ID: 1104732223

View in Genome Browser
Species Human (GRCh38)
Location 12:131113801-131113823
Sequence CAGGTCATGCGTGACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104732223_1104732228 9 Left 1104732223 12:131113801-131113823 CCCTCCAGGTCACGCATGACCTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1104732228 12:131113833-131113855 GCCTCTGTGACGCCCCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104732223 Original CRISPR CAGGTCATGCGTGACCTGGA GGG (reversed) Intronic
900140622 1:1138042-1138064 CACGTCCTGTGTGGCCTGGAGGG + Intergenic
900312680 1:2041752-2041774 CAGGTCAGGAGTGCCCTGCAGGG - Intergenic
901907652 1:12428218-12428240 CATGTCCTGCCTGACTTGGAAGG + Intronic
902662470 1:17914688-17914710 AAGGTCATGGGTGTCCTGGGGGG + Intergenic
902693008 1:18121973-18121995 CAGGTCCTGGGTCACCAGGATGG + Intronic
902749757 1:18499527-18499549 CAGGTCATGTGTGGACTTGAAGG - Intergenic
902955550 1:19922410-19922432 AGGGTCATGGTTGACCTGGAGGG + Intronic
903926027 1:26831373-26831395 CAGATCATGCCTGGCCTAGAAGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
908121190 1:60987631-60987653 CAGGTCATAAGTCACCTGGAAGG + Intronic
914848146 1:151294119-151294141 CAGGTGATGGGCGGCCTGGATGG - Exonic
916245011 1:162678639-162678661 CTGGCCATGCTTGTCCTGGAGGG + Intronic
916384271 1:164249815-164249837 CGGGTCATGCGTGGACTTGAAGG - Intergenic
917161156 1:172058195-172058217 CAAGTCCTGAGTGACCTGCAAGG + Intronic
919843496 1:201626370-201626392 CAGGTCAGGCATGACCAGGCTGG - Intronic
921773702 1:219072522-219072544 CAAGTCATGCCTTACATGGATGG - Intergenic
1067307002 10:45073246-45073268 CAGGTCCTGCAAGCCCTGGAGGG - Intergenic
1069860919 10:71471344-71471366 CAGGTCGTGAGTGACCTGCAGGG - Intronic
1074651949 10:115534245-115534267 CAAGTCCTGAGTGACCTGCAAGG - Intronic
1077596486 11:3536670-3536692 CAAGTCATGTCTCACCTGGATGG + Intergenic
1078461903 11:11520773-11520795 CAGGAAATGCCTGACCAGGAAGG - Intronic
1080974832 11:37326441-37326463 CAGGTCATGCCAGTCCTGGTAGG - Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1083752757 11:64770193-64770215 CAGATCATGGGTGACCTGCTGGG - Intronic
1084252396 11:67910644-67910666 CAAGTCATGTCTCACCTGGATGG + Intergenic
1084820453 11:71685388-71685410 CAAGTCATGTCTCACCTGGATGG - Intergenic
1088876605 11:113941636-113941658 CTGGTCATGCTTGACCAGTAGGG + Intronic
1089539836 11:119183152-119183174 CAGGTCTTGCGAGACTTGGGGGG + Exonic
1089581737 11:119485568-119485590 AAGGTCATGCATGCCATGGAGGG - Intergenic
1091079898 11:132656638-132656660 CTGGTCATGCATGCTCTGGAGGG - Intronic
1093943824 12:25085236-25085258 CAGATCACACGTGAGCTGGAAGG + Intronic
1096503063 12:52077111-52077133 CAGGGCATCAGTGATCTGGAAGG - Exonic
1100890424 12:99119615-99119637 CAGGTGATGCTTCACATGGAAGG - Intronic
1102552264 12:113700063-113700085 CATGTCATGAGGGACCTGGTGGG + Intergenic
1104601245 12:130154941-130154963 CATGACATGCGTGAGCTGTAAGG + Intergenic
1104732223 12:131113801-131113823 CAGGTCATGCGTGACCTGGAGGG - Intronic
1105761192 13:23515907-23515929 CAGATCCTACCTGACCTGGAGGG + Intergenic
