGACAAGG - Intronic
1006979130 6:38132498-38132520 ATTTTGTTTTCTATGAGACAGGG - Intronic
1007149408 6:39673301-39673323 ATTCTGTATTATATGAGACTTGG - Intronic
1007564158 6:42835921-42835943 TTTCTTTGTTTTCTGAGACAGGG - Intronic
1007996261 6:46311409-46311431 ACTCTGGGTTTGATCAGAAATGG + Intronic
1008867397 6:56229359-56229381 ATTCTGTTGTTTTTGAGACAGGG - Intronic
1009638768 6:66302894-66302916 ATTGTTTGTTTTTTGAGACAGGG + Intergenic
1010238824 6:73597773-73597795 TTTCTTTGTTTTTTGAGACAGGG - Intronic
1011473534 6:87731194-87731216 ATTCTTTCTTTTTTGAGACAGGG + Intergenic
1011524467 6:88248431-88248453 GTTTTGTGTGTGAGGAGACAGGG - Intergenic
1011567946 6:88699656-88699678 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1012034655 6:94118408-94118430 ATTCTGTGTATTATGATACTGGG + Intergenic
1012225517 6:96699352-96699374 TTTCTTTGTTTATTGAGACAGGG + Intergenic
1012280816 6:97326660-97326682 TTTCTTTGTTTTTTGAGACAGGG + Intergenic
1012663556 6:101936563-101936585 ATTGTGTGTTAGATGAGGAAAGG - Intronic
1012695644 6:102378833-102378855 TTTCTTTGTTTTTTGAGACAGGG - Intergenic
1013095540 6:106941360-106941382 ATTCAGTGTTTTAGAAGACATGG + Intergenic
1013135690 6:107280674-107280696 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1013364143 6:109422580-109422602 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1013547350 6:111171128-111171150 TTTCTTTTTTTAATGAGACAGGG - Intronic
1013568262 6:111391980-111392002 ATTTTGTTGTTGTTGAGACAAGG - Intronic
1014083958 6:117320147-117320169 ATTGTGTGTTTTATGTGACACGG + Intronic
1014207239 6:118669465-118669487 ATTCTTTGTTAGATGAAGCATGG + Intronic
1014458587 6:121667723-121667745 TTTCTTTGTTTGTAGAGACAAGG + Intergenic
1015049541 6:128822810-128822832 CTTGTTTGTTTGTTGAGACAGGG - Intergenic
1015334326 6:132020173-132020195 CTTCTGTGTCTGAGGACACACGG - Intergenic
1016506830 6:144791398-144791420 AATGTGTTTTTGATGAGGCAAGG - Intronic
1016561077 6:145395745-145395767 AGTCTGTGTGTGGTGAGAGAAGG - Intergenic
1017441710 6:154470369-154470391 TTTTTGTGTTTGTAGAGACAGGG + Intronic
1017505974 6:155068922-155068944 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1018052442 6:160023082-160023104 ATCCTGTGCTTGTGGAGACATGG + Intronic
1018187769 6:161282022-161282044 ATTTTGTTTTTGTAGAGACAAGG + Intergenic
1018194118 6:161339613-161339635 ATTTTCTTTTTTATGAGACAGGG - Intergenic
1018993179 6:168690166-168690188 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
1019145763 6:169974535-169974557 AATCTGTCTTTGTTGAGACGTGG + Intergenic
1019509338 7:1409548-1409570 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
1020046974 7:5047390-5047412 TTTGTCTGTTTGTTGAGACAGGG - Intronic
1020292331 7:6731269-6731291 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
1020377964 7:7509135-7509157 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1021203030 7:17746645-17746667 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1022597947 7:31730677-31730699 TTTCTGTCCTTGATGAGCCAGGG + Intergenic
1025220706 7:57105141-57105163 CTTCTTTTTTTTATGAGACAAGG - Intergenic
1026059898 7:67016642-67016664 ATTATGTGTTTTTTGAGAGAGGG + Intronic
1026718206 7:72808431-72808453 ATTATGTGTTTTTTGAGACAGGG - Intronic
1027384005 7:77642286-77642308 GTTCTTTGTTTTTTGAGACAGGG + Intergenic
1027560074 7:79718443-79718465 ATTCTTTTTTTTTTGAGACAGGG - Intergenic
1028356154 7:89912290-89912312 CTTCTGTGTTTCAGGACACAAGG + Intergenic
1028387912 7:90280202-90280224 TTTGTTTGTTTGTTGAGACAGGG + Intronic
1028725863 7:94087045-94087067 ATTCTGTGTTTGATGATGTCAGG - Intergenic
1029244565 7:99189626-99189648 TTTGTTTGTTTGTTGAGACAGGG + Intronic
1029256852 7:99275168-99275190 TTTTTGTTTTTGAAGAGACAGGG + Intergenic
1029645214 7:101850750-101850772 CTGATGTGTTTTATGAGACATGG + Intronic
1030564936 7:111141874-111141896 ATTTTGTTTTTGTAGAGACAGGG + Intronic
1030796039 7:113789197-113789219 TTTCTTTCTTTGTTGAGACAAGG - Intergenic
1030821610 7:114099126-114099148 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1031023155 7:116650229-116650251 ATTCTGTATTTGTTGCCACAGGG + Intergenic
1031237934 7:119199987-119200009 ATTCTGTGGTTGATGGGTGAAGG - Intergenic
1031929164 7:127666785-127666807 GATCTGTGTTTGATGACAGAGGG + Intronic
1033110617 7:138571286-138571308 TTTCTTTCTTTGTTGAGACAGGG - Intronic
1033179279 7:139158905-139158927 ATTTTTTGTTTTTTGAGACAGGG - Intronic
1033346625 7:140530215-140530237 ATTTTGTTGTTGTTGAGACAGGG - Intronic
1033727310 7:144132627-144132649 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
1033899474 7:146117143-146117165 TTTCTGTTTTGGAAGAGACAGGG + Intronic
1034613617 7:152395189-152395211 GTTTTTTGTTTGTTGAGACAGGG + Intronic
1034630018 7:152523639-152523661 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
1034657412 7:152740606-152740628 AGGCTGTGTTGGATGAGATAAGG - Intergenic
1034787692 7:153940549-153940571 TTTCTGTGTGTCATGAAACATGG - Intronic
1035159129 7:156938359-156938381 ATTTTTTTTTTGAAGAGACAGGG - Intergenic
1036494429 8:9257196-9257218 TTTCTTTGTTTTTTGAGACAGGG + Intergenic
1037314323 8:17586382-17586404 ATTCTTTGTTTGATGTGACATGG - Intronic
1037645322 8:20787596-20787618 ATGGTGTGCTTGATGATACAGGG + Intergenic
1037800941 8:22035278-22035300 TTTGTTTGTTTAATGAGACAGGG + Intronic
1037923025 8:22821178-22821200 GTTTTTTGTTTGTTGAGACAGGG - Intronic
1038361207 8:26879696-26879718 ATTCTCTGTTTGTTGAGTCTGGG + Intergenic
1038550818 8:28466948-28466970 ATTCTGTTTTTTTAGAGACAGGG + Intronic
1038561990 8:28588804-28588826 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1038702043 8:29857818-29857840 ATTTTGTTTTTGTAGAGACAGGG - Intergenic
1038782880 8:30583384-30583406 ACTGTTTGTTTGTTGAGACAGGG + Intronic
1038856550 8:31339355-31339377 TTTCTATCTTTGATGAGTCAAGG + Intergenic
1039620563 8:38993447-38993469 ATTTTTTGTTTTAAGAGACAGGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041351863 8:56955011-56955033 TTTTTGTTTTTGTTGAGACAAGG - Intergenic
1041776311 8:61527013-61527035 TTTCTGTGTTCTATGAGAAATGG + Intronic
1042109976 8:65370609-65370631 TTTTTGTTTTTGTTGAGACAGGG - Intergenic
1042365496 8:67931868-67931890 AGTCTGTGGTTGAGGAGACATGG + Intergenic
1042448573 8:68918532-68918554 AGTCTCTGTTTGAAGAGACATGG + Intergenic