1106583129 13:31034561-31034583 CAGGTCATCCGTGTCCAGAAAGG - Intergenic
1108612922 13:52101727-52101749 TAGCTCATGCATGACCTGCAGGG - Intronic
1115430245 14:33309240-33309262 CAGGTGAACCGTGACATGGAGGG - Intronic
1115577275 14:34723849-34723871 CATGCCATGCCTGGCCTGGAAGG + Intergenic
1116812061 14:49548656-49548678 CAAGTCATGCCTTACATGGATGG - Intergenic
1119871255 14:78019982-78020004 CAAGTCATGTCTTACCTGGATGG + Intergenic
1120721688 14:87895999-87896021 CAGGTCATGTGTGAGCTGTCGGG - Intronic
1120956899 14:90090838-90090860 CAAGTCATGCCTTACATGGATGG - Intronic
1128618103 15:69126093-69126115 CAGGTCATGCCTGACCCGGGAGG + Intergenic
1132556294 16:574199-574221 CAGGAGCTGCTTGACCTGGATGG - Exonic
1133312743 16:4860821-4860843 CAGGGCCTGCGGGAACTGGAGGG + Exonic
1136478157 16:30526070-30526092 CAGATCGTGTGAGACCTGGAAGG + Intronic
1136500116 16:30665722-30665744 CAGGTCCTGGGGGAGCTGGAAGG + Intronic
1137072036 16:35912131-35912153 CAGGTCATGGGTGAGCAGGAGGG - Intergenic
1141902645 16:87002712-87002734 CTGGTCATGGGGGCCCTGGAGGG - Intergenic
1142088124 16:88195309-88195331 CAGGTCATGCATGTCCAGAAAGG - Intergenic
1145273060 17:21414827-21414849 CAGGTCCTGCATGTCCTGGGGGG + Intronic
1152127262 17:78454679-78454701 CAGGCCATTCGTGATCGGGATGG + Exonic
1152772562 17:82179285-82179307 CAGGCCATGCGAGAGCAGGAGGG - Intronic
1154359196 18:13645119-13645141 CGGGGCATGCATGATCTGGAAGG - Exonic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1160956580 19:1695698-1695720 CAAGTCATGCCTTACATGGATGG - Intergenic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1164865350 19:31600013-31600035 CAGGTCCTTTGTGACCTTGATGG - Intergenic
1165538759 19:36472873-36472895 CAGGTAATGCGTGATTTGGCTGG - Intronic
925124175 2:1442076-1442098 CAGGTCATGTCTTACATGGATGG - Intronic
925611667 2:5706743-5706765 CTGGGCAGGTGTGACCTGGAAGG + Intergenic
927183570 2:20466489-20466511 CTGGTCATGCTTGACCTTAACGG + Intergenic
927264674 2:21132018-21132040 CAGGGAATGCGTCACCTAGAAGG + Intronic
927886761 2:26723552-26723574 CTGGTCATACCTGAGCTGGAGGG + Intronic
933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG + Intergenic
933934606 2:87192054-87192076 CAGGACCTGTGTGACCTGCAAGG + Intergenic
936358537 2:111773842-111773864 CAGGACCTGTGTGACCTGCAAGG - Intronic
940223932 2:151382490-151382512 GAGATCATCAGTGACCTGGATGG + Intergenic
942018912 2:171847455-171847477 CAGGTCCTGCGTGACATGAAAGG + Intronic
947671648 2:231940761-231940783 CGGGTCATGCAGGACCAGGATGG - Intergenic
1169206060 20:3740932-3740954 CAGGTGGTGGGTGACCTGGCTGG + Intronic
1173501762 20:43559021-43559043 CAGGTCATTCCTGACTGGGAAGG + Intronic
1173644161 20:44623095-44623117 CAGGTCATGGGTGCCCTAGCGGG + Intronic
1175524614 20:59624967-59624989 GATGTCATGCGGGATCTGGATGG - Intronic
1179368258 21:40779714-40779736 CAGGACTTGAGTGACCTGGAGGG + Intronic
1182876995 22:33700871-33700893 CAAGGCATGAGAGACCTGGAGGG + Intronic
1183579297 22:38714072-38714094 CAGGTGATGCGTGAGCAGGGTGG + Intronic
1183706003 22:39475295-39475317 CAGGTCCTGGGGCACCTGGAGGG + Intronic