1042617163 8:70662692-70662714 ATTCTTTTTTTTTTGAGACAGGG + Exonic
1043225181 8:77718556-77718578 ACTCTATGATTGATGAGCCATGG + Intergenic
1043439425 8:80263968-80263990 GTTCTTTGTTTTTTGAGACAGGG + Intergenic
1043507487 8:80916641-80916663 ATTCTGTGATTTAAGATACATGG - Intergenic
1043579205 8:81692223-81692245 ATACTGTGTTAGATGTGATAGGG + Intergenic
1044317126 8:90763186-90763208 ATTCTGTGCTTGGAGAGTCAGGG + Intronic
1044547808 8:93479075-93479097 ATTTTTTTTTTAATGAGACAAGG + Intergenic
1044710029 8:95048185-95048207 ATTTTTTGTTTTTTGAGACAGGG - Intronic
1044995509 8:97834574-97834596 TGTGTGTGTTTGAAGAGACAGGG + Intronic
1045104223 8:98875635-98875657 CTTCTTTGTTGGAAGAGACATGG + Intronic
1045233207 8:100325929-100325951 ATTCTGTGAGTGTTCAGACATGG - Intronic
1045341985 8:101263289-101263311 GTTCTTTGTTTGTAGAGACAGGG + Intergenic
1046404612 8:113756465-113756487 ATTATTTGTTTTTTGAGACAAGG - Intergenic
1046441263 8:114257979-114258001 ATTTTGTATTTGATGAGGGATGG - Intergenic
1047162241 8:122393423-122393445 ATTCTCTGTTTAATGAAACATGG + Intergenic
1048047863 8:130790470-130790492 ATGCTGTGTTTCATTAGGCACGG - Intronic
1049132527 8:140860479-140860501 ATTTTGTTTTTGTTGAGACAGGG + Intronic
1049226821 8:141457154-141457176 TTTGTTTGTTTGCTGAGACAAGG - Intergenic
1049247223 8:141569337-141569359 ATTTTGTGTTTTGCGAGACAGGG + Intergenic
1049677894 8:143901088-143901110 ATTTTGTGTTTTTTGAGACAGGG + Intergenic
1049794735 8:144491923-144491945 ATTATGTTTTTTAAGAGACAGGG - Intronic
1051941392 9:22509305-22509327 TTTCTGTGTTAGATGTGAAATGG + Intergenic
1052295094 9:26889244-26889266 TTTCTGTTTTTTATTAGACACGG - Intronic
1052567473 9:30174891-30174913 TTTCTGTTTTTGAAGAGACGGGG - Intergenic
1052876074 9:33565469-33565491 ATTTTGTGTTTTTTGAGATATGG + Intronic
1053118919 9:35530644-35530666 TTTCTGTTTTTTATGAGACTGGG + Intronic
1053187862 9:36034220-36034242 ATTATGTTTTTCCTGAGACAGGG - Intergenic
1054146898 9:61568908-61568930 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1054323037 9:63692067-63692089 ATTCCTAGTTTGATGAAACATGG - Intergenic
1054754011 9:68938834-68938856 ATTCTGTGTTTGAAGACAGAGGG - Intronic
1054976275 9:71149394-71149416 GTTTTGTGTTTTTTGAGACAGGG - Intronic
1055077870 9:72235706-72235728 ATTCTCTTTTTTCTGAGACAAGG - Intronic
1055192048 9:73537013-73537035 ATGTTTTGTTTGATGAGAAAAGG + Intergenic
1055465872 9:76565225-76565247 ATTTTATTTTTTATGAGACAGGG - Intergenic
1055672795 9:78624129-78624151 TTTCTGTGTTTGTAGAGACAGGG + Intergenic
1055703168 9:78968780-78968802 TTTGTTTGTTTGTTGAGACAGGG - Intergenic
1056350811 9:85746869-85746891 ATTTTGTTTTTTTTGAGACAGGG + Intergenic
1056467694 9:86874262-86874284 ATTCTGGGTTTCATGAAATATGG + Intergenic
1056770232 9:89473079-89473101 ATACTTTATTTGTTGAGACAGGG - Intronic
1056936754 9:90920352-90920374 TTTCTGTATTTGAAGAGCCAAGG + Intergenic
1057558262 9:96106563-96106585 ATTCTCTATTTGATGGAACATGG + Intergenic
1058694995 9:107551508-107551530 TTTCTTTGTTTTTTGAGACAGGG + Intergenic
1059175126 9:112163151-112163173 TTTGTTTGTTTGTTGAGACAAGG + Intronic