960953581 3:123015435-123015457 CTGGTCAGGCCTCACCTGGAGGG + Intronic
961900082 3:130202001-130202023 CAAGTCATGTCTCACCTGGATGG + Intergenic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
967137951 3:186528438-186528460 CAAGTCATGCCTTACATGGATGG + Intergenic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
969250175 4:5962586-5962608 CAGATGGTGCGTGGCCTGGATGG - Intronic
971010551 4:22430070-22430092 CAAGTCATGCCTTACATGGATGG - Intronic
977347136 4:95830281-95830303 CAGGCAATGCTTGACCAGGAGGG - Intergenic
979985518 4:127309403-127309425 CAGGACAGGGGTGGCCTGGAAGG - Intergenic
988012310 5:25505273-25505295 CAAGTCATGTTTGACATGGATGG + Intergenic
989047162 5:37284332-37284354 CAAGTCATGCCTTACCTGAATGG + Intergenic
993896092 5:93536976-93536998 CAAGTCATGTCTTACCTGGATGG - Intergenic
995892269 5:116967740-116967762 CAGGTCATGTCTTACATGGATGG - Intergenic
999139137 5:149345838-149345860 GAGGTCATGCATGGCCTGGAAGG + Intronic
1003748617 6:9030620-9030642 CAAGTCATGCTTTACCTGGATGG - Intergenic
1006793911 6:36720432-36720454 GAGGCCAAGCGTGACCTGGCTGG + Exonic
1007795442 6:44343144-44343166 CAGGTCGTGCTTGAGATGGAGGG - Exonic
1009826917 6:68878849-68878871 CAAGTCATGCCTTACATGGATGG + Intronic
1012683347 6:102210551-102210573 CAGGTCATGTCTTACATGGATGG - Intergenic
1018890525 6:167978306-167978328 CGGGTCAGGCGGGACCAGGAAGG + Intergenic
1021024221 7:15643886-15643908 CAGGTGATGCTTGACCCCGAGGG - Intronic
1024336905 7:48217878-48217900 CAGGTAATGCTTGACCTGCCAGG - Intronic
1025141754 7:56472438-56472460 CAGGTGAGGCCTGGCCTGGATGG + Intergenic
1026294333 7:69038033-69038055 AATCTCATGCATGACCTGGAAGG + Intergenic
1028668013 7:93369504-93369526 CAGGTCATGTCTTACATGGATGG + Intergenic
1035966065 8:4193446-4193468 CAGGTCATGTTTTCCCTGGATGG + Intronic
1038276111 8:26122243-26122265 CAGGTCCTGTGTGTGCTGGAGGG - Intergenic
1039400472 8:37265091-37265113 CAGGGGATGCCTGAACTGGAAGG - Intergenic
1039845826 8:41324839-41324861 CAGGTCCTGCGTCACCAGGCGGG + Intergenic
1040408683 8:47133837-47133859 CAAGTCTTGCCTGATCTGGAGGG + Intergenic
1040471202 8:47737384-47737406 CAGCTCACGCGGGACCTGGCCGG - Exonic
1047512727 8:125528076-125528098 CAGGTCATGCTGGACATGGCAGG - Intergenic
1049448811 8:142647572-142647594 CAAGTCATGTGTGACATGGATGG - Intergenic
1050661918 9:7892086-7892108 CAAGTCATGTCTTACCTGGATGG + Intergenic
1060530721 9:124345881-124345903 CTGGACATGCGTCACCTGGGTGG + Intronic
1060990216 9:127844794-127844816 CAGCTCCTGCCTTACCTGGAGGG - Intronic
1186672976 X:11785630-11785652 CAGTACATGGGTCACCTGGATGG - Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1190152268 X:47958233-47958255 CAGGCCATGGCTGCCCTGGATGG - Intronic
1190160394 X:48027895-48027917 CAGGCCATGGCTGCCCTGGATGG + Intronic
1192928975 X:75784848-75784870 CAGGTCATTCGGGTCCTGAACGG + Exonic
1193796800 X:85887352-85887374 CAAGTCATGTGTTACATGGATGG - Intronic
1197170868 X:123432514-123432536 CAGGTTATACATGACCTGGCTGG - Intronic
1198685782 X:139226722-139226744 CAGGTGATGTTTGAACTGGAAGG + Intergenic
1201402670 Y:13620169-13620191 CAAGTCATGTGTTACATGGATGG + Intergenic