1059306583 9:113358239-113358261 ATTTTTTGTTTTTTGAGACAGGG - Intronic
1059487162 9:114635670-114635692 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1060184469 9:121555659-121555681 ATTTTTTCTTTGTTGAGACAGGG + Intergenic
1060336402 9:122727263-122727285 CTTCTGTTTTTTAAGAGACAGGG + Intergenic
1060939136 9:127533625-127533647 GTTATGTGTGTGTTGAGACAGGG - Intronic
1061076841 9:128346693-128346715 ATTTTGTTTTTTTTGAGACAGGG - Intronic
1061337260 9:129948266-129948288 TTTGTTTGTTTGTTGAGACAGGG - Intronic
1061646326 9:132005055-132005077 AGTCTGTCTTTGATGAGGGAAGG - Intronic
1062659936 9:137624768-137624790 TTTCTGTTTTTGTAGAGACAGGG + Intronic
1062675040 9:137737654-137737676 ACACTGGGTTTGATGAGACTTGG + Intronic
1185784696 X:2880894-2880916 ACTTTGTTTTTAATGAGACAGGG - Intronic
1186816845 X:13246497-13246519 AGTCTGAGTTTAATGAGAAATGG - Intergenic
1186854981 X:13617768-13617790 ATTCTGTCTTTGATGGTACCAGG - Exonic
1186894316 X:13990740-13990762 TTTTTGTTTTTGTTGAGACAGGG + Intergenic
1187010285 X:15271429-15271451 ATTCTTTTTTTTTTGAGACAGGG + Intergenic
1187177349 X:16908537-16908559 ATTTTTTGTTTTCTGAGACAGGG - Intergenic
1187305911 X:18095057-18095079 AATCTGGGTTTGATGTGCCAAGG - Intergenic
1188357994 X:29216194-29216216 TTTTTGTTTTTGTTGAGACAGGG + Intronic
1188370639 X:29365676-29365698 TTTCTTTGTTTTTTGAGACAGGG - Intronic
1189625864 X:42895933-42895955 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1189637594 X:43027978-43028000 ATTGTTTGTTTTTTGAGACAGGG - Intergenic
1189756734 X:44279664-44279686 ATTGTGTTTTTGATAAGTCACGG - Intronic
1189784091 X:44543620-44543642 AGTCTTTGTTTTATGAGAAAAGG + Intergenic
1189838586 X:45046081-45046103 TTGCTGTGTTTAATGAGATAAGG - Intronic
1190042364 X:47081552-47081574 GTTTTGTTTTTGTTGAGACAGGG + Intronic
1190215141 X:48474937-48474959 TTTGTTTGTTTGTTGAGACAGGG + Intergenic
1190370261 X:49733525-49733547 ATTTTTTGTTTTTTGAGACAGGG - Intergenic
1191062711 X:56316786-56316808 ATTCTGTGCTGGATGATATATGG - Intergenic
1192571895 X:72212937-72212959 ATTCTTTTTTTTTTGAGACAGGG - Intronic
1192960077 X:76120797-76120819 ATTCTCTATTTAGTGAGACATGG - Intergenic
1193668898 X:84358977-84358999 ACTCTGTGTTGAGTGAGACATGG + Intronic
1194461725 X:94177825-94177847 ATTCAGTGTTGGTTGAGACAGGG + Intergenic
1194734697 X:97497998-97498020 ATTCTAGTTTTGATGAGCCATGG - Intronic
1194808853 X:98365074-98365096 ATTCTGTATTTTTAGAGACAGGG + Intergenic
1195162071 X:102180746-102180768 CTTCTGTGTATAATGGGACAAGG + Intergenic
1195894068 X:109727112-109727134 TTTTTGTGTATGATGAGAGATGG + Intronic
1196148715 X:112348199-112348221 TTTCTGTTTCTGATTAGACATGG + Intergenic
1198459655 X:136850892-136850914 TTTATTTGTTTTATGAGACAGGG + Intronic
1198977261 X:142350670-142350692 CTTATGTCTTTGATGAGAGAAGG - Intergenic
1200665604 Y:6018338-6018360 ATTCTGTGTTTTGTGAAACATGG - Intergenic
1201243434 Y:11980088-11980110 TTTGTATGTTTGTTGAGACAGGG - Intergenic
1201700358 Y:16874525-16874547 TTTCTATTTTTGAAGAGACAGGG + Intergenic
1201852321 Y:18498848-18498870 TTTGTGTGTTTATTGAGACATGG - Intergenic
1201881000 Y:18821536-18821558 TTTGTGTGTTTATTGAGACATGG + Intronic